Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00002174 (transcript) - C. hemisphaerica

Overview
NameTCONS_00002174
Unique NameTCONS_00002174
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1560

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00002174 ID=TCONS_00002174|Name=TCONS_00002174|organism=Clytia hemisphaerica|type=transcript|length=1560bp
TACATCGTTGAGAATTCGAGAAGATGGTCAGAAAAAtATTTGCCGTTTTG
GCATTGCTCGTTCACCAAACAATAGCTGCAGAAACTTGTTTTCGATCAAA
CTGCAAAAAAGAAGGGAGTTCTGATTCGCTTACCATAAATCACGCGTCTT
TCACTCAAGTTCCCGATCAAAAGATTGACCCTGCTTGGCCAATCAACGAA
ACGTTACAAGTCTCGGGAACACAAGAAGAACGCATAAGAGCGTGCACTGA
AAGATGCACAAAGATAGGAATACATGGCTGCAGGAGTGGAAATCTGAGCC
CTTATCAAGAAAACGCACCGTCAACATgtgatttgtttacatatgGTATT
TACGCTCATAGTATTCATTTGGTTCCACTTTTGCGTATAGTGAGCACAGG
ATGGACCTCTTTTCACTTGTTTAATTCGTTTTGTGAAGGCTATCCATGTC
AGAATGGAGGAATTTGTTATCCGCATTTCCTCACTGATGAAGGTTATTGC
AAATGCACAGGTTACTCTGGAACGCTCTGTCAAACTCTCGACCCGTTGCA
CCATGAAGAAGCAGGTCATTGGACGTTCGATGATTACACTTTATCCAATA
CTGGAATTGGTGCAAATACACTCGCTACCAGTGAGAGTGGTGATGGAATA
GTATTAGAAACTCTTGAGCGAGATTCTCCTGTTCTTCAATGTCAAACAAC
AAATTGTCTGACCATCGACAACACCAATATGCCTTGTTTGAAGGATTACA
CATCCCCGTATGGATGCACCACTGGAGTGACTTTTGGTTTCTGGTTGCGA
CCTCTCTGGAAAACAACAGGAGGATCATTCAATTACCTCATTCAGGGAAA
AGCAACCAAACAAGGATTAACTTTTAATTCAGTTACCAACAGTGACATCC
GTCTTCATATCGAAACATCAAGCACACGACACATGTGCACCTTACCATTT
GCAACCTATAAACCCAACTGGTTCAAAGCATGGACTTTTATTGCAGTGAC
CTGGGACCCTACAAACAGAAAATGGGAATGCATCATGGACAATCACATCA
TTCAAATAACAAGCTCATCAGTGACCTCATCTTCGAATGGTCCGATCGTT
TTCGGCAATCAAGGAAGCGATGAAACTAAATTTTTGATAGACGATGTCGT
ATACTATCCTCTGTATTCAACTCCCGAAATGATTTCTGCTGTAATGGACT
TGACGAAATCAGGACGAAATTAATGGTAACAAACTAAATGAAGCGGCATA
AAGgaaattctttaaaacaatATACCAGAAAAAGTTCATTTGAAGTCATC
CAATAAGCTGGATAAAGACAAAATGTGTGAAGGAGAAAACATTGGATCGA
TTGTTACATTTGTTTTGGACAGAAAGAGGCCCATctgattgggcttttcc
agaaatagacCATGCCAAAAACCGTTAACCCCCtagatatccgatatcct
caattcctcaattcacgcagaagatgcaatttttggtcaattttagacca
aaatgtggcgaaaagtggaacttgcgcatgaaatatctcgagttaggtaa
tgaaatcggc
Run BLAST on NCBI

transcript from alignment at sc0000018:940959..956526-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00002174 ID=TCONS_00002174|Name=TCONS_00002174|organism=Clytia hemisphaerica|type=transcript|length=15568bp|location=Sequence derived from alignment at sc0000018:940959..956526- (Clytia hemisphaerica)
TACATCGTTGAGAATTCGAGAAGATGGTCAGAAAAATGTAAGATTTTTAA ATTTTTCGCTCGATTACCCTTTAGAATAATTTACAAAAATTCATAAGTCA CAGCCATAACAAATTAGTTGATTCTGTCTGTAGACCTTATCGGAGTTTTT CATTTTTCTAAAAAAGCGATGCACTGTGGGATTGTTTCGAGTGTATTACA ATAGAATTCCCTCGAGGAATTCCTATAGATTTCTATTGTAATAAACTCGA AATAAAACGTTAGACTCTATCAAAATTGTGAAAAAATCTCAGTTTGTGAC GTCAGTGTTCGAGTCGTATGTAAAGCAAACCATTATAAGGGTGTATTCGA TCAGTGTGTAACACAACGCTGAAATGCTGAAATGCTAAAAAAATGATAGT GGTGACGCCATAACCTGAACCTTTTATGATATTGATGAAGTCCAAAATCA TTCACTATTAATTTGAAGACTTTTTAAGCTCCCTTCAATGTGTTTAAATG ATCAAAATAGATGAAAATGGGCAAAAATAGCAATTTTTACCCCCTGAAAC CCTGAAAATTGCCAATGATGACGTCACAAACTGAGATTTTTTCACAATTT TGATTGAGTCTAACGTTTTCCATATTTTTAAGGAGTTTTTAAAGATTTTG AAAGTTTTCAAATTGGTTTAAATGGTCAAAACAGGCCAAAAATAGGCAAA AATGGCTGTTTTTTGCCCATTTTTGTTCAGACAAACCCCCGGAAATTTCT TTTCGAAAAAATTAATTTTTCAAATAGTTGTTCTACTTATTTTGAGTATT TCTGCAAAATTTCAAGTCATTTTCTTGGCTAGTTCAAAAGATATTGTCTG ATGTTGTTGACAGGAAAACGGCTTCTCCATAGTATTTCTTACCCTGGCGC TTTAGGACCCCCTACTTCAGACCCTCTGGAGACCAAAAGCCCCCTCTAAA CGCTATTTACCTTTCGATTCCATAAACAAGTGAAGTTAAGCAACACGAAA ATCGTATTGTAATTTAGGACCCCCCTAGGTGGTGCTACCCCGCACTCAGG AGCTGGTCTATATTCTGTTCTATTTTTTAATTTCTCGTTTGCTTTTTTTT CCGATCGGTCGAATCACTACCCCCTGGTTTTAACAATCTTTAAACCGAGC GATTTTCAACATTTTCAGAGCGGGTTACAGAAAAAAAATTTATAGTTATT AGTGCTCTTGACAAATAACAATTCAACATTACATCTTGTTAACCGGTTAC TTTTTCGAAGCGGGCTACATGGCTTTTTGCGCAATGCAATTGGTTCGTTT CGCATGACGACGGGCCTACATTGTCCAGAGTTGCCCGTCGTTAGGAAAAT TCATTGTGACGTCACTTTTTCAAAGGAAAATGAACAATGCGTTGACATCA TTTCTCTCATTTTTTATTTCTGACGTCAGAAATTATAGCAATTTTTTATC TCTTTTCGCTTGTTTTTTCTGCTTTATTTCGCTATTTTTCCTGGATAAAG CGCTAAAAATCAATCAAAGTTGAAGGAAACGGTTAACAAATACAATAATG ACCGGTTTTTTCGGGCTGTACTGAAAATATTGCCCTCGGTCCACGCAACA ACCTCGCAAGCTCGGTCGTTACTTGACCTCGGGCAATATTTCTCAGTACA GCCCTCACTAACCGGTCATTATTGTATTAATAATCATTATAAAAAAACCC TGGTCTGATAATGCATTTTTTTAGCTTTATTGTCAAATTTTCTTTTATTG TAAATAAAAGGCGAGTTGCGATTTGCATACTTTTTGATCACGTTACCATT TTTGACTCTTGGGATTGGTTTATTTCCTAGTCGCATGATCAAAAACTATA CAAAAACAATCTATTTAAGGGCTCTGACCATAGTGAATTTTTCATAATTG CCGTGTTTAAAATGTGTTTTCTGACTGATGTAACCAACAAAACTATGACA TGTTATACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCAAAAATTGCATT GAAAAAATTTGATGAAGAAGAAAATGAAGACTTTTGCGAGGAAGATTATT TCAACTTTGAAGAGCTTAGTTTCGGCAAAGAAAAAACATTTTGAAAATTT TTTCGCAGTAGATGGTGTATCTTTTACCGAACAATAAAAACTTTTGCTGA AAATTTTTGTAAATGCTTCTTTGTCTCGAAATCTTCAAAATAGTGGTTTT TCATCAATTTTTCATCTGGATTTTGCTTAAAAAACAGTCATAACTTTTGA CACATCTTTTTAGAAAAATTTTCCGCAAAATTTAAAATAGTTCAATTCTT TGCGGACAGTGTAAAGACATTTTGAAACAAAAAGTTTAATTACCCATTAA AACTTAGCACTTTTTATAAAAGAAGGTGATGCAACATATTATCAACGTCT TTTTAAAGTTCATAACGTCATTTCTACAATTAAATTCTTAATTACTCTGC AATTTATAAATGTAATTCTTTGTTGAAAGTGTTGAAAGAACCTAAAACAT AACTTTTATGTTCAAATACTAAAATCAATTTTCCGACTATGGTCAGAGCC CTTAAGGGGAAAAAACTAACTTTTATAGCTGTTACTTTAATGGGATAAAC GACAAAACGACGATAGAAATTTTGAATTTTTGCGAATCGAAAAAAGATTT CAAATTTTTCGCAGGTATTTGATTTCACAGAGGCCCTTCCGAAATTTCCA TTGGGACTTATTAATCTCACAGATTTTCGCGAAATTTAATCTTCGCGAAA GTTTATCCCATTAAAGTAACAATAGAAAGAAAAAAAGCACTCCAGACCGG TTTTTTTTCATAATGACTATGCTGACATGGTATTCAAATGAAAAATACTC TCTCCTACTCTTAAAAATAGATTTGCCGTTTTGGCATTGCTCGTTCACCA AACAATAGCTGCAGAAACTTGTTTTCGATCAAACTGCAAAAAAGAAGGGA GTTCTGATTCGCTTACCATAAATCACGCGTCTTTCACTCAAGTTCCCGAT CAAAAGATTGACCCTGCTTGGCCAATCAACGAAACGTTACAAGTCTCGGG AACACAAGAAGAACGCATAAGAGCGTGCACTGAAAGATGCACAAAGATAG GAATACATGGCTGCAGGAGTGGAAATCTGAGCCCTTATCAAGAAAACGCA CCGTCAACATGTGATTTGTTTACATATGGTATTTACGCTCATAGTATTCA TTTGGTTCCACTTTTGCGTATAGTGAGCACAGGATGGACCTCTTTTCACT TGTTTGTAAGTAAATCTATTGCAGTTTTTTTTCACTTGGTTTCACATGTC GTCTCCTATGAATCCTTCGTTTTTGTATACCATGGGCAAAATTAATTTAG ACCACTTATTTAATGTTTGGACCGTGGTTCAATTTGCTAAGAAGTAACTA ACTAAGAATGTACTTCTGTAGTGCCAAAAAGAACCCATTAAGTACCACTG GCATCATAATGGGATTGCTTGTTTTTTACATATTGTTTCATTTTGAAGTT AGGTGGTGATTACCATAATGGAGAGAAGTGAACTGAATTTGATCATTTTT ACCGTAGAATTCGTTTTGTGAAGGCTATCCATGTCAGAATGGAGGAATTT GTTATCCGCATTTCCTCACTGATGAAGGTTATTGCAAATGCACAGGTTAC TCTGGAACGCTCTGTCAAACTCTCGGTAAGCTCCTTTGTCTTTGACTGCA CCTTGGATAGCCAAAGAACACCTTGGCTTTCATCACCCTAAGTGAAATTT AACCCTATTACTCTCGGGTACCTAATAGCCTGGGGGGGGTGGGGGTTCGG AATAAGCGAAATTAGGGCAAAAGAGGGAGCTTTCAAAAACATTTTCCCAA AAATTAATAAGCGGGGGGGGGAGGGTTGGAATAAAAATGTCCTGGGTGGA AAATTTTCGAAAAATTAATTAGCAGGGGGACGGCTATTAGGTACCCGAGA GTAACCCCAGGGGGGTAGAATCTACACATTTATGTATATCTCAGAGCCAT TTTTTTAAACGACTTGAAACTTTTTGACTTTCAATAAAATCTTATTAAGA GTACATGTGTAAAATTTTAGGGTGAATCAGGATTTATCAGGTTTTATGAC TTATATTGTGAAACATGACATAAAACCTAGCTAAAATCGCTTAAAACACA ATATTTCATATTCAATAATTTTCAAATTTTGACACGTGATAGGCATTAAT AATATAAATTTGAAAAAATAAAATTTCTTGTTTGAAAATCATGACGTCAA CATTTATGACGTCATCAAATTTTGAAAATCTTACTCATCTTCAGCATAGA TTTTTAAGAAAAAATCTTTATGGAGAATGCAAAACTGGCAATTATGTTAA AGGGCAGCCTTTTATCTTTCAGAATCTTCAAACAAAATGTAAATACCTTC ATTGTTCGACTGTGACAGACACTTTTGTAAACCATATATTTCGATTTTTT CCGACAGGTGGAAATTTTGTGACGACGCCATCACTTTTTGAGTTACGTTA TGGAATTCTTTTTTCTTCCTTGAAATTTGTGTCATGATGGAAAACATCCG TACTGTAATTTCATGACCATAGCACTTCTAGATAAAAAATAATCAAGGAA AATCATAAAGACTGATGAAAAAACCAAACTTTTACGCCCGTATACTCGTG TGTAGAATATGGTTCAAATGAGGAATAAATAAAAGGATCTACAATTCCAA TTTGTTTCATTCCTTTTCATCAAGATCTGTGATTTCTTTCAACCATAGAC CCGTTGCACCATGAAGAAGCAGGTCATTGGACGTTCGATGATTACACTTT ATCCAATACTGGAATTGGTGCAAATACACTCGCTACCAGTGAGAGTGGTG ATGGAATAGTATTAGAAACTCTTGAGCGAGATTCTCCTGTTCTTCAATGT CAAACAACAAATTGTCTGACCATCGACAACACCAATATGCCTTGTTTGAA GTAAGAATAAACAGGCATTCTTTTAAATGGAAATGTCATACTTATAAGAA AAGTAGTAGCGTTTTGGTAAACTATGATTCGGGGCGAAACTGTTTATGTA ACAAAACATTTTAATGAGTTAAACTCAGGGGAAAGGGGGTTCAATCAAGA AAAACGTTCTGCTGGCCAGGGTCCGATATAGAATCTGAGAGGGTCAACTT TTGATTATTTCGGACAATTTTCAGGGTGGAAATTAGGAAATTTTTTGATT TTGCATCTTCTTATAGTCAATTTTGACTACTTTTATAGGGTGAAAATTGG ATTATTTTAGCTTGTTTTGATAGGGTCTCTAATTTACCAAACATGTACAT TTGACAGGGGGTACAATCAAAGTGATAACTCTGAGTTCTAACGCTAGACT TAAGACTTAAGGTGCTTAGGATCTGAGGAACTAAAAGTCCAAGAATGGTT CAATAGGGCTCAGAATATAGCCTGGAAGTCTATAAACCCTCCCGAATTGA CATATTCGAATAAACTTATCAATTTTTCCGAAAGCAATTTTTTCGCCCGA ACTTTAAATTGCTGAAAACGAGGAATTAACCAAATTCGAACCAAAATTCC CAATATATTTTGACCGAGATTGTACTTTCCAAACTCTAGAGGCACCTCTC CGTCGGCTTTTAAGGTCGGTTACCCCATCCCCCAGTGCCTGTGTATCTCT TAAAATGATGTAATTTATGCATTTTATAATTTTTCATTCTGATGAATAGC ATACCGCAGTAATTCTAAAAACAAACATCAAAATTACTGTGGCTGTTTTT CCGGCGGCTTAAACTAACAGGATTAACAGGATTAACAGAAGGTGTAATAA AACGCTGAATAGCCCAAAACTAGTCATATAAGCTGTGGATGAAAAGAGAT AGTTATACACGTTTATGTTTTCTTTTGTAAAAAATAATTTCATCTCCCAC GGCAAATCTTTTGTATTTCCTGATCCACCTATCCTCGCTCTTTTTTTCTC TCATACATGCCCTCGACCATGTATTAGTGGATTAGAAAATTATATGAATA GTTTGGGGTATTTTTCCACTGACGGCTTAAGCTAATTGGATTAATGTAAC TTTTTGATAAAATGATGAATAGCCAAACCAGCTCAAACTTATTCATAAAA ATTTTGGACGAAAAGAGATGGTTACACGTTAATTTTTTTTTTAAGAAAAA TATTGTATTTCCCAAAGCAACACAGAAGAAAAACCGTTCGTGTCCGGAAA AAAGTATCGAGTCGTATCACTTCTACAGGGTGTCCCTAATTAAAGTATCG AGTCGAAACACAACTATGAGTAGCAAGTTTTATGTGCATGTTCACAAAAT TGTATTTTAAGCTCTCCCTCTTTTTTCTTTGTCATTACGATTAATTTATA CGTTGTAACTACCTTTTGTAATAAGCCNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTCATATTCAATAATTT TCAAATTTTGACACGTGATAGGCATTAATAATATAAATTTGAAAAAATAA AATTTCTTGTTTGAAAATCATGACGTCAACATTTATGACGTCATCAAATT TTGAAAATCTTACTCATCTTCAGCATAGATTTTTAAGAAAAAATCTTTAT GGAGAATGCAAAACTGGCAATTATGTTAAAGGGCAGCCTTTTATCTTTCA GAATCTTCAAACAAAATGTAAATACCTTCATTGTTCGACTGTGACAGACA CTTTTGTAAACCATATATTTCGATTTTTTCCGACAGGTGGAAATTTTGTG ACGACGCCATCACTTTTTGAGTTACGTTATGGAATTCTTTTTTCTTCCTT GAAATTTGTGTCATGATGGAAAACATCCGTACTGTAATTTCATGACCATA GCACTTCTAGATAAAAAATAATCAAGGAAAATCATAAAGACTGATGAAAA AACCAAACTTTTACGCCCGTATACTCGTGTGTAGAATATGGTTCAAATGA GGAATAAATAAAAGGATCTACAATTCCAATTTGTTTCATTCCTTTTCATC AAGATCTGTGATTTCTTTCAACCATAGACCCGTTGCACCATGAAGAAGCA GGTCATTGGACGTTCGATGATTACACTTTATCCAATACTGGAATTGGTGC AAATACACTCGCTACCAGTGAGAGTGGTGATGGAATAGTATTAGAAACTC TTGAGCGAGATTCTCCTGTTCTTCAATGTCAAACAACAAATTGTCTGACC ATCGACAACACCAATATGCCTTGTTTGAAGTAAGAATAAACAGGCATTCT TTTAAATGGAAATGTCATACTTATAAGAAAAGTAGTAGCGTTTTGGTAAA CTATGATTCGGGGCGAAACTGTTTATGTAACAAAACATTTTAATGAGTTA AACTCAGGGGAAAGGGGGTTCAATCAAGAAAAACGTTCTGCTGGCCAGGG TCCGATATAGAATCTGAGAGGGTCAACTTTTGATTATTTCGGACAATTTT CAGGGTGGAAATTAGGAAATTTTTTGATTTTGCATCTTCTTATAGTCAAT TTTGACTACTTTTATAGGGTGAAAATTGGATTATTTTAGCTTGTTTTGAT AGGGTCTCTAATTTACCAAACATGTACATTTGACAGGGGGTACAATCAAA GTGATAACTCTGAGTTCTAACGCTAGACTTAAGACTTAAGGTGCTTAGGA TCTGAGGAACTAAAAGTCCAAGAATGGTTCAATAGGGCTCAGAATATAGC CTGGAAGTCTATAAACCCTCCCGAATTGACATATTCGAATAAACTTATCA ATTTTTCCGAAAGCAATTTTTTCGCCCGAACTTTAAATTGCTGAAAACGA GGAATTAACCAAATTCGAACCAAAATTCCCAATATATTTTGACCGAGATT GTACTTTCCAAACTCTAGAGGCACCTCTCCGTCGGCTTTTAAGGTCGGTT ACCCCATCCCCCAGTGCCTGTGTATCTCTTAAAATGATGTAATTTATGCA TTTTATAATTTTTCATTCTGATGAATAGCATACCGCAGTAATTCTAAAAA CAAACATCAAAATTACTGTGGCTGTTTTTCCGGCGGCTTAAACTAACAGG ATTAACAGGATTAACAGAAGGTGTAATAAAACGCTGAATAGCCCAAAACT AGTCATATAAGCTGTGGATGAAAAGAGATAGTTATACACGTTTATGTTTT CTTTTGTAAAAAATAATTTCATCTCCCACGGCAAATCTTTTGTATTTCCT GATCCACCTATCCTCGCTCTTTTTTTCTCTCATACATGCCCTCGACCATG TATTAGTGGATTAGAAAATTATATGAATAGTTTGGGGTATTTTTCCACTG ACGGCTTAAGCTAATTGGATTAATGTAACTTTTTGATAAAATGATGAATA GCCAAACCAGCTCAAACTTATTCATAAAAATTTTGGACGAAAAGAGATGG TTACACGTTAATTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAACTACCT TTTGTAATAAGCCTGTGTGATGGAGAACGTTCTTATATTTTAGCGATAAC ACACACAAACTTTTCTACTCAATCGCATGTTCAGACTCGATACTTTAATT AGGGACACCCTGTATAAAAAGAAAGTTCATATATGTGTTTCACTAAATTT GCAATGTTTATCAAAGTTTATCTTTTTGTCATATTAATTGTCAGGAGACA TATTTGATATGAATAACTTTACAAAATACAATTCTAAATAACTTTAACGT CATAAAAATTGTAAAGAAAGTAAATTCTTTTTAATCATAATGACTGTTGT AAAAACAATTATTGTGTTGGTATATATTGTCTTACATTTTGTTAAACACA ACAACAACCTTCTACTCCGAATCATGTTCGAACTCGATACTTTTTTGCGG ACACCCTGTACATGGTCGAGGGCGTGTATGAGAAAACAAAAGAGCGAGGA TAAGCGGATCAGGAAATACAAAAGATTTTTCGGTTTTCTCATGTGGCTGC ATTTAGACCAGCCTGGCATTTGTAATTGCTGGCAGTATTCTTTTGAATTC TATTGTTCCGCGCAATTGTTCGGTTTTTCAAATGCCTAATGATGCCAGCG TGTTGGCATTTGAAATGCCATTTTGAGCAAAGGAATCCCCTTTTCTGGCA TTTCAAATCAAACAAAGGAACCAAAACAAAGAGAAAAAATGACATTTTTG ATTTTTTAAAGTATTTGCACGTTTTTTATTCAGTTCTTTCTATAGATTGT AAAAGTTGCAAGATTTGCCATAGCCTAGCCCTACGGCAAAAAGTTTCAGT TTTAATGACTGCAGTTTTTGAGAAATTTCATGCTTTTCATTGTTTGATCT GTCAAAGTTGAACTTAAGGGAATCACCTTTTCAGTAATGACTCTAAAAAG ACGATTCCTTAAATGCCATGACAGAAAATACAAGTAATAACTTGCACGAA TCAAGACGAAAAGGATTGTGGGATTGAATTTCGGTCAACTGTTAAAAGTA ATAATTATGACGTTTGTATAGCGGTGTGCTATTGAAATCTTTCTCATATG ACATATGTTAGAGTGTTCTGTGGGTCACATATACTTCACGCACAAATAAT TCGAAAGAATATAACACTCAAAAAGAGCTCTCTTTATCCTTTTACAATAG GGATTACACATCCCCGTATGGATGCACCACTGGAGTGACTTTTGGTTTCT GGTTGCGACCTCTCTGGAAAACAACAGGAGGATCATTCAATTACCTCATT CAGGGAAAAGCAACCAAACAAGGATTAACTTTTAATTCAGTTACCAACAG TGACATCCGGTAAGATATCAAGATTCCCTAAAATTCCTACAGCAAGTATC ACAAGTATACTACACTGTGACGACGAACCACGATTCTTTTGAGCACGCAT CCAACAAACGAGATTAAAAGTCAGTCCTGGCAGTTTAGATTTCAGGTATC CCCTTTGTTGAGTAGGTCTATTTTGGGAAAATAAACCCTCTGGATTGTTT TTTCATTTTTTCACATGAATTAGTTTTTCTCATTCTATGACTACCTTGGA TTTTTCGACCTTGTTTTACTGACCACCCTGGGTTTTCAACCTCATTTTAC TGACATCCCTGGACTTTTACACTTGAAAAACTACCCCTTTGGATTTTTAA GAACACTCTACTCGTCACACCTCCTCAACATAGGAGGGTACCAGACTATT TCTCAAATAACCCATTATGTGTCACAACACTTTGCAACTAACACCATGGA TTTCTAAATTCAAGGACGGTAGCAGATGTCCTTTGACGTAAAAATCCTAT GGCCTCAAAATATAGATGTCCCTGTATTGTGACGTCAATTGGTTTACAAA AATCTAATTTTAAATTGGCATGATTTTTATCACTGATAGATGTTGATACA ATACTTAAACCCTTTTGGCAACTGCTTGGCAAGCAGTATTAGCATCGTCA AAAGAGAGCCAAGGGACTAGGTCCGAGTTTGTGAATTTCAAAGAAATTTT TGTTGGGTGATTTCGGTCATCGTTTATTAGGGGAAAAATTGACGAAATGA CGTAACCAAATCCCAGCTGACATAGAATGTCCATCTAATGTCAACTTGAC GTCCCTAACGTCCGTATAACGTTAAATGAACGTTCAAACAACGTTGTGTT ATTGTTGGGATTGAAACTCCGCTACTCTATACTTACTTTGTACCAGAGTG TATCTCAAGTATATCGTTTGGTACTCTATGCGCATTGTCTTTCTGAAAAT AATTTCCGTACGGAAACTTCTGTGCTGAAGGAGATATCGGGTCTGTGTAC GGACTACTATACACTAATTCTGTTTCATAGTCTTCATATCGAAACATCAA GCACACGACACATGTGCACCTTACCATTTGCAACCTATAAACCCAACTGG TTCAAAGCATGGACTTTTATTGCAGTGACCTGGGACCCTACAAACAGAAA ATGGTGAGTGATTTTGGAGACGTCAGGTTTAGCAATAACAACAGATAGAT ACTTTAACAAGACAAATTTTAAGAGGTTTAATTTTGCGTTTTGGCGGAAA TTAATTACAAGTAAGTAATTTTAGTAGTAGCCTTATAAAGCAATGCGAGT GAAGATGATTCTCGTCATGATATCTTCACATCACTCAAAATGTATCTCTC ACAGTTGATGATTATACATTTCACGATAGAAAAAATTAACTCCAGTCGGA ATAGACACTCGATCTGAAAACTACCATACACGTTTTTTGTTTATAAGAAC ATCCAAAATTTTTGAAGCCTGCGGATGTTCTTAACTTTTTGAGTTTTGAG CCTAAAAACTTTCTTAGCATGTTCTTATTTTCAATATTTTTTAGGCATTT TTGTCCCATATTCCTAAGAAACTGGGAAGAGCCCCAAAAGCCTTAAAATG TTCTCAACTTGTTCTTAACATTTTGGCCATCGAAGCCTTATGTTCTTATA TAGTTTGTTCTTATTAAAAAAAGTGTATGTGCGAATAAAAAGATGAGAAT GTATTTTTAGAGTAGCATTTCGTTGTTTCTAAATAGTGTTTATAAATAGA CCTTATCGGAGTTTTTGATTTTTCTAAAAAAGTAATGCATTGTGGGATTG TTTCGAGTGTATTACAATAGAAATCTCCTAGGAATTCCTCGAGAGAATTC TATTTTAATACATTCGAAACAATCCCACAATGCATCGCTTTTTTAGAAAA ATCAAAAACTCCGATAAGGTCTATTGTCGGACTTTCTTTCTTTTTATGTC AATCAGGGAATGCATCATGGACAATCACATCATTCAAATAACAAGCTCAT CAGTGACCTCATCTTCGAATGGTCCGATCGTTTTCGGCAATCAAGGAAGC GATGAAACTAAATTTTTGATAGACGATGTCGTATACTATCCTCTGTATTC AACTCCCGAAATGATTTCTGCTGTAATGGACTTGAGTAAGTACTGTAAAT AATTGGCCATCCCAGTTCCTTAGTTCACTTACGAAAATTTATGTCGCAAA TTAAATTGCATCAGCCCCCCCCCCCCCTTAAAGGGGTTTTTTAAAACCAA AACATTTTGAGAAACTTTGAAGTTAAGAAAGCAGAATTAAGTCTCTAAGT TAAACATTTCGCAATCACAAACCTACACTATTTTCCAATTGTGCGCCTTC AGGCCCGAGACTTCAGCCTCCCAACTTTGAGAAAATGAATTTTTTTTCTC AAATATCTAGCGAATTTATCTCGTTTTGAGCCTTCAGCCTTCCAAATTTT ATGGTTGTACCGCTGGGTCTGGGCCTTATACTTATCTAATTTATTTCCTT GTCATTTTCAGCGAAATCAGGACGAAATTAATGGTAACAAACTAAATGAA GCGGCATAAAGGAAATTCTTTAAAACAATATACCAGAAAAAGTTCATTTG AAGTCATCCAATAAGCTGGATAAAGACAAAATGTGTGAAGGAGAAAACAT TGGATCGATTGTTACATTTGTTTTGGACAGAAAGAGGCCCATCTGATTGG GCTTTTCCAGAAATAGACCATGCCAAAAACCGTTAACCCCCTAGATATCC GATATCCTCAATTCCTCAATTCACGCAGAAGATGCAATTTTTGGTCAATT TTAGACCAAAATGTGGCGAAAAGTGGAACTTGCGCATGAAATATCTCGAG TTAGGTAATGAAATCGGC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001132XLOC_001132Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00002174-exon-sc0000018-1575043694:956490..956526TCONS_00002174-exon-sc0000018-1575043694:956490..956526Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1575043694:953172..953556TCONS_00002174-exon-sc0000018-1575043694:953172..953556Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1575043694:952752..952869TCONS_00002174-exon-sc0000018-1575043694:952752..952869Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1575043694:951477..951678TCONS_00002174-exon-sc0000018-1575043694:951477..951678Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1575043694:943818..943976TCONS_00002174-exon-sc0000018-1575043694:943818..943976Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1575043694:942674..942796TCONS_00002174-exon-sc0000018-1575043694:942674..942796Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1575043694:941692..941870TCONS_00002174-exon-sc0000018-1575043694:941692..941870Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1575043694:940959..941315TCONS_00002174-exon-sc0000018-1575043694:940959..941315Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:956490..956526TCONS_00002174-exon-sc0000018-1510915933:956490..956526Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:953172..953556TCONS_00002174-exon-sc0000018-1510915933:953172..953556Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:952752..952869TCONS_00002174-exon-sc0000018-1510915933:952752..952869Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:951477..951678TCONS_00002174-exon-sc0000018-1510915933:951477..951678Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:943818..943976TCONS_00002174-exon-sc0000018-1510915933:943818..943976Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:942674..942796TCONS_00002174-exon-sc0000018-1510915933:942674..942796Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:941692..941870TCONS_00002174-exon-sc0000018-1510915933:941692..941870Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1510915933:940959..941315TCONS_00002174-exon-sc0000018-1510915933:940959..941315Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:956490..956526TCONS_00002174-exon-sc0000018-1491911889:956490..956526Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:953172..953556TCONS_00002174-exon-sc0000018-1491911889:953172..953556Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:952752..952869TCONS_00002174-exon-sc0000018-1491911889:952752..952869Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:951477..951678TCONS_00002174-exon-sc0000018-1491911889:951477..951678Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:943818..943976TCONS_00002174-exon-sc0000018-1491911889:943818..943976Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:942674..942796TCONS_00002174-exon-sc0000018-1491911889:942674..942796Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:941692..941870TCONS_00002174-exon-sc0000018-1491911889:941692..941870Clytia hemisphaericaexon
TCONS_00002174-exon-sc0000018-1491911889:940959..941315TCONS_00002174-exon-sc0000018-1491911889:940959..941315Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000018supercontigsc0000018:940959..956526 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.000541067 0.00112678 0.000727498 0.00114965 0.000274298 0.000151145 0.000247641 0.000886789 0.000113696 0.000619621 0.00148884 0.0995051 8.40723 6.06349 0.00514683 1.96024 0.000696111 0.00047175 5.71915 13.068 0.562033 0.560477 4.75529e-07 0.000634742 0 0 0.106064 0.000168873 0.000503306 0.00184621
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00002174 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top