Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001997 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001997
Unique NameTCONS_00001997
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length370

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001997 ID=TCONS_00001997|Name=TCONS_00001997|organism=Clytia hemisphaerica|type=transcript|length=370bp
AGAGTATATCGGAGTTCATAGAGTAAAGACATAAGAAAACCGTAGTTACA
AATTCTTACATTTATCACACCCCCAGAACAACATTTTGTTAGCTCACAAG
GCTAACAAGtggaggttctaccgagatccTTAATGGGTCTTGGACCGTCG
TACTGTTCTGGGGAACCGAGAGTTACATAAAGAGAACTTAAGTTTATAAA
TGGAAGACTAGCACCTTCAAAGGTAGTCAGAATTTGATTGAAGGGAATTT
TAATATGGAACTAGACATTATGAACTTAGGACATTGTAGTAGAAATCTAT
AAAAAGCACATTCTATTGCTCTCTATTTAATTCTGAACCCCCAGGACAGT
TTTGTTAGCTTCGGCTAACA
Run BLAST on NCBI

transcript from alignment at sc0000012:415612..415981

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001997 ID=TCONS_00001997|Name=TCONS_00001997|organism=Clytia hemisphaerica|type=transcript|length=370bp|location=Sequence derived from alignment at sc0000012:415612..415981 (Clytia hemisphaerica)
TGTTAGCCGAAGCTAACAAAACTGTCCTGGGGGTTCAGAATTAAATAGAG AGCAATAGAATGTGCTTTTTATAGATTTCTACTACAATGTCCTAAGTTCA TAATGTCTAGTTCCATATTAAAATTCCCTTCAATCAAATTCTGACTACCT TTGAAGGTGCTAGTCTTCCATTTATAAACTTAAGTTCTCTTTATGTAACT CTCGGTTCCCCAGAACAGTACGACGGTCCAAGACCCATTAAggatctcgg tagaacctccaCTTGTTAGCCTTGTGAGCTAACAAAATGTTGTTCTGGGG GTGTGATAAATGTAAGAATTTGTAACTACGGTTTTCTTATGTCTTTACTC TATGAACTCCGATATACTCT
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001035XLOC_001035Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001997-exon-sc0000012-1491911889:415612..415981TCONS_00001997-exon-sc0000012-1491911889:415612..415981Clytia hemisphaericaexon
TCONS_00001997-exon-sc0000012-1510915933:415612..415981TCONS_00001997-exon-sc0000012-1510915933:415612..415981Clytia hemisphaericaexon
TCONS_00001997-exon-sc0000012-1575043694:415612..415981TCONS_00001997-exon-sc0000012-1575043694:415612..415981Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:415612..415981 .
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.05234 0.928896 1.07107 2.01895 1.18866 0.469649 1.98314 1.32614 2.8859 0.920038 2.97466 4.98476 3.55973 3.7345 0.502204 2.14695 2.31591 2.14267 0.436428 0.85125 3.87038 4.16116 0.252659 0 0.946357 4.25464 3.87424 2.45508 1.90873 0.996757
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001997 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top