Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00002052 (transcript) - C. hemisphaerica

Overview
NameTCONS_00002052
Unique NameTCONS_00002052
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length3170

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00002052 ID=TCONS_00002052|Name=TCONS_00002052|organism=Clytia hemisphaerica|type=transcript|length=3170bp
accttTAGTACCAGATTCTTGTACACACGCCAACCAAAAGCTAATGCTCT
ACCAACAATCCTAACAATAATGCTCCACACAAGAAATATGCACACATTGA
ACTTCTGTTTTGTCATCTCTCCTTTTCAGACAATGAGGCGATGCTAGGGA
ATCACCAGAAGATTCCTTGGTGTCATGCTGGTAGAGTTGGCAATCGAAAG
AGTGTTGGCACATTCTCATAAAGCAATTGGATCCACTTAACGTCCAACCA
AGATGTCGCATCGATATGGTGTCGATCACTGGAGAAAGGTTCATCAATGG
ATCCACTTTGGTCACCGACCGTCCATGCACCTTAACATTAAAAATATTGC
AGTGTGAGTAATTGAATGAATCTGGACGTAGGGTTAAGGAGAGAAATCTA
TCGGATATTTATCGGAAAGAAAATCAACGTTAGtttgaaagaaatactAT
GATGAGAGCCTTATTGGCGATACTTTTCGTCCTTGTTGCCGTCTTGGTGC
CAAGTTGCACTTCCCTCACAGATGCTGAACAGAAGGTGTTAGATGACTTC
GATATTACGATTGCGTCATTGAAAACAAAGCTTCAAGATCTCAAGAATAA
CATGAATGGCAAAATTACGAAGTTGAAGACTGATACCGCAGACCAGTATA
CAAAAATCCATGCTGATCTAGAGAAGAAACTTGATAGCACTGTGACAAAA
CGGTTAACTTCTGTCAACAAAACCAATACATTGTTCGCCACCAGAGCCAA
ATCGTACAAAGACAATTTGAGAAAGAATTTGACTAATACCATAAAGAACC
TTTACCTTACTCAATATAAGAAGGCTTTAAAAGAACGGGACGATTCTGTG
AAGAGCTTTGTTGAGGAATTAAATCCCATTCAAAATGATATAAAAACAGA
ATACGACATTTACAACGTGAAGTCACACAAACGGCAACGTAATGACACTT
TAAAAGCAATTAAGGAATTACTGGACCAAAAGAAAGGAGAATCTGTATCA
GACCTCAATAACATCGCTGGTGATTTGCATTTTGCAACACGTCAAATGCA
ATTGCAACAATTCCAAGAATTAGAGAAGGCCAGATCTGACGGTTACTCTG
GAATCAAACAACTGAAGACGACAACagTCGGTGGGCGAAACTACTTCATA
GCTGATCACAAAGACTGGGGAGCAGCGGGCATCAATGATTATCACAAAGA
AGAACATAATGTCCTTGGTGTGGCTCCATTTGCCGCTGTCCTTAATGGTA
TCGAGTTTCGAGAAAGTACATCTTCCTATTCGCTTGAGGAACCGTCACTT
GATGGTTCATTCGAAGGGACTAAAGCCATCCCCAACCCTCCGGTACCATC
AGACGTTCTTGGTGAACCAACTGTTGATGGTCAAATCACCAAAATGAAGA
AATGGCTTACAGATTTCCAGCATGGTAACGACGAAACAAGAGACATGTTA
TACCCTTACTTCAAACCTGTGTTATCTTATGTAGAAGGATCATGGCAGAA
GGTGAATGCTGACGCAGCAAAAATCACTGACGATGAAGCATCTAAGATTG
TTTTTGATTCTGAAACTGGTGCACCGAACCTTGCAGATAAATACAGTCCA
GTCACCGTCTTCGGTTATACCAAAGACGAAAACGATGTTGAACAACCACA
GTATGCTAAATTCAAGACCAGAATCGTCAGCCAAACAATATCCAAAGCTG
CTGGTTTGAATCCATTGAAATTTAGACCTAAACCAGATATTGTGTCATTG
ATTAGACATTATAATGATATGGCGAATCTGTTGCATTCACCTGCAGCTGA
CTTCGAACTTCAACATCTTGATTTCGAAGGAAAAGCAGATAATAATGGCA
AAAGCTTCTATACTTACCTAGATCGTCTTATGGAAGAGATCCCTGGCAAA
AACAACGACAACACCAAGACGGATGGAGAAGGATTTGATAACATGATTCT
TCTCAGTGCAAACCCAAAAGCAATAGGTACCAAACTTGACGCTAGCAGAT
ATCATCGATCATACAAACTCAGTCAGTCAGATGCTATGGGTATCGAGAAC
ACACAACGATCATTTAACGATCGATTATACGTTTCCATGACAAACAAAGA
AGAAGTGGTCGGCCTCACTTTGGATTACGTCAATAGTGCTGAAGTTGAAA
GTCAAATCAAAGTGAAAGTCTCGTACGCCTTACCCCTTGAAATTGTTTTC
CTGACACCACTAGCTGAATGGAACCCTTATTCGATCCCTCATAAGGATGA
TTGTGGTGACGTTAAAGGATCTGGAAGTGATGATTCACCTTTCGATGCTA
CATGTCCTCAAAGATTTTTCAGAGCTCCACAAAAGTTGTTTACCAATGCG
ACACAGTGCGGTGGAGTACTTTACGAAGAAGAAGCTTATTTTTTCCTCAC
ACCAAATGGAGACAAAGTCTGTTTAATTGCGTCCGGGATACGTACCGTTA
TCCCACCGGTGCATGGTCAACATTTAGGCTTACGGCAACGTTTCCCGATC
GCGCCCGCCTACAAAGACGGTGCTGCAGCCGGTAAGAAATTAGACGCTAT
GGAAGATAGCATCGGATTCAGTATCAAGAATCTGGTCTCCAAAGTTTCCT
TACAAACAGGTGCTTCGACCAAAGTAGGCATCAACACGCATTCTCATTAC
ATTCGGTTAAGCATTGACCAATACAAAGAACTCCAGCATGGAAAAGAGCT
TTTGGTAGCGACAGCTGAAGACTACACGGCACATCAACATCTAGTTACTG
TCAAATATGAATACGGTAAATTCTCCATCGTCGGGTGTGATACCGATTCT
CCATCCGACAAGCATTTCTGCTTTGATGGTCACACACCTGATGTTTATTT
AGCCGGTGAACCTTTCAAACCAGGGTTCACAGGCTATGGTTACGGTTACG
GATACGGCTACGGTTATGGTTACGGTTACGGCTATGGATATTCTGCTGGA
AAATAAATTGATTTTTTGATATACGTAACTTAAGATTACGTCATTTTTTA
AATCAGAAGCACCCGAAAAAGCTAAGATTTGACATATTTTTGGCTATGTA
GTAACTAGCCTATACTAGACATTATCCGTGTTTTTTCTACGCAATGAACG
TCTATTCCACTTTGCGAATTTTTCGAATGTTTGGAGCCCGGGTTTTCGGG
CTCTAAACATTCGATTTTTT
Run BLAST on NCBI

transcript from alignment at sc0000018:637353..665680+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00002052 ID=TCONS_00002052|Name=TCONS_00002052|organism=Clytia hemisphaerica|type=transcript|length=28328bp|location=Sequence derived from alignment at sc0000018:637353..665680+ (Clytia hemisphaerica)
accttTAGTACCAGATTCTTGTACACACGCCAACCAAAAGCTAATGCTCT ACCAACAATCCTAACAATAATGCTCCACACAAGAAATATGCACACATTGA ACTTCTGTTTTGTCATCTCTCCTTTTCAGACAATGAGGCGATGCTAGGGA ATCACCAGAAGATTCCTTGGTGTCATGCTGGTAGAGTTGGCAATCGAAAG AGTGTTGGCACATTCTCATAAAGCAATTGGATCCACTTAACGTAGGTAAT TGTGAAAGGATATTTTTGTTAAGTGAATTTTGAATTCCTACTTTTAACAC ATGGTAAAGACTTAATGAAGCGATTATTTAAAGCAATAGGATAATCCTAT GTTTTTGCAATCGAATGATGTTTTGATTTGCTTTAAAGGCAGCATCGCGT AGGATGTTTTCCATAAAGCTTAACATTTAATAGGATTGCTTCCCTTTGAG TTTAAAAAATCAATTCTGATTTTTATCCTGTCTAATACGGTCCTTTTGAT TTTATCTAGTTTTGAGAAAGAGGGGAAGTAATTAACTTTTGATTGCTGAA CGGGAAAAAGATTTTCCATGAGAAAATACCGCAAAACCTATAAAGGTGCT TTATAGATTTCAAAACAGCAGCAATATAAAATGCAATATAAGATAACCTA AAATTTCCATCGCTAATGTAAATTTACATTTACCTTTAATAACCCAATAG GCACTAGGAGAGGAACTGAAATTTGGAGCTTCCCACTGGATATTTGAGCC ATTAAGATATAGAaggcaatacaccttttcgaccgtagctgccgattgct gcgcgggcattttttagtccgttttaccaccctaaacccaattctttttt tacacttttttctattgtctttaggtgcgaaaaaaagactgggatggttt tagggtggtaataaaaaatgcccgcgtggcaattggcggctacggtcgaa aaggtgtattcagacaaaagattttctatTCGAATGGTACCATTTAGATA GCTCAAATATCCACTAGCTAAACAATTCTCCCACGAGTTAACGAGACAGT GTTCTTGAAATTGTACTCAGAAAAATGCATATAAGTTCAAGCTCAAAGCA ATACACATTATAAGGTGTAATTCAAATTGAGCAAAATTAGTTGTATCGCA GCTTATGTTAAGTTCAttctgttttttaaatttgagttTCACCCACCCTG CTAGAACAGTTAGCCAAAAAAAATAccccttttgaaaaaaataccttACT TCATTCAGAAATTCAATTAAAATAAACGTTAAAAACTTACTCGCTGattt ttccacccaggacattcttatccCAACCctccccccctgcttattaattt ttgggaaaatgtttttgaaagttccctcttttgtcctaattctgctgtat tagcctccaaTTTCCAACTGGGACATTTTTCTTCCACGCCCAAGTTTTGA GATCTTTTCCAACCCTCTCCCCCTGCTTCTTCCAGCCCCCTGCTGCCCCC GGCTatttaggtacccgagagtatcctAATTCCTAGCCACCATAAAGTGC TAAAAAATTACCAACACCCTTTCGAAAACACGAAGAAACCAGAAATTTAT TAAGTACCTTAACGGCCCTTTTTATACCGGCCTGTCGGTTCCTTTTACGT TGACCCTTATTACGCTAAAGTCAGTAGACTAAAGGAAATGTTCCTGGGGC TCACTCCTGCAAAAAATCGGTGTTAAGTTCCGCTTGTTGGAGTCCCTTTT AAAGCCTTTGAAACAGTCAttgcaaaatcacaaaatttgaaaatggttaT CTGTCAtagaagagaaaaagaaaagtttagaTTTTGTCTACTAGGGCAAA AGTTTTCTCTCTTAGTGTTTAAATTTAGTTTTGACAGGGTCCATTCCGGT TATAgtcatattttgatatttcaaaataagACTAATATTTTGTTGAACTC CATTGGATGATGATATCATAATCTGTAACTTTTGGAATTTTGCACCCTTT CAGAAATgaaattcccttattcccttattTTTAACGCTAAACACTAAGAC TTTGTATTCGCGCTCCTCTTAATTGGCGGCAGCACGAAGTTCTAAGTGAA ATAGGACACCGATGGCATTAAATAAACAGACATGAAacatcttgaaaaaa aattgagaaagtaGAGAAACTTTATTTTGCTTAGAGAACACTTTGTGAGT GTGTTGTGGTTGTTGCTCTAATACATTTAGTCAGGTCTTTGTTTTGTGGG TGGAAGTTTTATCAGATAATGGATTCAGTGCATAGTGCCGAAGGAAGAAA TGATGTTGTCAAAAAAGTCGACTCAAGCGTAGAAATCgcaaaattgaaag aagaacATTCGAGGGAGATCGAGAAACTAAAGTTTGAAAGCAAGATAAAA CATCTCGAATCTGAAAACGAAAGTCGAATGAAAATCGTGCAGCTTGAAAA AGATAATCAGACTCTAACACACAAACTAGAATTGCTGAAACTAAAAAACG AATATGATTTAGGATCTAGGAAAATCGTTGCTGATTGTGAATTGGAAAaa gaaatgctgaaaatgaaaatggacTTCCAAAACAAACTTGCTGAGAATGA TAAAGAGATGACAGCTCAACAATGTGAATTCAAAATACAACTGACCGAGA AAGATAAGGAGATGACAGCTCAACAATatgaattcaaaataaaactgGGA GAGAAAGACCAAGAAATTGCAGCCAAAGAGAATGATTTCAAAACGAAGCT GTCTGGAATCGAAAATGTGAATCATGTCAAATTACTTGAATTAGAAAAAC AAATGTTAGCAAATGAAAATGAGCTACATTTACGAATTAAAGATTCGGAA TCCATCAACAAAGTTGAAATTGGTGAAATTGCTTCACCAGATGTCATTGC TGCTCAGAAAGTGCAAGATCAAGAAAAACACTTTGATGGGATAATAACTG AAACTCAAAAATTAGTTTGGGGTGCTGACAAGTTCTTTACAGGCAAATCA GTTGAACGGAATCTGTTTGAATCATACCAAGAGTGGTATAAAGAAATAAG TGTGTTGTTACATGGGGAGGTTTTCGTGCCCAGTGGTAAATCAAATTATG TGTTCATTATTAAAAGAGATCCACCTTTTTGCACATGTTTGTGGTTAATT GCTCATAGAAAAGGTAGAGAGAGATTGAAAGGCCGTGATGTATTTTACGT CGAAGATGATGAAAAACGGTTGTGGAAAAAAGCTAAATTCGTGTTGCTCC ATCCTTTAGACCACAATAAATGCTTGAGAATGGATGAGGGTTGCAAGGCG GGAGATTTTGAACGATGGGACGTTAAAAATGTTACCAATGACTTCTATCA AGGGGAACAAAAGACCGCGATTGTGTtcggaatattttgaaaaatgattc atGGTTGATGAActtcttaaaaaattcttttattggAAGTAGTTATGTCT GGGAATAAAGGGCTGTTCATATGGAGGCGGGCTGGCTCGACTAATTGAGG TGGGATAGATTTTCGAACGTCACGTAATCCCaggggggatacttaggcaa aatggatgccgggtatgtgcgagccagaAGGTCccttttcacaccctcga aagtctttcaaaggggtacaaaagccattaaaaagaaaatcgagtctctg taagggtccaaaattcacgaaattcaaaatttcctctctcaaagggtttt gattttccaaaatttggacaaaaatcgagtAAAAATCGACAAAAGTTTTG AGTACAATTTTCGATTTCATTGAGGATCCCAAAAACGCCAAATTTtcctc tctctaagggtcgactTCCGATTTTTGACCCAGACAAACCCGTCAACTCG CAAACTTAATACCCACGGACACGTAATCTATATTCATCGTCGGGATTTAC AGCCGGAACGGCCCTCCGCATTTAAACAGCCCCTAAGACTGGATAGAAAC TCCTGCGAAGCAAGATGAGTTGATAATAAATCAGCAATGAAATGTACAAA GAAatgaaggagaagaaaaattgtaatttatcaaaaatacttCTCATTTT CGAATATTATTTTACCGAAAAATTTTATGACAGTCGTTAGATATTGATTA TAATAGATAAAGTTTTGAgaataaattaaaatgattgaaaaattataatg ttgttgataaattttacttttcaaaaCCTGTTAAAACTTTGAACTATGAT GATTATTCAGAGAGTTTGataacacgctttttttataagcacatccaaaa tgtttgaagccttgtgttcttaactttttgacttctcttagactaaaaat gtttttaacttgttcttattttccccattttgtgcatatttttgtccatt ttcctaagaaattgggtgttttagaatcccaaaagcctgaaaatgttttt aacttgttcttaacaaagcctgaaaatgttcttaaatggttagtaacatt ttagccatcgaagccttatgctcttacatagtttcttttataaaaaacgt gtatatataatagcctgaaaatgttcttataaaaacgtataACATCTATG CTTATTCACTTGGTGTCATAGTTGTACTATggttatcaaaacaaacttta ccAGATTGGCTTTCATTACTATCACAATCAGCAATGTAAAATTCATCAGA ATCACCCTCATTAGCATTTGTCTTTCTTTTAATTGTAATCAGGTGATTAT GTCCATTTCGACTTTCCGTTTCCACTTCGATTTCCTGTTTAGTACCTGTT CGTAGCTCAGCTAAATCATTTTCTTCGACTTGGAAAGTGTGGAAATGACC AGTGGTTGTCGTGGAATCTGTGTGTGATAGACCGGTAATGAAACCTGTGA ATCCAGGCTGGATTACAGCAGCTTTGTCAAATCCCATTGCATCTTCAAGA GCGTTCAACTTTTTCCATAGAGCGCTTCCTTCGCCTGAAATATTAAGGTT AATGAAAATTTCCAAGGGctgtcttttcattttttcaagggggtaaaaag ctattcttaaatttcaagggggtaaaagactgattttagctcgtccaccc tcactttgaTGGAGAGAATCTTTCCAAGGGTATTtcgcaaattttgccat tttctagGGGATATCAACatattttcaataatatttttttgacttgaaaa ggttcgtccccctgtatggttttttaatggaacagcccattgaTGATGAT GGGTTGAAGGTGACTAAGTCCTTTTATACAAATTCCAAATTTTCTGTATA CATAAAATTTGTTATGACACTTGCCAAACAACCTCAGTCTCAAAACAACT TGCAATAGCAACCTTTTTAAATAACTGTTAAACTAAGTACAGTGTGTTGA GGTACACAACTTCGTCCCTCTTCCCCGTGTACCCCAggttttatttacgt tactggtGGACACTAATGGAGAATAAAAGAAAGTTACAGAGAAGTAATAC ATGGGTACCAGTTTTTCATTTGTTCTTTAAAAGATCATCATAGATGTCAA TATTTTCTCCTAAAAATACATTTGATAGACGCAAAGACGTCTTTTTTCCG CACACGTTAAAAAATTTCCTTACCATGAATAGGCATGATTGGATACCGTT GCCTGATTTTTGCTTCAATTCCTGCAATTTTCGGAAAGAAAATTCGTGTA CCAGACGCTTGAACTTTCTTTTTACCATGATTCGGTGTATTAACATGGAC TTCACCATCGACCGTATCTGCAGCATCACCTTCTTCAGATTCTCCACTAA AGAATTCAGTAGGTGTCATGTAATAATACTTGCTACCAATACCGCTGTAC GGGGACGAATGTGTTCCTGCACCGGTGACTACGTCTTGCATAGGAATGTT GTACGGGTTCCAACTGcatttaaagaaagtttttgttaaatgtttttCGT CTTATTATCCCTATTTCCCTTATGATCAAACCATGGTGTTCTAAATCTAG AATACAATTGATCAAACTGAAATTGAAAACTCACTATATTCTCTTAACCA ATttttgatatgcgtaagtcatttttctagcggaaacacccgaaaaaatc cGGGATTTGACCCCTCTCTGTTACTTAAAATAGAAACACGTAGgtcaaaa tccggcttttttcgagtgtttccgttaaaaaatatgatgtCATCTtcact tacgcatatcaagaatatacGATTTGGTAAAATATTTACAGCCCTGTACC GATGAATTTTCCTGACCCATTTTGGTCTGTTTTTTCACCTGCTACCACCT AATAGTAATAGCCTGTTGCTAGCGAGGTTTGGAATAACCTTAAGTAGCTA CTCAAATCCCAACAGACACGAAACGTCAAAAATGACCCTATAATGTCCAT ACGACGTCAGGAGAATCAAACTTACCAGAGTGTATCTTTAGTATAACGCC CGGAGGTACTACGGTTGTGGGATtctgggtatgtgcgtgccggaccctta gagagacgtTTCTacgatttttttctctcaaaatcaaaaaaaattcttaa gaatcgtgaattttccgacccttagagagactttgaaaggtgaaaaaacc gacccttaaggcacgcacataccGAGCACCCATTTTTGTCTAAGtatcac ccccccccccccgggNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNCCCCCCTCCCCCGGGTATAACCTAGCGTTTCTACGCGGCAATGAATTT CCTAATGGATCTGTTTCTAGACAAACTGACCTGTGAAGAGGTGTCAGCCA GATAACTTCAACTGGAATTGCGAATGAAACACgtctttcaatcttttcat cAAAACTGTTTTCGTAATCTTGAGGTGCAACTCGTTCTTGTGTAGTGTGT GCAACGTAGAGTCGGTCAGAGAATGTTCTTTGGTCCTGGTGTCTCCTGGC ACCATCAACTGATTTCTGAACAAAAGCACGGTGATAGTATCCAAGATTCA AAGGTTTGTTTGGTGTGTTTGGATTTGCTGAGAAGAGATcatcaccagat ccatcaaatGCTTTTTCAGAGATGTCAGCTTTGTAGTTATCTTTACCAGG GATTTGCTCCATAATAGAATCTAACAAGTTGTAATCCATGGCTCCTTCTT CTCGTGTACCGTTAATGTTGATTCCTTCAAAATCGAATCGTGCAGCACGT GAGTAAACGTATTGCTCACGGTCTAATCGTTTCAAACGTTGTGATGCTTC GTCGTATCTGTGATAATGGATGAATTACTTTAGAATCAGGGGTTTTGCTT TGTCTTTGTTAGGTTggggaatgaaaaattaacCCTGGCGATTTTTAGAT TCTAGGCCGATGAATTTTTAGCAAGCGCAGTGTATTGATCAGCTTAAATA TGTATACTTGAGGTGACGAACCGATCTTTTCGAACGgcaaattgtaattt ttttcgtgccttggacCGGTGATATTTCCCGGTCGCCGGGCCTTGATAAA ACCCCTGAGAATACACTTCGAGATAGTTTCATGTGATTGAAAGCCAGCCA CTGCTAGTATATCGTAGCCTGAGCTTAATAAcacaaaaatcgaaattttg gcaatttcaaATTGTCTTACAtgtttttaagaacaaattatataagaata taaacGAAGcctcaatggccaaaatatcaagaacaagttaaagtTATTTT AAGGCTTAGCAGACTTTAAAACATCCACTTTCTTGGGAATTcgtaaaaaa tggtaaaaataaaaacatttttaagtttaaaactgaaaaagttaagaact tccaaaggcttcaaaaattttggatactcttacaaagaaaacgtgtattt tgAAAAGCCGCACACAAGGGTCTCTGATTTTGAATTATAGTTCGAGAGCT GTCGGCCTTTTTATTAGGTCATAAGCCTCAGAATTTTAACCATCCTCAAC GTGTTCGCCGTattgaaaactatcaaaaaaaactttgtcaGATCGAACAC TAGCAGTCTTTTTGATCTCCAAGAGCCCAAAAAAGAGGTAAAAAAGGGCT TAAAGCTGCTCATCAGTGGAATAGCTTTACAATTAAATAATTATACTAAT TTTACCTTGGTTCAAACATATCAGTGGAGACTAAGTCTCCTTCAATAGGG TGGACAGCGATTCGATAATTCCACTGTGCAAGAACAGGGTCTCCATTTTC GAAGCGTGTGATCTTTGTAGGTAGATGGGCCAAGTTTTCTAAAAGACTTT TGGATCCCGAGTATGCATTATATCTGacctaaaaacaaaattataaatat ttattCAGGGCGTAGTAGACTATGaatcaggcccggcggaagcggggaga ctgaagaaaatttaaatttttgaagagCCCTCGAAATATAGGGCCGAATA GTTTCTACAGAGTGGAGTCCTAAGTTGTtccccaaagtgcactgtaaggg tcgaaattaGCAAAGATAAGAAAAGtgaagtgcactgtaagggtgtagaA TTTGGAAAGTCTGACCATATTTTGTCTAAAAAATgatcaataattttcaa aaaaatgtaccATGAGAGTCGATTTTTCGtctaaattactcaaatttgcC TAAATTCTCCCTGTAAGGGTCTAATTTTGGGCCACACATACGGTCGTTTT TTAACCCCTCCGGGCTTTTACCTTATCTTGTAGGTCCAACCAAGATGTCG CATCGATATGGTGTCGATCACTGGAGAAAGGTTCATCAATGGATCCACTT TGGTCACCGACCGTCCATGCACCTTAACATTAAAAGTACATGTgttactt tgttttttttgataGGCTTGCGCATGAAAAAGACTAACTCCGGCGAATGC TACTCTTAGCCGGTGAAATCTATTCTGGGCAGGCGAAGACTTGGTAAGCC CAGTGTAATGATTATCATGAATATGTAATTGAGGCGGTGAACCGAATTTT TAGACCGGCgagttgtaatttttttaagccGTCCGCCGAGCTTAATTAAG TTCTTTGAAAGCATAAGGTACAATTGACTCACCTAGGATTCCAGTTCCGA AACTAATATGAAGctctttctttaacttttacgAGTCGGTTTTCGTTAAG TGAGTGACCAGTGAATTTTTAATTTGGGAAATGGCATCTTAATTTGGGAA GTAATAGCTACCGTAATTACTACCCTGTTTCATTTGTGCTACAGGTGTGT CAGCAATTAGGCGTGAGTAATTAGCAGCTAGACATTTATATGGAGGGGAT GAGGAAGTCGAATTCTATTCTTTAAAGCTTTGAAAAGAGTCCAGTGAAAA TTGAAGTTTTTGGCCATTTTAAAACTTAGGAATTTGTTCAAATTCAATAG gttattttcttttgataagaGAACAAATATTCTTTTTACCTTCAAGATAA GTCAGAACTGGTTTGAAATAATGTTTAAATGGTCTCAACTCTTCATCTCC AGTCACCCACGCTTTAAACCATTCTCTCATTTCTTCAATTTGTTCGGTCA CTGTATTTTTCGCCAGTACTGCAGGTGGTACTTCGGGAAATGGAACATTC TCTTGAGCATGAATGTCGGACGATGTTTTTGAAGGTCGGTATAAACGGTA ATCGTTGTGTCGGGTACGGAATTCGATACCGTTTAAAACACCGACGAATT CGCCCATGCCGACTGTACGGATATTGTTTGAGTGATCATGAATGGCGCAA AATGAATTTCCAGAGTGAGAGTTGGAATGATAGTTTTCGGAACCgactag aaaaaaataaaagtccAGTGCATTagcggaggtgtttacagtgtttaAAA CTCTACCGCTAATCTTTTTCCCGTAAtccgccctgacgccctgactctgc gcatatatattttcctgCGTTTACTGACCCTCAAACGGACGATAGTATCG TCAATCTGGCACCCAAATACAGAAATTCTAATCCGAACGCTAAAACtgtg aaggtcgggaaaatgtTCAACATCTGGAAAGTTTACATCACGATGAAGAA ATTTGTGTAAAAGCTTGATTCCCAATGAGCTTTTCATGTTCCTCTTTTAT GTCATTTTAAGTTCCCTTTTGATCTAACAGTAACCTTTACAAACCTTTTC TAGTCCTGATTTGTTTGATTCCAGATTGTCCTTCCGTTCTCTGTTTCTCT TCTTCATGAAATTGTGAAGCTGCAGCAAACTGAGCTAACTTGTGGAATTC TTTCTTTAAAACGTCAACTTGTTCTTTGCGAATTCTTTGATCTTCTTCCG TCATTTGTCCACTCTTTATGTTTTCATAAGATGCTTGCATTCCTGGCAAT GAATTGAATATTAATACAGTGTGAAGTCTCCGAAACTCGACCACGCACGG GGAACGTAGATTTATTCGAGtgttaatgaaattttgagttCCGAAGTAAG Gttcataaggcattgttaactgaagggaccataaaaattgttcgagttaa ggaaattttgagttatggagtaagcttcacaaggcattgttaactgaagg gaccataaaaattgttcgagttaatgaaattttgagttatggagtaagct tcacaaggcattgttaactgaagggaccataaaaattgttcgagttaatg aaattttgagttatggagtaagcttcacaaggcattgttaactgaaggga ccataaaaattgttcgagttaatgaaattttgagttatggagtaaggttc acaaggcattgttaactgaagggaccataaaaattgttcgagttgatgaa attttgagttatggagtaagcttcacaaggcattgttaactgaagggacc ataaaaattgttcgagttaatgaaattttgagttatggagtaagcttcac aaggcattgttaactgaagggaccataaaaattgttcgagttaatgaaat tttgagttatggagtaaggttcacaaggcattgttaactgaagggaccat aaaaattgttcgagttgatgaaattttgagttatggagtaagcttcacaa ggcattgttaactgaagggaccataaaaattgttcgagttaatgaaattt tgagttatggagtaagcttcacaaggcattgttaactgaagggaccataa aaattgttcgagttaatgaaattttgagttatggagtaagcttcacaagg cattgttaactgaagggaccataaaaattgttcgagttaatgaaattttg agttatggagtaagcttcacaaggcattgttaactgaagggaccataaaa atTGTTCGTGTGTTAAAGAGACATCTGAATTATagatgttcgagttatgg agactccattaTTGTCTAAAAATACGAAACCTTCAACTATTCAATGGAAA CACAGAGaacaaaacccacaaaacaaaaggaCAAGACAAATCACAACAAA TATCTAGAATGAATATCcacaaaaatgaaagaaatggaAGAAGTATGATG AAATCGAGatccatcaaaataaaaaaccaaaGATCTAAAACGACCTCTGG AAAGAACGTAACTCAATAAGAGTCaggatgaaaagaaaaaagcaacTCAG CCTTCCATACCTTCTAGATCGTAGCTCTTTATCACATCAAGGAGTTCGGT CAGCAGTTTAATATACTTATTGAAAGCTTTCGTTCTCCACAAATTTTTAT TGACCCTTTTTCCCCACCATTCTTTTGACATGTCCAAGTTCTTCATCTTC TTATACGTATTGATGGTCGTTTCTTTGTCTGCAGCAAGCACCTCAATGCC AGCCCAAGTATTTGTTATATGTTTCTCAAggctcttcttctttttctcga CATAAGTTACATACTTCACGCCTTCATTCAAAATCTTATTACCAGCTTTG GTAAACGAACTGTTATTACTGGTCAATGTGTTTGATAGAGAGGTCTGGTT TTTGGCGATTGAACTTTCGAATGCTTTGAATTGTTTGAGTAATGCTTCAG TTTCGGCTACTCGTGAATCTAACAGCATTCCGTAATCCAATTCCATCGCA TTAAGAGTTGATATCACCAGTAATACCAACCAAAACATTTTGAATGGTGA AACCATCTTTCCTGGCTTTTGTTCCTGGTTGTCACCTATTACCTCAGTAA ATCAAGTCTAGAATTAAAATAAGATGATAGCCTTGAAGTAATAAATATAG TACATAACAACACAAAggtgaaaataataattttgtaTTCTTCTGTCTTG CGAAAAAATGANTATAGGTCACGAGACAAAGGcgaaaataataattttgt aTCATTCTATCTTGCGAAAAAATGAACGAAAAAGTTACTACACAAAGGAC TAGcatattattttttgtaaaagctccaaaaagcttttaaaacaGAGACC CGCCTTGATTCTTAAATGCAATGTGGCTGAAAAATTATTGATGAATTAGG TGCGTCAATGGTGTGCATTGACGCGTGAAATATTTAGGTTTTAGCTTTGC CCTTCTGAATCGTGTACTTTATTCCTTACAAAAAGTTAGGGCCCTATGGC CGATGCCCCCCCCTTGGTATTTTGTCTTCGCCCTAATGTTTATCttaaac ttttgaataaaaatcttaaaatgttctttccGATTGTCTTAAATGAGCAA CAACTACAACATAAGCTTCATTCACAATAAAAGGCTGAAAGTTGgcaaaa aaatgagattttcgGAATCTTGAAAGAGTTGAAAAAAACTTACCTTCAAA TCACCAGAAAAAATCTCTCCGAAACGTTTTACCTCCAATGTTTTGGATTT GTATAAGaatcaaaaaatgtttacaTCGAAGTAAGAAAACAATACACGAG GATTGCATTTGAATATCAGAAACAATAGGTTAGTTTCTGATTATCTTATG GTATCTTAACTCTGAGACCAAGGGAATCACCATTTAGACAAGGATGGGAT AAATTTGCGAGGGTTGGCATTGTCAAAAATTATAATAGAGAactaattta aaaaaacatactcgttatttaaaagaattattttatcagaGAGAGTTCTT TCTACGCATGTAATGAAGCAATTAGTGCAAAGCTGCATGGTTGAAAATTG TAGGAGGTCCTTTTTTGATAATGAGGTATTTAGAGTGTGTAAGATATGTG CGACTTCATTTTCACATGACTTAAAGTAGGATTATTGTCTTGTTATTTTG TCTGAAAATCTCACCTATATACAAATACCAAAAGGTTGTATTTAAGGCTA GACATTTTGAATTGATATACATGTTTCAGCTACAAAATGAGAATTTTACA TCTGGGGGAGGGTGTCTATTTCCTTATATGGATTACAGCTCAAAGAGTTA GCTCCTCCTTTGCACTTAAAAAATATCTTCTTTATTCTGAATTGTTTTCC TCTCAAAGTCAGTTCCTCACTGTGTTAAAGAAGGCATTATGACGTTATTA ATCTGCAGGTGCCATTTTTAACGAAAGATAATTGATTGGAGATATTTATT TATCCCTAGTAGGAGGTTACTGTGGGTTGCTTAGGTTACTTAGCGACAAT TCAAGTAAAACTTTAAAGAGGGTATTATATGCAATTCATTATAGGATCAA TATAGCATTATGGGATTAATTGCCAATTTATCAAATGGGGAGCAAAGCAG GAAGGTATTGTGAAATTTGCACTTTGGCAAGTCGTGTAGCTGCTTGTTTC TGTTTACGTTTGAACAATGCTCTTTAACGGTTATAGGTACGACCACTTAC GGCTGTAGGCGTGCTATAAAATAGCTACCTCTATTTAATAGATATAATTT AAGTTATAAAATAGACTCTTAGTGTATGAGATTTACTAAATCAAGGTATT TAATCTACGAATTAAATCGTTTCAAAACAGGAAAATCATGTTTGTGCGGA AATTTGGACCCAGGCCCTAGGATCTACAAGATGTTATGTTTTCTCTTATT TCTCTGTAAGAAAATGTAATAAATCGGAGTCTCCATAGCTCGAACTTGCA TGGAGAACACAAATTAACTTGacttaaggaaatttcgaaatAAATATGGA GTAAGGTTCATAAGCCATTGATAACTGATGAAGGAATcaaaaaaacttgt tcgagttaaggagacattcgagtaataGAAGCTCGAGTTAACAGACTCCG CAGtataaatttgaaattcatcTAGGACGGCATTCATGGACCTTAAATGA ATGTTTTTTGAACGTTTGGGGCCAACTGGGATCAAAGTCAGGAAAATTTG TCTGATTATCAATTTGCAACTGAGAAAGACTATCATTTCTTTAACCTTTC ACTGTCCAAGAATATCCCAGCACTAAAAACATACTAAAGAAACGTCAAAC TAACGTTCAAAGGATATACGTAGTTGCTGTGACGTGAATTGTCAGCTGGA AGTCCTTTTGATCTTTTGATAGTAAATCCAGGGGCCTCTAAAACAACGTA GACGATTAAAGTTTGAATAACAGGAAGCTTTTTTACTCTGAGAGACCACG CAGTTTTTGCAAAGTTCGTGCATCAACTTCATGccgttagaaaaatgaaa aacaatcgAACGCAATTAAATAATTATCGTTTTCCCTCATTAAGACNaaa aaatgaaaaacaatcgAACGCAATTAAATAATTATCGTTTTCCCTCATTA AGACACAAATAGATCAATTACCTGTAAGTACCTGTAACTTTAAACCAAGT ATAGTTATTTTAAACATATCGCTCAATCATAAATCTTCGTATGATATGAT CATAGACCTGCTGGAAAATCTGGCAAAACTTTcgtcccactggatttttt taactttggaacaatagaatttatatccccttttagatttcaataggaac ttttatccccactgaggaaaaaagttccaccggggctgtgagacaggggt gtgactATGAAGGGATCTTTTTGATGCTGTAAAAAGCTCATTGCTTAGTT ATTAACTTTACCTAAAAGTGTTGTTTAGTTGGCGTTGTTAACCCATGAAA AGCAAATTTTAAAGTCAACCAAAGACAGtaaatttgcttttttttccCAG TGAAAGCgttctaaaattgaagatttcttGATATGAAAATGACGATCATA GCACAATTTTACGAGAAgtctttcttcatttttgacctCTATTTTCCACG TTTTGATTTCCACTGTcctgattatcttttcaacaagcccAAAACTGCCA TCACGTTCGTGAGTTCTATCAAAACTTACAGCCTTTTTtctccgctgcag attatatcCAGACAGACTTTAATGTTATTTTTGTCCTGGGCTAAGATACC TTCGGATTTAACTTGCTGGTATCATCGCTTAGGAATTTACAATTATATAT GCTTTTTTGCTAAGACGAGAGAGGTTGCTTTTAGAGAATAACAGCCGAGG CCAGTGTTATTCTTAGCCTCTATCAATTTGTGTCGATAAAAGCTTCGTTC CTATAGTCTAGCTTACTAACAATACTTAAAACCAACCAGCTCAATCAGAA TgccttttgattggcttaaacgACAACACGTGATTAGCATAATTAAAGTA TTCAATTAATTAATTTATCTCAACCAATACCTTCCCTTTTTTAATCAACA TCTTTCTCTCTTGTTCAGATATTGCAGTGTGAGTAATTGAATGAATCTGG ACGTAGGGTTAAGGAGAGAAATCTATCGGATATTTATCGGAAAGAAAATC AACGTTAGGtatataattatatttttcgAATAAACCAAAATGAGAACGAA AACGGTCTTGTGAATTTGTCTCACCatatgttttacttttttggtTGGTC GGCCTGTTTCAAaattcggggggggggggaagttTGTTATTTTTCCAGAA CATTATTTTTGTTGATGTGATTTTAGGTTCtttattaaatgaaattttga gcaaGATGGACTTGGGGTCCACTATATGTTTCAAAATCATTGTATTTCAC TTGTCGTTAGCCTACAGCAAGCTAAGAATGACGTTTTACTAAGATTAACT AGGTAATTAGGGTTGGTTAttgtttgatgaaaaagataagTTGAATTTTG GTGGCTTGATTGCATCTCAGCTCAGAGCTAACTTGATTGCATCTCAGCTC TTGAGCTAACTTGATTGCATCTCAACTCTTGAGCTAACTTGATTGCATCT CAACTCTTGAGCTAACTTGATTGCATCTCAAATCTTGAGCTAACTTGNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNCTAACTTGATTGCATCTCAACTCTTGAGCTAACTTGATTGCATCTCA ACTCTTGAGCTAACTTGATTGCATCTCAACTCTTGAGCTAACTTGATTGC ATCTCAGCTCTTGAGCTAACTTGATTGCGTCTCAACTCTTGAGCTAACTT GATTGCATCTCAACTCTTGAGCTAACTTGATTGCATCTCAACTCTTGAGC TAACTTGATTGCATCTCAACTCTTGAGCTAACTTGATTGCATCTCAACTC TTGAGCTAACTTGATTGCATCTCAGCTCAGAGCTAACTTGATTGCATCTC AACTCTTGAGCTAACTTGATTGCATCTCAGATCTTGAGCTAACTTGATTG CATCTCAACTCTTGAGCTAACTTGATTGCATCTCAACTCTTGAGCTAACT TGATTGCATCTCAACTCTTGAGCTAACTCTTACTGTAAAGGGAGACGAAT ACTCTGTAAATTTAGCATAGCCTCAGGGCTTGATGGTTTAGGCTAGATAG GATAGATAATATTTTAGAGTTTGACGGTTagaaactacatgtttttttat aagaacagccaaaatattttaagcctttggatgttcttaacttttttagt tttaaacctagaaatgttcttaacatgttcttaatttctttattttgata gtattttggtccattttcctaagaacatgggtgttttcgagtcggcaaag ccttaaaatgttcttgacctgttcttaagattttggctttcaaagtctta tgttcttatgtagtttgttcttataaaaaagtgtatttgttttgcttcat ttcagtttgaaagaaatactATGATGAGAGCCTTATTGGCGATACTTTTC GTCCTTGTTGCCGTCTTGGTGCCAAGTTGCACTTCCCTCACAGATGCTGA ACAGAAGGTGTTAGATGACTTCGATATTACGATTGCGTCATTGAAAACAA AGCTTCAAGATCTCAAGAATAACATGAATGGCAAAATTACGAAGTTGAAG ACTGATGTAAGAGTTCTTCTTTTCTGTGATTCAAAAAGAAAGGGGATCTT CTCAAAAGGTTATCATCCCTAAATGTTCcctgttttcacttttttctctG AAGAATTTCAGTGCATTACAAACTTTTGATCTCCGGGGATCTAAGGATAA TAAGTTTTCGAGATGTCAaagccaaaaaaattgaaatagatTTTTAGAGA CAGGAAAGATATttgtttctcaatttttgatccAAAGTTTTTCGGAAATC ATAAGAATTTGAGGGCACGGGAAGGGtgaattttggattttcataatttt gaaaCCCTTTTGGTCGCATGATCGATGAGTAGATGAGTAGATTTCGGCGG GAAGCGATTTTGCtgactgagaaaaaaaataaacacgGCTTGAACACGGT TTACTTCTCGGTTTACTTGTGTTGTACTTTCCGCCACTACATTACATTCC GTTCGGTACGCTACTAAGGCtaccatatttgtttatatttgtttatttgt ttttattattattactacGTTTTTACTATAGTCAAAAAAGTGCTGTTTAT TCTCGAATTAACTGTGTTGATTTCTGGTTGTAACCTTGACAACTGGCGTT CCTTATTCTTTTAGACCGCAGACCAGTATACAAAAATCCATGCTGATCTA GAGAAGAAACTTGATAGCACTGTGACAAAACGGTTAACTTCTGTCAACAA AACCAATACATTGTTCGCCACCAGAGCCAAATCGTACAAAGACAATTTGA GAAAGAATTTGACTAATACCATAAAGAACCTTTACCTTACTCAATATAAG AAGGCTTTAAAAGAACGGGACGATTCTGTGAAGAGCTTTGTTGAGGAATT AAATCCCATTCAAAATGATATAAAAACAGAATACGGTAATTtaccttttt cttctttttttttacgtGTCCCATATCCAGgaggttaacgatttttgttc aaaagtggatatctaGGGGTTTAAATATCTACAAGAtagcggatatccag ggagtagagtgtcttttcaagtagaaaatacgatatccaagggtaagcat ctttataagagaggatatccagggggttgagcatatttttaagagcgGAT AAAGGTCTTTTACTAATAAAGATATCCTGAAAAatcgatatcctcaacag tggggtaaatttcttttctggaaaagcctaatGTATACAAGTtgcacacg agggcctctgagaACCGGATCATGATTACAATTTTCTTGTCTCCAATATC TTTTCGGATGTTTTTTCCATCAAGCTTCAttgagtctttctttgaagAAA TGATTGTCCAATAAATAGATAACTGTATTATATCTGCAAACTCTCGAGAA AGATATATACAGTCatactctctctctaattctaATCTCCTTTATTGGAA TTTCTATGAAATCCGAACTAGAACATCTGCCCCATCAGCCGGGAAGTGGT ATCAAATactttctctaatttgaagaATATTCATGGTCCCTCGAAGATCA AACTAAACCACCTGgaggaaaaatttctttttcgcgTTACACAATACCCT GAAATCTCAATCCCAGCACTTAAACACTTTTATTTGGAAACAGCAACCCC ATGAAGTTGACCAGAAAACATTTTCCTCAAGGAAGATTTCAATCACTTAC CTAAAAAAGACTCTTAGGGCTTTTTACTTAGTTTGTGACTCCCGCTAATT ATTTCCCCCTAATAATTATTTCAGACATTTACAACGTGAAGTCACACAAA CGGCAACGTAATGACACTTTAAAAGCAATTAAGGAATTACTGGACCAAAA GAAAGGAGAATCTGTATCAGACCTCAATAACATCGCTGGTGATTTGCATT TTGCAACACGTCAAATGCAATTGCAACAATTCCAAGAATTAGAGAAGGCC AGATCTGACGGTTACTCTGGAATCAAACAACTGAAGACGACAACaggtaa acaaaaacaaaaacaaacactttacttatctttctttttcttccttCACT TGTGGAGGTAGGaggtactctgtaccagagtgtaccTCGCGTTTATCGCT TCTTAGTACACTCTGTACGCATGTTTTTTGGAGTACCGTCAGATTCAGAT CTGACGTGTATTGAAAAGGCTGACGATTTCGCCTGCCCATACATTGCGAG CTTGCCGCTTATTATCGGCTTTTTCATGCGTTCTGATTGCACTAAATATA CACTGGACATTTTCATGTGTTGGAACGCATAAGATTGTGTTATCAATGGG CTGTTCAATTAAacttccatacagggggtggaccaACCTTTCTCAAGTCA AAAGAGGATTCTTCTTTCCcatggaaaataaaaacaattgaaaaattaCC CTCGGAAAAGATTCCTACCTTAAAAGTAAGGTggaccatggaggtataaa gaaacaggagaagtatgctattgtaaccaagctcgccctacgattataaa agttacgatgtattcATGCTTATAAtatcatatatcgtgcatttttaatg agctcttttatccataggtgaaatcttattggctcatttcagctttagaa attagattagacgagattcattgtttctaacatcagtgtaagaaaatatt ttgactaaaaaaaggtctgtaaacttggcaatccttcatcaaatgataag atttttcgatcaatgttttctttaagatGAACTCTactgcttgatacttt cctccaaaattctccagcgactttatgtctgcaaattgagtctgaaatcg tgtgtgcttataaagaaattttcattttcggcttgagaaaatatcttttc aaaacaaaattgaacggataataaaatggaacataaacttcTTTCGTTGA CGAAGTTTTATCTAAATTTTCGTatatattaaaaggctagaatcttcaat gctgataattagaatgttcagagcaaatttgagttctactaaaaagtcat CGTGCGagcttaaaatttattttgataccttttataaaagaaatcaaaag actttaacgaccaattaccgacacattcaactcctgtttctATTTATACC TCTATGGGTGGACGAatcaaaatcagtcttttacctccttgaaattttgc aataattTTTTACACCCTAGAATATGAACAAAAAACTTCTCTTAGACCCC CTTGAAATTCTTCTCCGATTTCCCCCTCTGGAAAAATTCATAGTAATACC AAAGTGGTATTACCCATaaaaatttatgtaatttttCCTTATTATTTTCC CTTCTTATATAGTCGGTGGGCGAAACTACTTCATAGCTGATCACAAAGAC TGGGGAGCAGCGGGCATCAATGATTATCACAAAGAAGAACATAATGTCCT TGGTGTGGCTCCATTTGCCGCTGTCCTTAATGGTATCGAGTTTCGAGAAA GTACATCTTCCTATTCGCTTGAGGAACCGTCACTTGATGGTTCATTCGAA GGGACTAAAGGTATCAGTTTCAAACATAGACGATGGCTATCGTCTGTGTA ATATAATATTATGATATTACgatatattataaaacgtaatatgttgcgcC GCGGAAGATAGAGTTTGTGTTTACGGACTATATCAACTCGGCTAAATTCA TTCATTTCGTTGTGCTTGGACCGACCACAGGATTAGGTCGGTAGATTGCA CATTGAGCTCCTCCGACTATTTTTCGCCCGAGTGGACAAAATTTCCGTCC AACTGCTAATTTGCGTGTTTGAGGTTATTCTTTATTATTcgaattcgtct tagactatagcatatagtttattttaaactACGTTTTACAGGGAAGACAA TCGAGGCAAAATCTTTTACACAATTTGCAGATAGGAAATTGTTGAATCTT AAATCTACTCCTCTCATTTGAATCCTTTAGATTGCAGTTAAATTAACATC TAAAACTTTTCGTACTTTCTGTGAATAATTCTTTTTAGAATGATCGAATA AATTACGTATAAATGGGAAATTTGTTAGTCTGGTTAAATTTTGTTGACTC TTCTCTCCCTCTATTTTACCTCTAATGACTCAAACATCTACAGtcgactc tctctctctctaattcgatcttcaagggaccaaaaagtttattcgaatta gagaaagattcgaattacagtgaatgatttttaaaacttcctagctgagg ggaccaatacatgaattcgaattacagaaaaattcgaataatgaaggttc gaattagagaatgtTGACTGTATGCTCTTGTTTCTTCTAATACCACAGCC ATCCCCAACCCTCCGGTACCATCAGACGTTCTTGGTGAACCAACTGTTGA TGGTCAAATCACCAAAATGAAGAAATGGCTTACAGATTTCCAGCATGGTA ACGACGAAACAAGAGACATGTTATACCCTTACTTCAAACCTGTGTTATCT TATGTAGAAGGATCATGGCAGAAGGTGAATGCTGACGCAGCAAAAATCAC TGACGATGAAGCATCTAAGGTACaatggacttttccagaaaaaatttgaa tatgataaatgaaatttgagaaatttacccgctggacattgtgaattttg accccccggacagtAGGTCTGActccctggacaagcatcagttgaccccc tggacattcaaaataacCCTAGAAAAAATTACAACCTTAGGAActaagga tccaaaagttcaagaatagtTCAATAAGGCTCAGATTCTAGCATGGAAGT CTAAAATCCCCTTTCAAATTGAAATGTTCAATTACATTTGACAGATAACC CAAGCAACgttctcgcccgaacttcaaatttctaaaaaagaataaataac caaaattctcaatatattttgacgtacaatctcggtaaaaatatattgag aattttggttaattNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaccctctt ttacaaaaagtgcttagttttaatggataattaacttttttgtttcaaaa tttctttactgtCCGCAAAGagttgaactattttaaattttgcgcaaaat ttttctaaaacgatgtgtcaaaagttatgactgttttttaaagcaaaatc cagatgaaaaattgatgaaaaaccactattttgaagatttggagacaaag aagcatttacaaaaattttccgcaaaaaattttattgttcggtaaaagat acaccatctactgcgaaaacattttcaaaatttttttcttcgccgaaact aagctcttcaaagttgaaatactcttcctcgcaaaagtctaccttttctt cttcttcaaattttttcaatgcaatttttgaattttcagattcaggaata gtttgtctaacagaacatgtataacatgccatagttttgttgattacatc agtcagaaaacacatttgcCGCGGGAAAAAAAAGGTTCcacctatttgcc acgggaaaaaaagaaggttcgacctatttgcccgATGTCGGCATTTGCCG ACATGGTCAAAAGGTAgcgattttgacttcattttctgaatNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtt tgacttcattttctgaataatatatgaagtatcagccaaggactataatt ttgagttgaacattgttgaatagttatttttcaacatagaaaagctttta actaacatcttttttcatttcaaaacatctaatacaaaatctttgtagaa ctgttaaatttttgggcaaaggaatggaaagtgccgatgtcggcaaatcc cgacatgggcaaagaaatcgaaaatgctcatgtcggcaaatcccgacatg ggcaaagaaatcgaaaatgctcatgtcggcatatgccgacatgggcagtt aaagggttaattgTTGCCATGGTTTATTGTTTGGCATTGCAACCAAATGC TTTTTGTACCAGTCAAAAAACCTTACACATACATAAAAATACTTAACTCA TTTCAAATTCTACTTGATTTTTTAGATTGTTTTTGATTCTGAAACTGGTG CACCGAACCTTGCAGATAAATACAGTCCAGTCACCGTCTTCGGTTATACC AAAGACGAAAACGATGTTGAACAACCACAGTATGCTAAATTCAAGACCAG AATCGTCAGCCAAACAATATCCAAAGCTGCTGGTTTGAATCCATTGAAAT TTAGACCTAAACCAGATATTGTGTCATTGATTAGACATTATAATGATATG GCGAATCTGTTGCATTCACCTGCAGCTGACTTCGAACTTCAACATCTTGA TTTCGAAGGAAAAGCAGATAATAATGGCAAAAGCTTCTATACTTACCTAG GTAAGATTTTAGATTTAAAATTAGCTGATGATTGTCGTCCATACGGGCCa gcatgaaacttaaagtataataaatcaaagtctcttttcttttaatttga ataagCTCTGATATCATAGAGCACTCTCGGCAGATAGACTTGTAGATTCA AAATACAATCTTTTTTGATGCCCCAATCGTTAAAATTTAAAACTACACTC GGTTTTATCTATCAAGAAGGTTACCTGATGTcttttattatatatatttg TGATATGCACAATTGCAATGTTTTCtggcattacatcacggacccaacag ctgattggttgtaagtgacgtaaatcagtcaatacgtcactttcaactaA TCAGGTAGTGGGTCCATGATAGACAtttcaatggtgcatatcatgaatcg gTGCAGCCTCATGTTCGTGCTGTGTAACTCAGGTTTCTCCATGTCGTCAC TGGCAGAGTGCAGGAAACTATGTTCCACGCTTTTAGTGTGCGCTGAGAGG TTGATAgtcccgagggggggggggggaNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcccccc cccccccgggctgaTAGTAAACTGAGTCCGAGGTTGACCATTACTTGGAC AGTAGTACCAACTTTAACAGTGGACATCTCGCCAAGCAATAACTTATTGT ACACTAAGAAGAAAACTCTAGTACAAGGCTACCAATATAAGACATACTAG AGATGTTATTGTGTACAAACTACTTACTCCCTTTCCAAGATTTCCATTCT TGTTGTTGAACTCTGTTGTTGAATCTATATTATATCATTGACAGATCGTC TTATGGAAGAGATCCCTGGCAAAAACAACGACAACACCAAGACGGATGGA GAAGGATTTGATAACATGATTCTTCTCAGTGCAAACCCAAAAGCAATAGG tatcaaaattgattttcattgtttgtaATAAGAATAAGATAGGATTGTTA ATGAGAATCCCCTTGTGTTGAAATATTGATTGCTATAAGCaaaaagaact ttttcaaatgataaaatttctatattCTTTGACGTATCTGAAATATGTAA TCTGAATCGGGGATTCTGAACATCTTCACAGGTACCGTAATATAAAATGA AAGATAATGGGAGAATTCCTGACCATTATTAACGACCTAAACTAAAATTA GAACTATTTTGAACCGAAATACCGATTTTCTTTTTGGTTAAGCTCTCTAT TGATGATCAAAGATAGTATAGCAACAAGAAACTGAtagaacttttttttc gaatttttaaggCATTGAATTTGACAAATGATATTCTGTAAAACACCCCC TGTTGAGAAGCCATCTTTTTGTTGCTGGAAATGctttaaccccctggaat tccaggtaatttcaggcttaaacccctctggaattttgaattttagtagg atttaaaaagctacccccatggaattccagttgtttttgacagatttttg tctccctatggaattctgccacatatcaaaccttattactcccttggaac ggaaatggatcTCCTCAACAGAGAGTATACGGGTTCTTTTTGGAAAAAGC TCAATGTGGGATTTATAAAAGACTTTTATGAATAATCTCACATCTCacat aaatttctttcaaacttttaagGTACCAAACTTGACGCTAGCAGATATCA TCGATCATACAAACTCAGTCAGTCAGATGCTATGGGTATCGAGAACACAC AACGATCATTTAACGATCGATTATACGTTTCCATGACAAACAAAGAAGAA GTGGTCGGCCTCACTTTGGATTACGTCAATAGTGCTGAAGTTGAAAGTCA AATCAAAGTGAAAGTCTCGTACGCCTTACCCCTTGAAATTGTTTTCCTGA CACCACTAGCTGAATGGAACCCTTATTCGATCCCTCATAAGGATGATTGT GGTGACGTTAAAGGATCTGGAAGTGATGATTCACCTTTCGATGCTACATG TCCTCAAAGATTTTTCAGAGCTCCACAAAAGTTGTTTACCAATGCGACAC AGTGCGGTGGAGTACTTTACGAAGAAGAAGCTTATTTTTTCCTCACACCA AATGGAGACAAAGTCTGTTTAATTGCGTCCGGGATACGTACCGTTATCCC ACCGGTGCATGGTCAACATTTAGGCTTACGGCAACGTTTCCCGATCGCGC CCGCCTACAAAGACGGTGCTGCAGCCGGTAAGAAATTAGACGCTATGGAA GATAGCATCGGATTCAGTATCAAGAATCTGGTCTCCAAAGTTTCCTTACA AACAGGTGCTTCGACCAAAGTAGGCATCAACACGCATTCTCATTACATTC GGTTAAGCATTGACCAATACAAAGAACTCCAGCATGGTAAGTGATATTTC TGCTTAGCTTTTCAACAAATTAACTGACGATTCGTAAAAGATGAAACTGA CATTACTAAATtgatttttgtttactttttcttaaaatcgtaTGATTTCG CCCTGGTTGTGTTCAATACAACCATTGAGCACTCTTGGTAAATTGATTTA TACATACTTATATTtctgcttataaaaatgtattttttggaGATATCTTC CACTGTGAATACCATGACGAAAGCAATACAGAATTGTTGATGAAGGCCAA AATCCATCTCTCTAAAAGAAGGTGTTTAATAACTGAGCCCAATACACCCG ATCCTCGCAGACCCActgaccccttcccactggctCTCCTGTGGAAAATT ATTCtccaatttttatccccactgaaagtaatcaaataaaccaatcccca CTTCataatattatgctatttttcgtATCCCCACTAAATTTCCTGACttg gaaacaaaagaaattcctagccataaaaatattgaatacagtccgttatt tttatccccaggctcgaaaaacctaccgggtctgtgagagggAAAAGAAA TAAGATTTAACTGAAGATAAGAGAGTGATTTTACACTTTCTTTATCTTCG AACTTTTAATTGTTCTGATTCTAGTCGTAAATGTTAAATCAACTTGAGAG GCGTCACGGAAAAAATAAGAATCTATTTTACTTATTCAGCCTGTATATCA TTCCAGTGTTGACCGTGAAATCATTCAAAAAGTAACAATAACTTTTGTAA TTTTCCTATATTAGATTATAACGAATTTCACTTTTTTCTCCTCTACAGGA AAAGAGCTTTTGGTAGCGACAGCTGAAGACTACACGGCACATCAACATCT AGTTACTGTCAAATATGAATACGGTAAATTCTCCATCGTCGGGTGTGATA CCGATTCTCCATCCGACAAGCATTTCTGCTTTGATGGTCACACACCTGAT GTTTATTTAGCCGGTGAACCTTTCAAACCAGGGTTCACAGGCTATGGTTA CGGTTACGGATACGGCTACGGTTATGGTTACGGTTACGGCTATGGATATT CTGCTGGAAAATAAATTGATTTTTTGATATACGTAACTTAAGATTACGTC ATTTTTTAAATCAGAAGCACCCGAAAAAGCTAAGATTTGACATATTTTTG GCTATGTAGTAACTAGCCTATACTAGACATTATCCGTGTTTTTTCTACGC AATGAACGTCTATTCCACTTTGCGAATTTTTCGAATGTTTGGAGCCCGGG TTTTCGGGCTCTAAACATTCGATTTTTT
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001080XLOC_001080Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00002052-exon-sc0000018-1491911889:637353..637593TCONS_00002052-exon-sc0000018-1491911889:637353..637593Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:637353..637593TCONS_00002052-exon-sc0000018-1510915933:637353..637593Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:637353..637593TCONS_00002052-exon-sc0000018-1575043694:637353..637593Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:646336..646437TCONS_00002052-exon-sc0000018-1491911889:646336..646437Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:646336..646437TCONS_00002052-exon-sc0000018-1510915933:646336..646437Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:646336..646437TCONS_00002052-exon-sc0000018-1575043694:646336..646437Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:653221..653310TCONS_00002052-exon-sc0000018-1491911889:653221..653310Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:653221..653310TCONS_00002052-exon-sc0000018-1510915933:653221..653310Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:653221..653310TCONS_00002052-exon-sc0000018-1575043694:653221..653310Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:654708..654908TCONS_00002052-exon-sc0000018-1491911889:654708..654908Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:654708..654908TCONS_00002052-exon-sc0000018-1510915933:654708..654908Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:654708..654908TCONS_00002052-exon-sc0000018-1575043694:654708..654908Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:655517..655787TCONS_00002052-exon-sc0000018-1491911889:655517..655787Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:655517..655787TCONS_00002052-exon-sc0000018-1510915933:655517..655787Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:655517..655787TCONS_00002052-exon-sc0000018-1575043694:655517..655787Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:656627..656848TCONS_00002052-exon-sc0000018-1491911889:656627..656848Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:656627..656848TCONS_00002052-exon-sc0000018-1510915933:656627..656848Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:656627..656848TCONS_00002052-exon-sc0000018-1575043694:656627..656848Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:658165..658362TCONS_00002052-exon-sc0000018-1491911889:658165..658362Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:658165..658362TCONS_00002052-exon-sc0000018-1510915933:658165..658362Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:658165..658362TCONS_00002052-exon-sc0000018-1575043694:658165..658362Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:659151..659371TCONS_00002052-exon-sc0000018-1491911889:659151..659371Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:659151..659371TCONS_00002052-exon-sc0000018-1510915933:659151..659371Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:659151..659371TCONS_00002052-exon-sc0000018-1575043694:659151..659371Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:661528..661852TCONS_00002052-exon-sc0000018-1491911889:661528..661852Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:661528..661852TCONS_00002052-exon-sc0000018-1510915933:661528..661852Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:661528..661852TCONS_00002052-exon-sc0000018-1575043694:661528..661852Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:662847..662951TCONS_00002052-exon-sc0000018-1491911889:662847..662951Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:662847..662951TCONS_00002052-exon-sc0000018-1510915933:662847..662951Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:662847..662951TCONS_00002052-exon-sc0000018-1575043694:662847..662951Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:663675..664388TCONS_00002052-exon-sc0000018-1491911889:663675..664388Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:663675..664388TCONS_00002052-exon-sc0000018-1510915933:663675..664388Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:663675..664388TCONS_00002052-exon-sc0000018-1575043694:663675..664388Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1491911889:665201..665680TCONS_00002052-exon-sc0000018-1491911889:665201..665680Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1510915933:665201..665680TCONS_00002052-exon-sc0000018-1510915933:665201..665680Clytia hemisphaericaexon
TCONS_00002052-exon-sc0000018-1575043694:665201..665680TCONS_00002052-exon-sc0000018-1575043694:665201..665680Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000018supercontigsc0000018:637353..665680 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.0477338 0.177373 0 0 0.0744546 0.0490905 0.42817 0.421335 6.70578 5.37698 5.1065 5.32405 16.2865 24.5855 0.146714 0.208929 3.27184 6.02395 84.8007 98.3367 0.627351 0.2206 0.447698 0.43853 2.04442 2.41087 0 0 0.542121 0.31403
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00002052 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top