Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001984 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001984
Unique NameTCONS_00001984
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length346

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001984 ID=TCONS_00001984|Name=TCONS_00001984|organism=Clytia hemisphaerica|type=transcript|length=346bp
TTAGcatgtcctctttctaataaaagtggttttgagtctaaacaagactt
tgttcggcctcagtggctcgccaaacgtccaaagttttttctgctgcACC
CGTACAATTTATAATTCTTATTATAAGGGGGTAACAGAATTTATTAAATA
AGATTGTATCATAATtacttcaatttttcaaaatttttatttattcatcc
tgaaccattttttttcaaaaagtgtatttattgttttttaGAGCTTAATT
TTTAAATGAACTTCTCAATGCACACAACTATAAATCAGAATGTTATTGTT
TTAATCGATAAGGCTTTTGATTATTCGACATAAAATAATGATtggg
Run BLAST on NCBI

transcript from alignment at sc0000012:122647..122992

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001984 ID=TCONS_00001984|Name=TCONS_00001984|organism=Clytia hemisphaerica|type=transcript|length=346bp|location=Sequence derived from alignment at sc0000012:122647..122992 (Clytia hemisphaerica)
cccaATCATTATTTTATGTCGAATAATCAAAAGCCTTATCGATTAAAACA ATAACATTCTGATTTATAGTTGTGTGCATTGAGAAGTTCATTTAAAAATT AAGCTCtaaaaaacaataaatacactttttgaaaaaaaatggttcaggat gaataaataaaaattttgaaaaattgaagtaATTATGATACAATCTTATT TAATAAATTCTGTTACCCCCTTATAATAAGAATTATAAATTGTACGGGTg cagcagaaaaaactttggacgtttggcgagccactgaggccgaacaaagt cttgtttagactcaaaaccacttttattagaaagaggacatgCTAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001022XLOC_001022Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001984-exon-sc0000012-1491911889:122647..122992TCONS_00001984-exon-sc0000012-1491911889:122647..122992Clytia hemisphaericaexon
TCONS_00001984-exon-sc0000012-1510915933:122647..122992TCONS_00001984-exon-sc0000012-1510915933:122647..122992Clytia hemisphaericaexon
TCONS_00001984-exon-sc0000012-1575043694:122647..122992TCONS_00001984-exon-sc0000012-1575043694:122647..122992Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:122647..122992 .
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.34005 0.25933 0.305447 0.29328 3.67028 4.06553 4.21326 5.28367 4.54384 2.21475 2.94063 2.33389 3.62555 1.8323 2.09687 0.843741 1.37524 2.08395 0 1.38216 0.786191 0 1.01372 0.853391 3.38494 6.82457 3.31608 1.35561 3.36475 8.16395
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001984 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top