Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00002060 (transcript) - C. hemisphaerica

Overview
NameTCONS_00002060
Unique NameTCONS_00002060
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2602

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00002060 ID=TCONS_00002060|Name=TCONS_00002060|organism=Clytia hemisphaerica|type=transcript|length=2602bp
ttgagaataagggattgcaaatctgttaatcgtgtttgtttctcattttt
gattatatccttcaactccaagtagttttattgttatttagatttttaat
tttttttttcaaaatggcgacctcgccaaatgctcctagtctacttgact
ggactcagcgtcataaaaaattatcaaaaagcaaagttcagccagaagta
gactctagtctaggggtcatgtaaaaattcaaaacaaaaaaggggGAGTA
TTTTTCTTTACTTGGCTCTCTCCCCGAGTTGATTTTAACAGGATAACAGA
ACAAAATGGCGGACCGACTAAGGGATGAACTCAATGATTCTaaagaagag
gaagaagaaaaCTTTTGGAAGCAAATTTTACGAGAAGTATCAGCAAAATC
ATCTAGAAGATTTCCTTCTTGCAAAAGAATCTTGGTGTTAGGGAACGATG
GAACAGGTAAAACAAGTCTGGTCATGAAATTGAGGAGGTCTGGGGACGAT
TTATTGCGTGGTTCAGGATTGGAATATACCTACCTTGATGTGGATGACGA
AGAACGAGATGaacACACCAGGCTCAGTGTTTGGATACAATCAGGAGAAG
CACACATCAAGGACCTCATGAAATATGTCATCACCAAGGAATCTATACAC
CATTCTCTCATCTTATTATGCATTGATATCTCGAAACCATGGAACATGCT
TGACCAACTGGAAAACCATGTCAATATTTTACGTCAGCACTTACACACTT
TAAATATTTCGGCAAAAATTTTAAACGAACTCGAAAAACAAGTTCTTCGA
GATTTTCACATGTACAAATACAATGACGAGGAAAACAAACGGTTGAGTTC
CAACATGGAGCAAGACGAACAAGAGATGAACCAACTAGCAGAAAATATGA
TCGTTGATAATATTGGTCTCCCTATCGTCGTTGCTGTCACTAAGACGGAC
AACATGTCTTCCCTCGAACAAGAACACGACTACCGTGAAGAACATTTCga
tttcatccaaaaaaatCTACGAAAATTCTGCCTCAAATGCGGGGCATCAT
TAATATATACTTCGACCAAAGAGAATTGCAACACATCCGTTTTATATAAA
TATCTACTACATCGATTATACAACTTCCCCTTAAAAGATCCAGCACAAAT
CGTAGAGAAAGATGCCATTTATATtCCTGCAGGATGGGACAATCAGAGCA
AAATCAACATTCTAGACGAACACATCAAAACTTTCGACGCAAACGAAACA
TTCAAAGATAGAATCGTCAAACCCGTCACACGAAAGtACGTCAACCAAGa
aaaagaagtcgttgcagaGGACGAACAGAAATTCTTGGAAGCGCAAATgG
CGATCCTAAGCAAAGAACCAGCACCTTCTTCATCCGCTCAAAGAGGTCCA
CCATCGCAGGACGCCAGAGCTTCCGCCCGAATGCAGGGCCATTCTCCAGG
ACAACGAGCAACCGGCCTCCCCCGACCAGCAGCCATGCCCAACATGAAGG
GAAAGCCTGACCCAACAAAAGGTGGTGCTGCTGGACAAAATTCATCAGAG
ACGGTCCTCGCCAATTTCTTCAACAGCTTATTGAATAAAAACTCAACCGG
AAAGCCAGGTGGTCCGCCCGGCAAAGGTGCCCCTCCAGCGAGCGGTGCAG
CAAATCGAAGCGACGTTCAAGCAGAACTAGAGAAGATGTCaagaaaaacc
atcaaaaaagaagaaaaatgaaaggctCTAGAATTACTAATTTTAATTAA
TAATTGATTATTTAAATGAATAATAAATTTAATAGcactttttctctaaa
atagccAAGACTGTGTTTTCTAAGAAAATATAAGCCAACTTAGTGTTGCT
TGCTGGTGGTACGTGGAACTAGATGTAATCTAGGCTAACGAAAGCCAATG
GAGCTGTCCCTCGGTATTTGTTCTTTGTCCAGAACATTGCAGACAGTTGT
TTCAGCCTGGAATGCAAGAGATTTTTAAAAGCTGGTTATTTTTGTTACCA
TTTATTATAAATAATAGAATTTCCcaaatattttgtttgactACAATTTT
TCATTTCCATTTTAGGTATTTATTAATATTTTCATGTTCTCGTCAGCATG
ACATCAAAGTAATGAAAATTGAGATTGAGGCTTTTTATAAACTCATTGAA
AGTGTTTctgttatatttttgttttgtcatACTTGAAGTATTTGGGGGAA
CATtcgttcattttttttatttcacagaaatctttttttgaacatcttca
tttttatattatGTAGACAATACTGTTGAAGAACACAAAGTGAATGAATT
TAATCCAATAACACCCCCTTTGTAACAGACTAAGCACCTCCCTGCTTCTT
ATCGGAAATTCTCTAAAAATGACCTCCTGCACCAGCTTCTTCATCTGACT
AAAAGATTCTCACTGAGTTTCTGGGACAGTGGTAGCAATCAGGTTGTGTT
CTTCAACAGTAGAAATAGCAATATAAAAACAATATATTGTATCGTAGTAT
TTTCGtgtacaataaaaaaatatctgaaaataaagaaaagtcaTTTAGAC
ACGAAATCATGctctttgaaattatttttgatgtatcaaaaagaaaaagg
aa
Run BLAST on NCBI

transcript from alignment at sc0000018:698064..722166+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00002060 ID=TCONS_00002060|Name=TCONS_00002060|organism=Clytia hemisphaerica|type=transcript|length=24103bp|location=Sequence derived from alignment at sc0000018:698064..722166+ (Clytia hemisphaerica)
ttgagaataagggattgcaaatctgttaatcgtgtttgtttctcattttt gattatatccttcaactccaagtagttttattgttatttagatttttaat tttttttttcaaaatggcgacctcgccaaatgctcctagtctacttgact ggactcagcgtcataaaaaattatcaaaaagcaaagttcagccagaagta gactctagtctaggggtcatgtaaaaattcaaaacaaaaaaggggGAGTA TTTTTCTTTACTTGGCTCTCTCCCCGAGTTGATTTTAACAGGATAACAGA ACAAAATGGCGGACCGACTAAGGGATGAACTCAATGATTCTaaagaagag gaagaagaaaaCTTTTGGTAAGACTTTCTTTggctttatattttttgaat aatctTACTCTTAATAATTCAACTCTTCAGCTAAAATTTTTGACTACCAT CCCTttctgacacccttttttagagccGGCAATTATAGCTAGGAGGGTTA GAATCGCTGCAGACAAAATGTCAATTGAATATAAAACCTTACCAAGTGCc ctgtatagaccttttttcaaagaggacgtcctgttgaataattatgtagt ccagccataaaaacaatgatagagccatgcataattactgtatcatgcat attgtaataattatgcatggttttatcattgtttttctgcacgaccctcg acatgaaccgagaattctcgggcctcttcgggccatgttcgggccgggag tccctatcaattcttttggcccgaacatgacccgagtcattcgggccatg ttcgggccatgttaaatgttaaattgattcagcatgtccagtcaNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNtaacctttcacagtactaaagtgcgcatttttac ctaccatttttaccgggcctctgcaatggagtaccgtgaaatggcgagac tcctaaacggtgtattaagagaaaccaagtttttctcaaagaaaatgtta aaaaaattcagtctgAAATTtatacacgcctgtttaaatcatgttttcaa aaatacacctttcccgtaattcgtaaaactaatgcgcgcgcattattttg atgctctccaccgtttggtctctggaggtaaacaaatccgtttttgcctg cgtccccttagggaaagttggtttttttgagcttttcttaagttctgttg aacaaaatcccctcaaattttagtatgttcaatctattcatgatatcata ccaccctgaaaatattttgccaaaagaaggtcgctgtcaaaagttagagg ctcaaatcccactttccctaacccctcgcaggcaaacacgcgttttttac ctcccaaacaattttatacacaacggtggagcgcacattttcccgggcca tttctgagaaatttgaattacgggaaaggtgtattggcccgagtgtggcc cgtgcgtggcccgcgtgtggcccaaattctcgggccatactcgggcttta cgcgaattccaataaaagttttggcccgagaattctcgggccatgtcgag ggtcgtttttctgctggactacataattatttaacagggtggcctctttg aaaaaaggtctatcactGTAGGTCCACATCCTCCAGTCAGGAAAATCCCT CAATTgtggtatactgcaattgcggtagttttcaTTCGTCGTGATCAGGC CACACGGCCGTTAGAGTATGTCGCGCGGCCAGTACGGCACGCCACATAGC CAGTATGGCACATCAcagtttcaaaataaatgttAAAATCGGCAGGGTCG TTGGTTAGCATACAACAAAAGCTTATAGAGTCAAGTCACCAGTGCACAAA CGGCCCCAGTGCACGAACAAgcgtctttgaacttgaaaaaaacaaccaaa aacaaacttatATACAActtcctttgtgcagcagaatcctGAAACTATCC CTTGCAATcactccaaaaattaaaataaacggagcactagaacaatacca aaccgattttgaacgaggccaagtaaaaaatcacgaaattcgggattttt gtaaacatggcCGATTgcgagagaaaatgttttttataagaaaatttgcg caagaagagttctgaaaatgactttccttttttaaaaacctgttatcttc catcacacaaaatttcattgaaacatgttagCTCATTAATNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNtcaatagaaacatatcaccagtagttgat ataaaaaaggttccagtccgcgaacgatccgaacaccatattcaaaatga agacattgcaatgtcaaaacattcgaaagcgctggcgatctcaattaaaa aagaaggcACTACATTGCTGCGCTTTTCAATGAgcacaaaacttgaaaaa gaaaacaaaaaaatggacgacaagaaaatatttacaaaaataaacaggtt agtaaaacgctaaagttcttataaaaaagatattttttggtgaaaaagcg cgtggttttgaaaagttcaaatacccctgtatcatctcggaagagagtta aagtgttacctgcgagcagagctctaatttgttctttcaaaagatcgttc GCGCACTGGTTCCTCGTTCGCGGACTTGGTCCAAATAGCGCTCGCTTTAA Cgacttattattccaagaagaagccttcaaataaagtgaaaacaaactga aagaaggacttcaagctTGTTTACGAGATGGTCAAAAAGGATTTATGTAA AAACAAAAAGTAAGTgagaaaagagaaaaataagtttgccgttcgtgcac tgggcacCCCCCTCTAaccagtcagggaaatccctcaattgcggtatact gcaattgaaGTAGTTTTCATTCCTGgttagcctacaaaggcttataatgg ctacatatagtgctggtcgacaaagattaacaaacatcgactgtaaaaAA TTGTACGAGAAGAAAGcctttctttattaaaagaatctgatctacgaaaa aaatattttgtctgtgcgttaaaaagatatgatcaattatgtacaaaagt TGCCTGTTTTCTCAATtaatcttgaattctgtttcttgaatatactgcaa ttgcggtatatgaaaaatgtaaaagtgacatttataccgcaattgcagta aaaaattactaccgcaatgagggatttccctgactgataACGGCTACATA TAGTGATGGTcgacaaagaaaaacaaacatccagttagggaaaccatcca ggatcctgccattctataagccagcaaaaactaaatgacacttataaact taagtttcttactattttccatcgaaaacatccaaaaacattgctacttc ccgaAGCCGgggaccaaaacaaattatcttccaaaaTTAGGGCGCCCTTT TGggtctattgttaaggccatctaaaatgatGGAAAGAGTTGCGGGAAGA CAAAGACGTCCGCTACTTCGAGGGcagtaacgccaaaacgcccaatatga tcttccaacagaaggcgagtaaGTTGCCGCGCtggttacgtcatgcactc cactgcagcgcacaacgaagcgtgtttcaacgaatatcattaattagaat agaatatcttatgtgcttaccttcagtaaactttgagtgcttcattgaaa atgaagaaggtaagaagataaaaaatacgctggataattttcattgtaac agtttggtcgaAATaatcgctgaaagtttgaaaaagtttttccgatgcaa aaaaaaatttcagccaattaaaagcacagtgtgcttatacttactatgtt tgctacattgtCTAGGCTAAAGAAAGTGCGCAAAGACACTAACATTTTTA ATGagtgatgttatgatttttttgattgcagccgcgtacaggaactcgcc aaatgttcctaactgacatcgactgtaaaaaattgcagtataaatgtcac ttttacatttttcatataccTCAATTTGCAGTATATGCAAGAAACAGAgt tcaagattcaaggagaaaacaggcaatttttgtacataattaaTCATAAC ATAGTTTGGACTTAAACtggtatatcaagattacagaatttcgagtacgg gccgattttacttttgttttgagtggtttcgttttcgatttcaagccaac atcttagcaacagggtgctcgcccatagttacaggggtttgtgcaaaaaa ctaaacatagaaaattttccaaatcccccatttcgattaaagcaatgagt ttcacttttttgcacctattgcaaatgaaaatatttaagattttaaataa attttaaataatttaaagGGTGGGgctgcaaggcactgagaggccacggg tgccaaaaagaagggccgtttgaaatgtggcaacctcattggttaaaatt tgataaacagctgcgaaggagcgctgggaagcaatcagtagaagagacca ctttcttttttgttgcagattttgatataagCTTCTCTCAGGGATTGCTT GTCAATctacatgtacacatgtgttgtgtcaacttatcagcattgtattg ttgtagaggaaaagataaaagaggtaagactagcctactttctaatcctg atataggagttaaATTTTAGACTGCCTCCCCTTTTTTAaagggggatgac accttctgaaaaaatgaagaaggggaGCGTGATaggaaattttcatgaaa aagggggATGTCCAAAATTCTTGTggaatttttaaaggttgggcaGTATA GACCAAAACTcctaccatcaactgctctaacttgggactatctgacaaaa catgggacggcaattccgccaccatttcaccaaacctctaaactcatttg atttgatttaatgaacgacatattacaaaatacacaatttctctttcgca ctgagtaggcttttaaatcgaagtATGAAAataatctgtagtggaacaca cacaAGTGTCTGTGAACGATGAAGAACAAGTTAGAGGCAAAACGTTGGAG CAATTGACGTCActtgcgcggcaagttacacactggCTATTTGTTAATCC TATCGAgcggtaggcggttaggcgTTCTCTAACTCTCCAATCAACGTCCG GTCATTttgtatgaaaacaaaaaaagttaaaagggcgtgctatcagtgaa agttatcgtgacatgttatgacagaaagtatgattgataaacttgttaga gttatcaaaacaaatttgttgtcaaagagatttaacagtaagtgaaaata caggccagatgaTATCAACAGTCCTATGTtatgaccaatcgtcccaagtt agagcagttatTACGgtatatcaaaattttgggatTTGGAGTGTGGgcca attttactttcgttttcagtggtttcgatttcaagccaacatcttagcaa catgGTGCTCGCCTGTGTTttcccatagttacaggggtttttgcaaaaaa ccaaacatagaaagttttccaatCCCCCTATTTCAattgaaccaataaaa aatgaaacttttccatgtttcacttttttgcaccagatttaaaaattctt cttttattcaatgattttttacggcactttgttgacaatctaactctcgc atcaaattcccgttttcttcagaaaattgaagatgagaaaaaacccagag gtaagactagcctagtttttaatcctgatataggagtttaagcttagact gttggatgatgccaagaagggggtatcatttaagaagggggagTTAGACC CCTTTCCACACTATCAGAACAAAAGAACACCAGcttggtagattctaccc cctggGGCTAGTAGTTAAATATCATACACTGAATCCCCcagttattcaaa atttgcctaacaaaaagattttttattcaaGTTCTTTTTGCAATCActtt ttttcatgcaaagtaTCTTCTctcaaaaaaatggtaaaaataaattCCCA TTGGGAAATGGGCCAAAGCTGACAGTCCTTTCAAATTCTCAAATTCCTAA TTTCAAACTGAAACCTTTGTAACCCATTTACCAGGGTTTTGACAACAAGA AGcattgaatttatttttctttattgaacAAGAAATTGTACCCTTTAAAG CTTTCAAGGACTACCTTTTGATCAACAGAAAATCTGATCGGGCTGGTCGG AATTGAAAAAACTAGTGGTTTTAAGTTTTGTTTAAAGTGATCAACTATAT GTGGATCCTCAAGATGGAAAAAAacgtttcattactttttgtttttgttg ccaATCTGTCAAGCTCATTTCAAAATCTAGATGGGTCTCTGTATACTGaa gattcttttttttaagttgCCTAGAAACCTAAAGTTCTTTTCAATATGAT AATCAGATATTTTGGTATCTACTAggagggggtggaggattctaGGGGGG TGTGGTGTCAAGATTTTTTCCCACCCTCAGAGGGGGGtctcaaaaaattt catgtaACCCATTTACCAGGGTTTgtccaattttcattcattaataTAGA TTTCAAatgtacactctttttttataagcgtacttaggctcaaattcggt aaaaaattaacaaaatgacCATACTGAAATGCAAAATGATTTGTGCAGCC TTTTtaaaacgctgacctttttagggttattttaaccctattcgtactat aAAAATAACCCCccgctctttctgttcggaagtcaaactattggtaatag ctcctgaaataatagagctttggccgtgaaattttctgtaaattcctaac ttttattttgcttcaaaataaaaaaaaatttgacacctaaatattttcac accttgagcatgatgacatttcTGACAGTAAGGTGTCACAAAAATTGACA CTTTTCCAATACAAATTTATTTTAATgtcaaatatatcgtttaaaccgta atttattgaatatttaggataaaataagcattttaaactcaggcaactat tttctaaagcctttgttagaatacaatagctttttataagaacaatggaa aatttcggtttttgctcactttgggcatgatgagtgacgtcatcaaaaaa tttttttgtcaaaagttaccttacgtgacaaggatcttgtgtgccaaatt tcatccaaaaagacacactagatcaaaagttaagtggtggtacaggaaaa gccccccccccctagttctgaaccgcccctaaaagcctagtttgaatagg gttaaagctgtttgagctttcttagaccaaagattttTGCCTGGGGCggc aaattacaaagaaaacttaCATTCTTTGAGCTGAATTGAAAATTCTAAAT CTTCATGAACCCAATGAAAATCAACAAACCGAAgtctaagcatataaata agcataaatcaagggtgaaaatgagattttgcttaGCATATTCAGCCTCG AACTGATTTtcctgtatgcttataaaaaaaaagagtgtaccaGCTGCTAT TATTGCAGCTTCAAATCATCCAttttgagaaaacattttaagTGGCCTAT ATTAGGAAGGGAGGgatgtcaaaatatattgaccAGTTAGGGAGGGGCAT GAAATGTTCTTgtttttgtctgttttagaAGTTTTGATTTGTGAGTTTAT AGCTCTAAAAAAGGAAAGAGGATATTACCAAAAGTTTTCTGTAgtgtttt tgtaaaatttttcacGATGAAAATATATGAATAAATGGTACAAAAGCAGT GAATGATATATTTTAGagcttattattttttactttctctTTTTATCATC TACTTTTCAATTTGGTGATACAATCAACattttataatttgaatttgTCA TTTAGGAAGCAAATTTTACGAGAAGTATCAGCAAAATCATCTAGAAGATT TCCTTCTTGCAAAAGAATCTTGGTGTTAGGTTTgtatttatattcattta aactCTTAATATGTCAACGGTTGGTTATTGGTTTTGTTAACAAAGGCATT CAAAATTTCCTCCCCGTAATGTCTTCGAATACCAAGGACAGAGTTTTAAG AAAACaagtcaagaaaacaaaaagcatatggaaaaaatatttttagatac tgTCTTAAATGCCTTAACCTTAAAAGACGATCACCTAAATTCTTTATCTG GGCTATTTTAACCTTTTAatcaaaacttcaaactttgtaGGGAACGATGG AACAGGTAAAACAAGTCTGGTCATGAAATTGAGGAGGTCTGGGGACGATT TATTGCGTGGTTCAGGATTGGAATATACCTACCTTGATGTGGATGACGAA GAACGAGATGGTATACTTCTAcatagttcggaagggggtcactacccccc cttccctagagctacccccctaccctaggttcttcccccttttaaaattt gatgctacccccctcaaaattttaaaatcctacaaaagaaaatagaacaC ACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGTGCGAACTATGT TCTATTCTatgaattttgattttgttctGTTCTCTTATAAGAACCAGTGA AATTAGGCTTTGACCTGGCCGTTCTcaatttttgtggtttttcaGGCTTT ACTAAATGACCATAAATTTTTCTTAGGTTAAAAGcttacttttaaaaaaa gtctttaaataccaatttttttgactttttttttgcgttttattcttatg aaatattgttcttttaaataaaaaagcgtgtatttgtaGTTGTCTATTTC AATTAAAAGTTTGTAGGTTGAAATCAAATTTCACTACAAGATTGTAAGCG ATATCACTGCCTTTCTTTTACACCAACGATGCAGAAACACGGACAACTCA CTCTCTtcatacttaatttttttcagaacACACCAGGCTCAGTGTTTGGA TACAATCAGGAGAAGCACACATCAAGGACCTCATGAAATATGTCATCACC AAGGAATCTATACACCATTCTCTCATCTTATTATGCATTGATATCTCGAA ACCATGGAACATGCTTGACCAACTGGAAAACCATGTCAATATTTTACGTC AGCACTTACACACTTTAAATATTTCGGCAAAAATTTTAAACGAACTCGAA AAACAAGGTATGGTTcgatttcaatataaaaaaatttatcatcaaaatga aaaatatgagcaatctgattggctaaaagcGCGTACAtaaaatgctgtat ttcatattgtacctTACATATACAAGACTGCGTTcaaaaaaggggtctgg taagcgggagatcattattttgtacaattttatgATAAGAAAGGTTTCCT CTTCGCTTCCAATACACAACAACTTATCAAAAGAGTTCATGAAAAGAAtc ttttgatctttttaatgaccattcaattcttttgtcgaatgttttgatgt tgatttcatctaaataaaagtaaaagaaaaaatattggaagggaaaaaca aaacaaagaaaaagagacaCAAATGGAGAGAGAAAAGTTCTTGATATTTG TCAAGTTGATGATAAACCAGTTTTTACTCGTACaatatacagtatgtggc ccccaaaacctcgatcaaattatttaaaatttctctcaaatctagaggaa aagaggttttacaaaaaattttgctgcatgaaaaactttaacatctctac tttatttcccggaagttctttttcaaaattttgaatttcagcaatatttt tcaatcgcttcaAGATAGATAAgctttttctaatggcccccaaaacgttg cgttacagtatacccctggttgttaAAACGTAGGTTTGGGGCCCCaaaaa cgtaggtgtagttaaaatcaaattattaagccaaTGGTAATTAATATAAT AGGGGGAGAagctatgaacatatttgtattttcccttaaatttaagaccc gatggatgtaaaatttatgatttctaTAAAATacttcaagattttcgatg atgcaaagtcAAAAccgaaaaattggaaattttcaaaattacaattttga tttaacaacgtcttaatcaagtttctgaaaaccaatctcttttgaaaata gtcccattcatgtatggaatatgcagtgagaattttagaaaaacagctta actgaaactgaaaatatcaagctatttttctcctatattttgcaaaaaaa tgacagaatttgtcgtttttgctgattcagcgaaaaattttatatacacg tttttttttttataagaacaaactatataagaacataaggcttcgaggcc cataaatttaagaacattctaagaacattctaaggctttggagacttaaa aacatgcattttcttaagaaattacatcaaaatgctcaaaaaatgctgaa aataagaacattttaagaacgtttttaggcttcaaatccaaaaaactaag aacatccgaaggcttaaaaaatttttgacgttcttataaaaaaaaaaacg tgtataatgttaattttttgtaatAAATTTTAAGTCAAGCTGGTAGGAAT GGAATGTCGAGAtcttttgctgtttctcatatttagaattttcggtttta tcaatgctgattatAGGGCCTGTTAATATCGCTACGCGGAAACTGTGGAA TGTGGAAACCAAAGTAAAAGATCAATTATGTTTACAGaagatttttcttc ctttaattttgaaaagtaaataaaaacctCGATTGATCACGAAATATAAA GGCCTATCTTgacgggagtttctaaacatcgaccagaaatggcgaccacg accagcgaccacgaccggcgaccagataaatttgggttatcgaatttttc ctctttctgcACCGTAGAGTCTCtcttatgatcatttatttatcgaattg aagagtaaagctcacccctgtctcacctacagtgattataaagtcacgtg caaaacgtgtagagccgccatttcaacgctcttggagcttgaatagaggg tcaatttctatccttttatattttcggcatcaaattaattagtagtaaaa tttgtgctggaatttatttaggaagctttatatttgatcatcagatcatt attttgtcaaaataagtcattttgacaatgtaaggacaatagaatAATTG ATGAGATTGTTATCTCTAAAACTGGTCTTCCCAGCTTTTTCCTACTGACT ATATATATATTCaaactaaaggcatctcatttcggtacaattaaaatatt tggtgtaataaagtttacaggcatcacacttaattgccctgtcaatattt ttgtcaaaaagtgtcactttgtctagaaaatgactggtaacgtcaaaaGG GGCAGGTGTGAAAAGAGCTCACACCATACGCGTTTAAAAAGACagagaga aaaagaaagaaaaagtatcAGACGATCGTGTTCAATTAACGCATCAATAG ctctatttatttaatttgatcACCCAATGAATATTTTACGCTATATATTT TACCCatctctaaagtcacagatgtatcttgattttctgaaaggcattag gtgtagaaagtttcctagaCCCCATTTCCatgacttattttcaatatcca aggagctagagtgagttacatgcaatttttatcttattttggtgttgaaa tatcTCCTTCAGAcacaaatatgttattttgaatttgtctcGAACCATCA AAagcatgctcatttttaagtatagccatgattctttcaaaataaacaaa aatcgtctaattctgataaatctacaggtcaggatcctcattttaatgac gacctacgttttgggggccgtctccgttttgggggccatatactgtagga tatatttttctcgttcagagttttctattttttcctcACTTAAAAGCTCg gaaaatatgacgaaaaatctAAGCTCGAAAAATATATATCCCATATTTTA CTCTGTACCGTGTGATAACTATTGCTTAAATCTCCTGATCTACAGCTTTC AGAATAATTCACTAAAGCTTTAGTATATCACCAATAATCCATAGTGAATC GAGCTTTTTTGATTTGTAAGATAAAGTGGGTCATGTAACTGTGCGAGTGC TCGcgattaaaaaaaaaggattgcttgcgcaaatcgaatgttttcttaGC GGAAGTTTCGcaattttaattaaaatattAGTTAATAATAAATTTACTTA CTTAATTTAGTTACTCTCTTTTTAGAGGGTGTAAAATATTAGTTGAGCTA GCAACAAAGACTCGATTCTCAACTGTATGAAAACTTCTACCGTTTCAGTT CTTCGAGATTTTCACATGTACAAATACAATGACGAGGAAAACAAACGGTT GAGTTCCAACATGGAGCAAGACGAACAAGAGATGAACCAACTAGCAGAAA ATATGATCGTTGATAATATTGGTCTCCCTATCGTCGTTGCTGTCACTAAG GTTCCTTTTTACTACGTCTGCTTTTATGTGCTAAGCTGTTTCTTTAAAGA ACTCATTCATGCATGATATAGTTTTTATGCTCATGTGCCATATCTAAATG CAGGAAAGATACAAATCTTAATTTTGAATACCTTAAAATTGGAGAAAATA CAATAAGCCTAAATGTTACTTTGGGATTCAGATAAGATTTTATAGAATTG GAAAGAAAGTGGAATCAATTGCTTTTAAATATGACCCGCATGTACAGTTG GTATCATTTAACAAGTGTTCATAAATACCACTATCTCACAGCCTCCTATa gaatttgtttttgaaatccCAGTGAGAATGAAATATTGTttcaaagctca aaaaacctAAGTTGGGATACTTTTAGAGTTTCCATTCAATTTCAAATGGA GattaaatcaaagtcaattatCCAGTTGGGCTGGATTTGTAGGGTACTTT ACCACCGGGGgatgaaattttggccaaattttccagtgggccAAGGGTCA TCATGTAGGGGTGTTTATAAGGCATATGTAGTAATATTGTAAGTTATTTT ATGATTTGTTGAATGAATaacttgatttattttttacctACAGACGGACA ACATGTCTTCCCTCGAACAAGAACACGACTACCGTGAAGAACATTTCgat ttcatccaaaaaaatCTACGAAAATTCTGCCTCAAATGTATGTCgaactt tctgtttttttttcttatactcCTTCATATTATGCCATTCACGTTGAAAC TTGATACCTTTGAACCCATCCACCCAGTTAAATTCAAGATTGAAAAGCTT TATCCAGGCTTGATTCACTGTAGTACATTAGTGTCTTATAATCCTCTTAT AATTTCTTTCAGGCGGGGCATCATTAATATATACTTCGACCAAAGAGAAT TGCAACACATCCGTTTTATATAAATATCTACTACATCGATTATACAACTT CCCCTTAAAAGATCCAGCACAAATCGTAGAGAAAGATGCCATTTATATGT AAGAAAAGTTACCTCTGTGTGTAGTCTCAAAATCAACCCTGACTTCTTTC TGCTGATGTTGTTAGCTGTCAGACTCTGGAGTGATTCGTCATACAgtaaa aacaatattttgtctattttttgatggatttcatatttaatgtttctata ttttttgtcttttagtCCTGCAGGATGGGACAATCAGAGCAAAATCAACA TTCTAGACGAGCACATCAAAACTTTCGACGCAAACGAAACATTCAAAGAT AGAATCGTCAAACCCGTCACACGAAAGGTATTATGTTTAAACTTTTCTTT CGTCGTTTTTATTCCcgaattaagggctctgaccatagtgaatttttcat aattgccgtgtttaaaatgtgttttctgactgatgtaaccaacaaaacta tggcatgttatacattttctgtNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNaatctgaaaattcaaaaattgcattaaaaaa atttgatgaagaagaaaatgaagacttttgtgaggaagagtatttcaact ttgaagagcttagttccGGCGAAgaataaacattttgaaaaaattttcgc agtagatggtgtatcttttaccgaacaattaAAATtgttgcggaaaattt ttgtaaatgcttttttgtctcgaaatcttcaaaatagtggttttccatca attttttatctggattttgcttaaaaaaacagtcataacttttgacacat ctttttagaaaaattttccgcataatttaaaatagttcaattctttgcag acagtgtaaagaaattttgaaacaaaaaagttaattacccattaaaacta agcattttttgtaaaagagggtgatgcaacatattattaaNCTCTGTGTG TAGTCTCAAAATCAACCCTGACTTCTTTCTGCTGATGTTGTTAGCTGTCA GATTCTGGAGTGATTCGTCATACAGTAAAAACAACATTTGTTCTATTTTT CAATGGatttcatatttcatttttctatattttttgtcTTTCAGTCCTGC AGGATGGGACAATCAGAGCAAAATCAACATTCTAGACGAACACATCAAAA CTTTCGACGCAAACGAAACATTCAAAGATAGAATCGTCAAACCCGTCACA CGAAAGGTATTAAAATGTTTAAACTTTTCTTTCGTCGTTTTTAATCCTGA ATTAAGCTAGGGCTGGTGACTTTGGTGTGTATCATTGTGAAGAAATCCAA AAGAGCCTCTTTGCCGATGTCCCGCATCGCATTGTCATATTCATCTATCA ACGACGTATATGGTTCAAATTTACGGCGTCAAGTTTCTCAGGATCGAATG ACGTACAACGTCTGTATCTGATAGCACGTCAAGTAATAACTTTCGACGTC AACCAACCTTGGTTGTTTACTCGAACCCAATCCCTTTTCATGTTGTATTC GGCGTaggaaatcaaaagaaaaatgacatCCAAATACAcaagaaataaat attttttttctttttcacagtACGTCAACCAAGaaaaagaagtcgttgca gaGGACGAACAGAAATTCTTGGAAGCGCAAATggtaattataaaaatttt atttttgtttatcaaatcatatTGTTTCTAAAAGCTCGGTTATCTCATTT CCATACCTCTGATCATTTGCAGTAGAATATTTAAGAGCGGTTtatacaaa attttcaactatAAACCATATacacaggaaaatttttttgattcccTAGG CTATGGAAATGTATATGTGCAACAGCTCCCtagttatggaaatgaaattt cccGATCTTATGACTACCTAGGGATGTTAAATTTCCCTAATATTGAAAAG TGCTTTTTTTGAGCGAAACCCAATAAAACCCGATAGGGTTACCCATATTC ACGAATTAAATCCTGATTTATagaaagctggtaaaataattaaatgtatt cgatcattgtgtgagcattggttcgatagctctcattcgttctgacatgt actagactagtaaaccacgtcgttgtatttcgctgcagattaaacttggA ATAGGATCTATTTTcttatatgttcactgaatacaacgACTAGTTCCAAA TGGCGCTATTTACTAAATAAACGGTGGAGTGCTTTTCATACCGCGGCGGA GTGCTCACTAAAAACAGTGCACTCACTCTCACAGAttagaataaaaaagt aaacaaaactcggtactttttatgctttattattatttatttttttcaca tcataattattttttgaatttaatattataaaagaaggtgagtaCAATGG AATATCAGTCAATTTAGgagctttttttttgaaaaaattgaaagttcttt CTCCCATAATTATCATGCATAATGCACTAACAAGATATATACCAACAACA AGACAAGGAGTTATTcacaaaaaatatgatatttttgtCTGAATGAAAAG AATATGAACTGGACTGTACCTACCAGCTATAGGTAccccaaaacaaaaat attcatatatggggaaaaatctttttcaaacaggggggggtacagccgca gggtactaacccatagccgggtggtggtgtctaatttggaaattcaaaaa agttagtacccagTACTAATTTTGGGGTGGGGGTGGGTATATCTCCAATT ttaagttagtacccggtaccaATTTTAGGGTGGGGTGggtatcatttcaa tttttcttcaagtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNTTGGCAAGTTTTAAGGGTGGTGTCTTCTATTTTCCTTGGTAAT TTTAAAGCCGGTACCCGTTACTAAAAAGGGGTtgggggtccctttttcct taaaaaaaagtaagtacccggtactaaaaaggggtgggggtcccttttcc ttaaaaaaaagtaagtacccggtactaaaaagggggtggtggtacctaag acaatttttcttaaaaatcaggttagtaccctatgggttagtaccctgcg gNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaaaaagaaaaatgtttt caaaaaagcaacagcttttacaaaacataaaattatatgTATTTGTTCAT ATTGACCttcaattttgctataaaaatgaTATAGCTACATAAAATTACTT CTAAAtccaagtagattttttttttaattggcaaaaatccaatcaaaatt ttcgttaaaactgtaagtttgaaaaactttgacgtATAAATTTCAGTCTG AACTTGTTCAACAACACCAGGGGACAACACAAAATGACAAGGTAGAAGTC TGCCGGGGGGNTGACGTATAAATTTCAGTCTGAACTTGTTCAACAACACC AGGGGACAACACAAAATGACAAGGTAGAAGTCTGCCGAGGGGCACTGAAC TTGGTAActgacggggacgtgccgctggagtttgaaaagtggaccctgtg agAGGTGAAtgtttagtaaatttgggacccattcagaacgaaaaatgatt tgatcgaaaaaatcaaaatattttcccactTCAACCCTGTAAATTGGCAA AAGTGACTTAAAGtagacaaaaaattcaaatatttccaccctaaaaaTTG tatacatcttgaaaattagtaccGTGAGAtttggtaacttgcatcagtgg aggctaacatgcatagccctcaaatgaaagacctggctggtcattaaaat acaactacggagctccgctcgcagctctactctaccatttttgttttgat ttaactttgtattttaatgaccagtcaggtctttcatttgagagctatgc atgttagcctccacggatgcaagttacccaatcgcACGGTAAATTTTGGG ACCCTATCAGATATCTCTAGAgtctgaaaaagggaccctgatcaGCGGCA TGTCCCGTACTTAATTTTGCCGAAGTGCCCCCCCCTGGAAATCTGCCAGT AGTGAAAACCCAAAACATCCTCGTACATCTAACATTTAGAGTCAAAGGTA GTGAATTCCAGCTAAACGACGGGCATCCGAAAGCCCAGGAAATCAGTCAT CTCAATGtaaaatgttgttattttcattcACAAATAGAACCAAGATGTGT CTCAGTGGTCAGCTTGTCAGAATATTGTTTCCGCACAAAAAGCAGtcaat ttttaaattccaaattacGCCACTTcacttttcatcatttccacAACATA TTGCACAATATCAGTATTGCACCAccaaaaatgttatataaatACCATAC TTTCCATTATAATTTTTGAGGATTTCTGTAGCCATTTTGGAGTTACATTC TCTGGGATAAGGTCATCAGGTTTAACTTGTACCCTTGTATCCATAGAAAA AAGCAGTGATCTGTTACCCAATGAATGTGAGCATATTAACATATTGAACA TTCCCTGCATGTAGTCATGGAAGCTCAGCTGTGTCATAATGTCATAAATA TTGCACTTGTACTAGAGATTTACCAGCGTACCAagccaacaaaatttaaa agatcCCAGTGTTAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNtctcccgcggcaatttctattttttataagaactctttatt attataagcactattcccgcgttcctgtgtccaaggaaagacagacgctt gctagtctagacatgtacttgcgctactttgagaatcccggcacttttgt cacaacagtggagcactagagagccaacttaatgacctcaaacccgtctc accgatccactgagcccttgcgacgcaagtccattgcgaacgaatgaggc cgcccaggcgggacgcctcacctttagtgttgtgttacacactgatcgaa tACACCCTTATAATGGTTTGCTTTACATACGACTCGAAACCTTTTGAGTA AAAAATCACTTGTTACGCATGCGTAATACAAGTTAGGGAAATCAATTTTC CCtaacctaaaaaaaaaattcccgaaCTTAGGCTCTAATTTCTGacagtt taaaatttttgattgaattgtcttatttgaaggtttgaaaaataagttct gATTTAATTAATTGTTTAAAGGATACACTCAAATTAAAGAGTTTGGGAAA TCGAATTTCCCAATCTGGGACATTTTATTTCACTAATTTAAGAAATCACA TTTCCCGATCCAGAGAAAGAATAGAATACAGCAAGCAAGGTCACAATTCG TGATATTTCCTTTCCCTAGCTTGTAGAAAGTAATCATTTTCAAAACTCGT GATCTCTCTTTTCCCGACTCATCCATAATCAGTTTAGAAAAACTTGGGAT TTTTAATTTCCCGATGCAATTCTGAATGGGCAACTAGAATGTTNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNTGGGCAACTAGaatgttaaaaatattagttttccA CATGTGGAAATCCGTTTTCACTAACACATTGGTAATACACTTCCAGCATG GGAAAATAGATTTCCTTAGTTTCCTTACTTTCCCGAACTTAAAATTCTCG ACTAATGTGATCGAATAAAAAACCACATCTGAAAATGAACAATCCCTAGG CTAgggaatcaataattttttcctgtgataggAACGTCATAAAATAATAA GTTGTTTtaatttattcatatttcttTGTTATTTTATTCTCAGGCGATCC TAAGCAAAGAACCAGCACCTTCTTCATCCGCTCAAAGAGGTCCACCATCG CAGGTAAGTTGAAATTTACTCACCTGATATTTCCACTATTGAGTATCTGT TAATCTCttgagaaaaaggaaaaacattaGTTGTTATTCCTCGACTTAGT AGAGGATGTAAATGACCATCAGgaacaattttattttctaaaaacttTTC TCAATTTGGCTTACAGGACGCCAGAGCTTCCGCCCGAATGCAGGGCCATT CTCCAGGACAACGAGCAACCGGCCTCCCCCGACCAGCAGCCATGCCCAAC ATGAAGGGAAAGGTATGTTCTTTTTTGTTAATGGGTGTAAACAGAACATT CATTCCTATGTATAGGTACTCttaagttccaaataaacggcccccggctt gttaatttttcgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcccccctg tttattaatttttaggaatatttgggttttcagaagtacaatttccaacc tcCCCGGCAATTAGGGGCCCCCCGCCTTTTAttgaaatctcgaaaatttt ccccccgtttctttggaacctaagagtacttacTATCCGATACTTTAAAA AGGGACACTTAGTCCAAAGTTGAAATTAGGACGCCTTCAACCACAGTTCA GAATCAAActggatcaaaagaagaaaaatcttcAATAGTTCAGAACTTTT ATATATTTTAGACTTCCTCGAGGCTTATTTTTCCGTTTCTGTCTAGACAG AGGACTCTAAGAGCTTAGGTTACATCATTATTCATCTTATCTTGCCTTTC TTGTAGCCTGACCCAACAAAAGGTGGTGCTGCTGGACAAAATTCATCAGA GACGGTCCTCGCCAATTTCTTCAACAGCTTATTGAATAAAAACTCAACCG GAAAGCCAGGTGGTCCGCCCGGCAAAGGTGCCCCTCCAGCGAGCGGTGCA GCAAATCGAAGCGACGTTCAAGCAGAACTAGAGAAGATGTCaagaaaaac catcaaaaaagaagaaaaatgaaaggctCTAGAATTACTAATTTTAATTA ATAATTGATTATTTAAATGAATAATAAATTTAATAGcactttttctctaa aatagccAAGACTGTGTTTTCTAAGAAAATATAAGCCAACTTAGTGTTGC TTGCTGGTGGTACGTGGAACTAGATGTAATCTAGGCTAACGAAAGCCAAT GGAGCTGTCCCTCGGTATTTGTTCTTTGTCCAGAACATTGCAGACAGTTG TTTCAGCCTGGAATGCAAGAGATTTTTAAAAGCTGGTTATTTTTGTTACC ATTTATTATAAATAATAGAATTTCCcaaatattttgtttgactACAATTT TTCATTTCCATTTTAGGTATTTATTAATATTTTCATGTTCTCGTCAGCAT GACATCAAAGTAATGAAAATTGAGATTGAGGCTTTTTATAAACTCATTGA AAGTGTTTctgttatatttttgttttgtcatACTTGAAGTATTTGGGGGA ACATtcgttcattttttttatttcacagaaatctttttttgaacatcttc atttttatattatGTAGACAATACTGTTGAAGAACACAAAGTGAATGAAT TTAATCCAATAACACCCCCTTTGTAACAGACTAAGCACCTCCCTGCTTCT TATCGGAAATTCTCTAAAAATGACCTCCTGCACCAGCTTCTTCATCTGAC TAAAAGATTCTCACTGAGTTTCTGGGACAGTGGTAGCAATCAGGTTGTGT TCTTCAACAGTAGAAATAGCAATATAAAAACAATATATTGTATCGTAGTA TTTTCGtgtacaataaaaaaatatctgaaaataaagaaaagtcaTTTAGA CACGAAATCATGctctttgaaattatttttgatgtatcaaaaagaaaaag gaa
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001083XLOC_001083Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00002060-exon-sc0000018-1491911889:698064..698430TCONS_00002060-exon-sc0000018-1491911889:698064..698430Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:698064..698430TCONS_00002060-exon-sc0000018-1510915933:698064..698430Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:698064..698430TCONS_00002060-exon-sc0000018-1575043694:698064..698430Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:706469..706542TCONS_00002060-exon-sc0000018-1491911889:706469..706542Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:706469..706542TCONS_00002060-exon-sc0000018-1510915933:706469..706542Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:706469..706542TCONS_00002060-exon-sc0000018-1575043694:706469..706542Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:706804..706923TCONS_00002060-exon-sc0000018-1491911889:706804..706923Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:706804..706923TCONS_00002060-exon-sc0000018-1510915933:706804..706923Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:706804..706923TCONS_00002060-exon-sc0000018-1575043694:706804..706923Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:707940..708170TCONS_00002060-exon-sc0000018-1491911889:707940..708170Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:707940..708170TCONS_00002060-exon-sc0000018-1510915933:707940..708170Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:707940..708170TCONS_00002060-exon-sc0000018-1575043694:707940..708170Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:711312..711463TCONS_00002060-exon-sc0000018-1491911889:711312..711463Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:711312..711463TCONS_00002060-exon-sc0000018-1510915933:711312..711463Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:711312..711463TCONS_00002060-exon-sc0000018-1575043694:711312..711463Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:712057..712150TCONS_00002060-exon-sc0000018-1491911889:712057..712150Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:712057..712150TCONS_00002060-exon-sc0000018-1510915933:712057..712150Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:712057..712150TCONS_00002060-exon-sc0000018-1575043694:712057..712150Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:712326..712461TCONS_00002060-exon-sc0000018-1491911889:712326..712461Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:712326..712461TCONS_00002060-exon-sc0000018-1510915933:712326..712461Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:712326..712461TCONS_00002060-exon-sc0000018-1575043694:712326..712461Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:712629..712662TCONS_00002060-exon-sc0000018-1491911889:712629..712662Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:712629..712662TCONS_00002060-exon-sc0000018-1510915933:712629..712662Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:712629..712662TCONS_00002060-exon-sc0000018-1575043694:712629..712662Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:713642..713719TCONS_00002060-exon-sc0000018-1491911889:713642..713719Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:713642..713719TCONS_00002060-exon-sc0000018-1510915933:713642..713719Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:713642..713719TCONS_00002060-exon-sc0000018-1575043694:713642..713719Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:714084..714146TCONS_00002060-exon-sc0000018-1491911889:714084..714146Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:714084..714146TCONS_00002060-exon-sc0000018-1510915933:714084..714146Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:714084..714146TCONS_00002060-exon-sc0000018-1575043694:714084..714146Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:720107..720166TCONS_00002060-exon-sc0000018-1491911889:720107..720166Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:720107..720166TCONS_00002060-exon-sc0000018-1510915933:720107..720166Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:720107..720166TCONS_00002060-exon-sc0000018-1575043694:720107..720166Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:720330..720425TCONS_00002060-exon-sc0000018-1491911889:720330..720425Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:720330..720425TCONS_00002060-exon-sc0000018-1510915933:720330..720425Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:720330..720425TCONS_00002060-exon-sc0000018-1575043694:720330..720425Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1491911889:721070..722166TCONS_00002060-exon-sc0000018-1491911889:721070..722166Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1510915933:721070..722166TCONS_00002060-exon-sc0000018-1510915933:721070..722166Clytia hemisphaericaexon
TCONS_00002060-exon-sc0000018-1575043694:721070..722166TCONS_00002060-exon-sc0000018-1575043694:721070..722166Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000018supercontigsc0000018:698064..722166 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
30.5618 31.2114 19.217 8.55972 21.2621 16.9278 19.9197 25.3832 17.213 12.2822 13.4604 11.2774 13.3315 14.8372 11.4128 11.7924 15.1721 13.3314 11.0299 11.8572 0.786443 11.033 13.9561 18.6574 15.6473 14.9968 16.6672 17.2796 21.2358 21.1585
Blast
BLAST of TCONS_00002060 vs. Swiss-Prot (Human)
Match: DC1L2 (Cytoplasmic dynein 1 light intermediate chain 2 OS=Homo sapiens GN=DYNC1LI2 PE=1 SV=1)

HSP 1 Score: 351.673 bits (901), Expect = 1.381e-110
Identity = 190/457 (41.58%), Postives = 281/457 (61.49%), Query Frame = 3
Query:  360 NFWKQILREVSAKSSRRFPSCKRILVLGNDGTGKTSLVMKLRRSGDDLLRGSGLEYTYLDVDDEERDEHTRLSVWIQSGEAHIKDLMKYVITKESIHHSLILLCIDISKPWNMLDQLENHVNILRQHLHTLNISAKILNELEKQVLRDFHMYKYNDE-----ENKRLSSNMEQDEQEMN-QLAENMIVDNIGLPIVVAVTKTDNMSSLEQEHDYREEHFDFIQKNLRKFCLKCGASLIYTSTKENCNTSVLYKYLLHRLYNFPLKDPAQIVEKDAIYIPAGWDNQSKINILDEHIKTFDANETFKDRIVKPVTRKYVNQEKEVVAEDEQKFLEAQMAILSKEPAPSSSAQRGPPSQDARASARMQGHSPGQRATGLPRPAAMPNMK-GKPDP-TKGGAAGQNSSETVLANFFNSLLNKNSTXXXXXXXXXXXXXXXXXXNR---SDVQAELEKMSRK 1697
            + W  IL EVS ++  + PS K ILV G DG+GKT+L+ KL+   +   +G GLEY YL V DE+RD+HTR +VWI  G+ + K L+K+ ++ ES+  +L++   D+S+PW +++ L+   ++LR+H+  + I  + + ELE++ ++DF  Y   +E       +R       DE+ +   L +N++  N+G+P++V  TK D +S LE+EHDYR+EH DFIQ +LR+FCL+ GA+LIYTS KE  N  +LYKY++H+ Y F    PA +VEKDA++IPAGWDN+ KI IL E+  T    + ++D IVKP  RK V+ +KE+ AEDEQ FL  Q ++L+K+PA  + A    P++    S R QG     R      P++ P     KPDP  K  AA    SE VLA+FFNSLL+K +        G     A  +  +   S+VQ EL++M+RK
Sbjct:   34 SLWSSILSEVSTRARSKLPSGKNILVFGEDGSGKTTLMTKLQ-GAEHGKKGRGLEYLYLSVHDEDRDDHTRCNVWILDGDLYHKGLLKFAVSAESLPETLVIFVADMSRPWTVMESLQKWASVLREHIDKMKIPPEKMRELERKFVKDFQDYMEPEEGCQGSPQRRGPLTSGSDEENVALPLGDNVLTHNLGIPVLVVCTKCDAVSVLEKEHDYRDEHLDFIQSHLRRFCLQYGAALIYTSVKEEKNLDLLYKYIVHKTYGFHFTTPALVVEKDAVFIPAGWDNEKKIAILHENFTTVKPEDAYEDFIVKPPVRKLVH-DKELAAEDEQVFLMKQQSLLAKQPATPTRASES-PARGPSGSPRTQG-----RGGPASVPSSSPGTSVKKPDPNIKNNAA----SEGVLASFFNSLLSKKTGSPGSPGAGGVQSTAKKSGQKTVLSNVQEELDRMTRK 478          
The following BLAST results are available for this feature:
BLAST of TCONS_00002060 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
DC1L21.381e-11041.58Cytoplasmic dynein 1 light intermediate chain 2 OS... [more]
back to top