Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001980 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001980
Unique NameTCONS_00001980
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1815

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001980 ID=TCONS_00001980|Name=TCONS_00001980|organism=Clytia hemisphaerica|type=transcript|length=1815bp
cttttagctgtgaaagagtatatttgaactctttcacttcacccacctct
gtccccttttctNAGAATGACTTTACCAGGATTGTCACGCGAAGTATGGT
GTCAACACctcaaatcaaaatcaaagaaaatgttgCTGGTAGTACTGCTA
AAAAACAGaagtCAGAAGACATTGATTTGGCATGTAAGTCTTCCAAAAAC
AAGAAAAGGTTATCGGCTGAGAAGAAGAACTCTATGCCCTCTCCCGAGCT
CAATTCAAGTCTCCAGTTATCACAATGGGGTCTTCCAGAAGTTATACTGG
AGAATTATAAAGCTAAAGGAATCAATAAAATGTTTGAATGGCAAAAAGAA
TGCTTACTACAAGACCAAGTTTTGGATGGTGCTAATTTGATCTATTCTGC
TCCAACGAGTGCTGGTAAAACGTTAGTCGCTGAAATCCTCATGTTGAAAA
GAGTCCTGGAAACAGAGAAGAAAGCCATCTACATCTTACCCTTTGTCAGT
GTGGCGAGAGAGAAGATGTATTCACTAAGGAATCAATTTGAGGAAGCTGG
CATCAATGTGGGTGGATTTATGGGAAACGAGACACCTCCTGGTGGATTAA
CCAACATTGATATCGCTATATGCACCATTGAACGAGCAAACTCTCTGATC
AACCGCCTCATGGAGGAAGACAAGCTATCTCTACTTGGAAGTATTGTTAT
TGATGAAATGCACATGATTGGTGACCCATCACGTGGTTATTTACTTGAAC
TCTTATTGACCAAGATTCGATTTTTAATGGCTAAGAATGCAACCAATGTT
GGTGAAAATAATGAGAGCAGCAGTAACCATGACAATGGGATACAAATCAT
AGGTATGAGTGCTACTTTACCGAATTTAGACATGATGGCGCGATGGTTGG
ATGCAAGGTTCTACGTTACAGATTACAGACCAGTGCCTTTGGATGAATAT
TTGAAAACCTCTAAGACTATTTACGATTGCGCAGATACTGTAGTACGGAC
TATTTCACCTGAGGACACAATTAAAGGCGACGACGATGACGTTATCAATT
TATGTCTTGAAACAATGCGAGATACAAACTCTGtcttgattttttgtcca
aCCAAGAACTGGTGTGAAAAATTATCCATCAGCATTGCCAACTATCTCGC
CAACAATGTTTTGAGTAAAGAATCTGATACAGAgaatatctttgataaag
aaGGCTTACAAGATGTGTTAAGTGAGCTGCAGCAAACACCAGCTGGTTTG
GATCCAAGTTTGGAGAAGGTGGTCAGCTCTGGTGTGTCTTACCATCACGC
TGGACTGACCATGGATGAAAGGGATATCATTGAAGGAGCATTCCGAAGAG
GTGTCTTGAAGATTATTATCGCAACGTCTACGCTGTCATCCGGTGTGAAC
CTTCCAGCTCGCCGTGTCATCATTCGATCCCCTATGTTTCATGGAAAATT
GATCGACGCCTTGGTGTATAAACAAATGGTGGGGCGTGCTGGGCGGAAAG
GCGTCGACACTCAAGGAGAAAGTATCTTGATATGTAAACCAAACGAGAAA
CAAAAATCACTTGCTATGATGACGTCACTCTTGAAACCTGTCTATAGTTG
TTTGTTAGATGCAAGTCGTACTATGAATCGTGCATTACTGGAGGTCATTG
CTGGCGGAGTCGCAGTGTCCCCACCTGACGTCGAGCTCTACGCAAAGAGT
ACTTATTTGAACACGTGTTTGGCCGTTCAAACGGGCCGTCACCCTGAAGA
ACTGATATGCACATCTATGAAGTTTCTACTGGAAAATGATTTCATCAAAC
TGCGCTTTGAGAAAA
Run BLAST on NCBI

transcript from alignment at sc0000012:1145035..1162739-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001980 ID=TCONS_00001980|Name=TCONS_00001980|organism=Clytia hemisphaerica|type=transcript|length=17705bp|location=Sequence derived from alignment at sc0000012:1145035..1162739- (Clytia hemisphaerica)
CTTTTAGCTGTGAAAGAGTATATTTGAACTCTTTCACTTCACCCACCTCT GTCCCCTTTTCTNAGAATGACTTTACCAGGATTGTCACGCGAAGTATGGT GTCAACACCTCAAATCAAAATCAAAGAAAATGTTGCTGGTAGTACTGCTA AAAAACAGGTAGGTCAGTAGTTAAAATGAGCAAGCGTAGCCGTAGGAATG TTTAGATCAGCTTTAAAGAAAAGCTATCCTCACTTGACATTTTTTGCTGA CTTCTTTTCCTGGTAAATGGTATCTATTTTATAGTTTAAAAATCCATTTT ACAATGACTTTTTAGTATCAGAGTTGTACTTTTAATACCCAATGCATGAT GTAATGTTAATGAATTATTAAGCTTTTGGGTGTGTTTGTGTAGGTCTTGA GATAATTGGTTTTGAATTGAGTGAAGCCAAGTAACTGAAAACGTTTGACC CCTCAATTCAATTTTGAGGTTTCAACTAGAGTGATGTCTCTTCAGCTTAT GGACTCAAATTTTGTTGCTGACGATGAATATTTTCTTCTTTAATCTTTTC TTTTTTAGAAGTCAGAAGACATTGATTTGGCATGTAAGTCTTCCAAAAAC AAGAAAAGGTTATCGGCTGAGAAGAAGAACTCTATGCCCTCTCCCGAGCT CAATTCAAGTCTCCAGTTATCACAATGGGGTCTTCCAGAAGTTATACTGG AGAATTATAAAGCTAAAGGAATCAATAAAATGTTTGAATGGCAAAAAGAA TGCTTACTACAAGACCAAGTTTTGGATGGTGGTAAGTTTTTTTTCACGTT TACTTATAACCAAACAAAAATATTTGATGCCTGTTGATAAAGCCTTTGAT AAAACCATCCAACGAATTCCCCCTTTTTGACCCTTTATTAGTCTTGGTGG CTGGTCGAAAGTGACCCGTTTGATAATGACACAACTGGTAATTCTGCCTT TCTTCCTGGAAATAGCAGCCTGGACTGTGCTGTTTCTTCTTAACCTAGCC CTATCGCAGCACGTGATTTTTTAGACACCGTTGGAACGGTGCTGAGAAAA AAGCCACTTCCGTCTGGTACAAGCAATATCAGCTGATTGCCGACCAAGCA GAGTCCGAAGTATGAAATGTCAAACCAATCATATCAAGTGTAACTTTCAA AGTCTTTCATTTTTGTTGTATTTCTCCTTACAGCTAATTTGATCTATTCT GCTCCAACGAGTGCTGGTAAAACGTTAGTCGCTGAAATCCTCATGTTGAA AAGAGTCCTGGAAACAGAGAAGAAAGCCATCTACATCTTACCCTTTGTCA GTGTGGCGAGAGAGAAGATGTATTCACTAAGGGTTTGTATTTAAGATTTC TGAATCTTATCTAGATCACCTAGTCAAACAGAAAAGACTCTTTATTCGTC ATTGCATTATTGTTCTTATCAACGATGTTACTGCAGCCTTTTCTTCTTAA AATGATGACTGAAGTTTCTATTGACATCAAAAGACTTGTATATCAGTAAT ACATTGAATTGTGTGATTATTGATAAAAATTGATAATCGCATTTTAGGAA ATAGGAAATAAAGTTCTCACGTAAAGTACATAATATTTGTAAATCTCACA TGCAGGCTTCAAATCTACTAGGGTATGAGTGTTGAAAATTTCACGGCGAT AAGATAAACAGAAAAAAAGTTACGTCAAAAATTCTAGGGGTGCGGTTTTT TTTTAATCACCCTGTATTTGCGTATAAGTTTAAACAAATTCTATATCGTA GAATCAATTTGAGGAAGCTGGCATCAATGTGGGTGGATTTATGGGAAACG AGACACCTCCTGGTGGATTAACCAACATTGATATCGCTATATGCACCATT GAACGAGCAAACTCTCTGATCAACCGCCTCATGGAGGAAGACAAGCTATC TCTACTTGGAAGTATTGTTATTGATGAAATGCACATGATTGGTGACCCAT CACGTGGTTATTTACTTGAACTCTTATTGACCAAGATTCGATTTTTAATG GCTAAGAATGCAACCAATGTTGGTGAAAATAATGAGAGCAGCAGTAACCA TGACAATGGGATACAAATCATAGGTATGAGTGCTACTTTACCGAATTTAG ACATGATGGCGCGATGGTTGGATGCAAGGTTCTACGTTACAGATTACAGA CCAGTGCCTTTGGATGAATATTTGAAAACCTCTAAGACTATTTACGATTG CGCAGATACTGTAGTACGGACTATTTCACCTGAGGACACAATTAAAGGCG ACGACGATGACGTTATCAATTTATGTCTTGAAACAATGCGAGATACAAAC TCTGTCTTGATTTTTTGTCCAACCAAGAACTGGTGTGAAAAATTATCCAT CAGCATTGCCAACTATCTCGCCAACAATGTTTTGAGTAAAGAATCTGATA CAGAGAATATCTTTGATAAAGAAGGCTTACAAGATGTGTTAAGTGAGCTG CAGCAAACACCAGCTGGTTTGGATCCAAGTTTGGAGAAGGTGGTCAGCTC TGGTGTGTCTTACCATCACGCTGGACTGACCATGGATGAAAGGGATATCA TTGAAGGAGCATTCCGAAGAGGTGTCTTGAAGATTATTATCGCAACGTCT ACGCTGTCATCCGGTATGTCTTACCATTTCCATTTCTTGATTTGATGACT ATTTTATTTCTGTTATCACATCATCTCACAAGATATTTTGGTCCTAGATA AAGGTCCTTTAACAGTAAATTCATGGAACTCAGTTCTTTAAGGAAATTTT AATTCGTAGCCAATAACTTAGATTCGTTCCATCAAAAGTCATGAAACTTT TTGTGATCACTTTTCTTGATGGACCAAAATCTATGTACACGGATGCTTTT AGCTTTGAAAGAGTATATTTGAACTCTTTCACTTCACCCACCTCTGACCC CTTTTCTTCTCCATCTTGCAGTTCTTACGACATCTGTCTTCTCAGGCCTT CCCTTTAAAGAAAGGTAGATGCATTGATTTGATCCTTACAAATCGGCCTC TTTGCTTTAAAAACAGTGGGACTTTTGAAACAGGAATCAGTTCTCAACTT CAGTTGAGCTACAATCTGACAATGTCTGTCTGTCTCCTGTGTGTGTGTGT GTGTGTCTGTCTGTCTGTCACAAAAACTTTAGGGCAGCCTGGAGACTTCA AAAATGCTTGGATTTGGCTGAAATTTGGCACACTTGTTCCTTGGGTGAAT ATCTGGAAGATCTTTTTTCGTTTTTCAAAAATTTAGATTTTTGAGGCCTG GGGACGAGTTTTTCACCAAAACGAGGCTAAAACTTTGGGACAGCCTGGAA ACTTCAAAAATTGTCGTATTTAGCTGAAATTTGGCACACTTGTTCCTTGG GTGAATATCTGGAAGCGTTTTTTTTCGTTTTTCAAAAAACTTGATTTTTG GGGCCTGGGGACGAGTTTTCCGCCAAAACGAGGCTAAAACTTTAGAGCAG AGCCTACAGGCCTCAAAAATGGTTGGATTTGGCTGAAATTTGGCACACNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA ATTTGGCACACTTGTTCCTTGGGTGAATATCTGGGGGTCTACAATCGGGC CTATGAATAATTTGAAGCCACTGAAGTTGAGCCCAGTGCGTTGCGCACGT TGCGTGACTACCATCACTTGATTTATAGCATGTTCAAAGCTAGTTTTAAA AAACTTCCTCCCAAAATTATAGAATATAGATCTTTTAAAAATTTTGATGA AAGTTGTTTCCGCTCAGCTTTAAGTCGTAATTTTGATTGCGATTTCTCAG ATTTTGAAGACTTCAGCAACACTTTTGAAAATATTCTGGATGCCCGTGCA CCAATGAAAAAGCGAACCATAAGGGGAAATCAAAAGCCCCATATAACTAA AGCTGTCCGAAAAGCTATTATGATTCGCTCTTTTTACAAAAACAAAGCAA ATAAGACCGGAAACACCTTTTATAAAAACTTATATTGTAAACAAAAAAAT AATATTGTAAATCTGAATAGGAAAGCAAAGAGAAAGTATTTTCGTGATTT AAAGGGCAACAGAAAACTTTTGGAAATCTGCAAAACCATACTTTTCAAAC AAGGTCCAACACCACGAAAAAATGTTCTTGCTTGACGATTCAAGTGAATC AAACGAGCTGATAGATGACGAGGCTACTATAGCTCAAACCTTTAATGATT ATTTTGTAAATATCGCTTCTTATCTTGGCATAAAAACTTCAGAATTTAGT CTTCCTGGGAACACTGAAAATAATCCGCTCGAAAATCATCCTAGCGTCCT TCGCATCCTCGAATCTCAGTCTACGAACAGATCATTTTCGTTTAGCGAGG TTACCCCCGAAGATATCCACCGAATCATGATTAAACTTAACCCTAGTAAA TCCGTGAGCGGTCCTTTTTCAGTTAAGCTTGTTAAAATGGTCTCTGACTT ATTATCAGAACCATTATCAAAACTAGTAAATCTTGCATTTAGCACTTCTC AATTCCCTCAAACTCTAAAAAAGGCGAGGGTCACTCCTGTCTTTAAAAAG GAAGACAAATTTCTGAAGACAAATCATCGGCCAATTAGCATATTGCCAAT TTTTTCAAAAATTTATGAAAGAATTATGCATGACCAACTTTCATCTTACT TTGATGGCATTTTTGACTCAAGACTTTGTGGGTTCTGAGCTAAACACAGC ACCCAGCATGCTCTAATCAAAATGATTGGTCAATGGCATCAAAGCTTGGA TGCGTCTGGTAAAGTTGGAGCAGTTTTAATGGACTTATCTAAAGCTTTCG ATTGCATAGACCACAAACTTTTATTAGCTAAACTCAAAGCTTATGGACTC GATGCTAAAAGTCTTGGCCTTCTCAAATGCTATATGAGTAATCGCTATCA GAGAACAAAAATATACTATACTCAGTATAGTGAATGGTTGGAAATACATC TTGGTGTTCCACAGGGCTCTATACTCGGACCCCTTTTATTTAACATTTTT TTGAATGACTTATTCTTTTTCATAGTCAAAACCAGCATTTGCAATTTTGT AGATAATAATACATTGTATTCTTGTGCTGAAACTCTTGCAGAGGTCATCT TAAATCTTGAGTTTGACTTAGAAATTATTCTAGATTGGTTCTCAAAAAAC TACCTTGAAGCAAATCCTGGAAAATTTCAAATGTTGGTATTAGGAAATAA TAAAGATATTATTGTAGAACTTTTGGTTGGACATGTAAAAATATCATCAA CGGATTCTGTTGAGCTCTTAGGCATCACCATCGACAATAATCTATCATTT AGCACTCATATCAATTCTCTTTGCTCTAAGACTAAAAAGAGAATTTGGAG CTTAAACAGAATTCGAAACCTTCTTACATTTGACCAANCTCTAAGGCTAA AAAGAGAATTTGGAGCTTAAACAGAATTCGAAACCTTCTTACATTTGACC ATGGATGTTCTGTAACAAGACTACAGTACATATGAGGAAATCACTAAAGT CCACAAGCGGGCTCTGAGAATATTACTTTGTGATTTCCAAGAAGACTATG AATCTCTGTTACAGAGCGCCAAGTGTAAAACGGTCCATGAAATTCATCTT CGCTTCTTACTTTGTGAGGTTTTCAAATCTGAGAAAAAATTAAATCCTGA ATTCATGCAGCAGGTCTATAAATCAAAAACAATTAAGTTTGATTTGCGAA ACAAAGTCTTGATGGCAATACCCAAGGCTACCTCCCATCGTTTCGGAACA CAATCCTTTTTATTTCGTGGAAGCTCACTTTGGAATCAAATTCCTGAAAA TAATAAGCTTAAGCCTTCCATCGATTCATTTAAATCCTTACTTAATGAAA TAAACCTAACAAATATTTGCCTTTATAAAATATGTACCTAAAAATTTATA GTTTCACTTTATTATATAGTTTTATAGAAATTATCTTTTCATATAATCAT TTTTGTCAATAGTTGGTATAAATTAGTATTTAATTATAACTATGTAACAC CAACGTTAAATAAATCGGGAAAAAAATAAAAAATAAAAAATAAACTGCTA GATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACGCTTTGAGC TGTGAAAGAGTATATTTGAACTCTTCCACTTTACCCACCTCTGACCCCTT TTCTTCTCCATCTTGCAGTTCTTACAACCTCTTTCTTCTCAGGTCNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNCCTTGCCTTCAAACTGCTAGATGTAGAAGAA AAGACTAACCAAAATTGTTGTGCACGAACGCTTTTAGCTGTGAAAGAGTA TATTTGAACTATTTCACTTCAACCACCTCTGGCCCCTTTTCTTCTCCATC TTGCAGTTCTTACAACCTCTTTCTTCTCAGGCCTTCCCTTCAAACTGCTA GATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACGCTTTTAGC TATGAAAGAGTATATTTGAACTCTTTCACTTCACCCTCCTCTGACCCCTT TTCTTCTCCATCTTGCAGTTCTTACAACCTCTGTCTTCCAGGCCTTGCCT TCAAACTGCTATATGTAGAAGAAAAGACTAACCAAAATTGTTTTGCACGA ACGCTTTTGGCTGTGAAAGAGCTCGCGTGAACTCTTCCACTTTACCCACC TCTGTCCCCTTTTCTTCTCGATCTTGCAGTTCTTATGACCTCTTTCTTCT CAGGCCTCCCCTTCAAACTGTTAGATGTAGAAAAAAGACTAACCAAAATT GTTGTGCACGAACGCTTTTAGCTGTGAAAGAGTATATTTGAACTCTTTCA CTTCACCCACCTCTGTCCCGTTTTCTTCTCCATCTTGCAGTTCTTATGAC CTCTTTCTTCTCAGGCCTCCCCTTCAAACTGCTAGATGTAGAAAAAAAGA CTAACCAAAATTGTCGTGCACGAACGCTTTTGGCTGTGAAAGAGCTCGCG TGAACTCTTCCACTTTACCCACCTCTGTCCCCTTTTCTTCTCCATCTTGC AGTTCTTATGACCTCTTTCTTCTCAGGCCTCCCCTTCAAACTGCTAGATG TAGAAAAAAAGACTAACCAAAATTGTTGTGCACGAACGCTTTTAGCTGTG AAAGAGTATATTTGAACTCTTTCACTTCACCCACCTCTGTCCCCTTTTCT TCTCCATCTTGCAGCTCTTACGACCTCTTTTTTCTCAGGCCTTCCCTTCA AACTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACT CTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCACCTCT GTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTCTCAG GCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGT TGTGCACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACC TTACCCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCT CTGTCTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACT AACCAAAATTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTG AACTCTTCCACCTTACCCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAG TTCTTACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTA GAAGAAAAGACTAACCAAAATTGTTGTGCACGAACTCTTTTAGCTGTGAG AGAGCTCGCGTGAACTCTTCCACCTTACCCACCTCTGTCTCCTTTTCTTC TCCATCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAA CTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACTCT TTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCACCTCTGT CTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGC CTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTG TGCACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTT ACCCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCT GTCTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAA CCAAAATTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAA CTCTTCCACCTTACCCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTT CTTACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGA AGAAAAGACTAACCAAAATTGTTGTGCACGAACTCTTTTAGCTGTGAGAG AGCTCGCGTGAACTCTTCCACCTTACCCACCTCTGTCTCCTTTTCTTCTC CATCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACT GCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACTCTTT TAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCACCTCTGTCT CCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCT TGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTG CACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTAC CCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGT CTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACC AAAATTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACT CTTCCACCTTACCCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCT TACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAG AAAAGACTAACCAAAATTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAG CTCGCGTGAACTCTTCCACCTTACCCACCTCTGTCTCCTTTTCTTCTCCA TCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGC TAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACTCTTTTA GCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCACCTCTGTCTCC TTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTG CCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCA CGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCC ACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCT TCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAA AATTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCT TCCACCTTACCCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTA CGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAA AAGACTAACCAAAATTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAGCT CGCGTGAACTCTTCCACCTTACCCACCTCTGTCTCCTTTTCTTCTCCATC TTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGCTA GATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACTCTTTTAGC TGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCACCTCTGTCTCCTT TTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCC TTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACG AACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCAC CTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTC TCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAA TTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTC CACCTTACCCACCTCTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACG ACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAA GACTAACCAAAATTGTTGTGCACGAACTCTTTTAGCTGTGAGAGAGCTCG CGTGAACTCTTCCACCTTACCCACCTCTGTCTCCTTTTCTTCTCCATCTT GCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCCTTCAAACTGCTAGA TGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACTCTTTTAGCTG TGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCACCTCTGTCTCCTTTT CTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCCTT CAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAA CTCTTTTAGCTGTGAGAGAGCTCGCGTGAACTCTTCCACCTTACCCACCT CTGTCTCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTGTCTTCTC AGGCCTTGCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATT GTTGTGCACGAACGCTTTTAGCTATGAAAGAGAATATTTGAACTCTTTCA CTTCACCCTCCTCTGACCCCTTTTCTTCTCCATCTTGCAGTTCTTATGAC CTCTTTCTTCTCAGGCCTCCCCTTCAAACTGCTAGATGTAGAAGAAAAGA CTAGCCAAAATTGTTGTGCATGAACGCTTTTAAATGTGAAACAGTATATT TGAACTCTTTCACTTCACCCACCTCTGACCCCTTTTCTTCTCCATCTTGC AGTTCTTACGACCTCTGTCTTCTCAGGCCTTGCATTCAAACTGCTAGATG TAGAAGAAAAGACTAACCAAAATTGTTGTGCATGAACGCTTTTGGCTGTG AAAGAGCTCGCGTGAACTCTTCCACTTTACCCACCTCTGTCCCCTTTGCT TCTCCATCTTGCAGTTCTTATGACCTCTTTCTTCTCAGGCCTCCCCTTCA AACTGCTAGATGTAGAAGAAAAGACTAGCCAAAATTGTTGTGCATGAACG TTTTTAAATGTGAAACAGTATATTTGAACTCTTTCACTTCACCCACCTCT GACCCCTTTTCTTCTCCATCTTGCAGTTCTTACGACTTCTTTCAATTCTC AGGCCTCCCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAATT GTTGTGCACGAACGCTTNTTCTTCTCAGGCCTCCCCTTCAAACTGCTAGA TGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACGAACGCTTTTGGCTG TGAAAGAGCTGGCGTGAACTCTTCCACTTTACCCACCTCTGTCCCCTTTT CTTCTCCATCTTTCAGTTCTTATGACCTCTTTCTTCTCAGGCCTCCCCTT CAAACTGCTAGATGTAGAAGAAAAGACTAGCCAAAATATTTGTGCATGAA CCCTTTTAAATATGAAACAGTATATTTGAACTCTTTCACTTCACCCACCT CTGACCCCTTTTCTTCTCCATCTTGCAGTTCTTACGACCTCTTTCAATTC TCAGGCCTCCCCTTCAAACTGCTAGATGTAGAAGAAAAGACTAACCAAAA TTGTTGTGCACAAACGCTTTTGGCTGTGAAAGAGCTTGCGTGAACTCTTC CACTGTGTAGAGTTATGGCGAAGAATAAGGGTGATCTTGCAGTTCTTATG ACCTCTTTCTTCTCAGGCCTCCCCTTCAGGGGGCTAAATGTAGAAGAAAA GACTAACCAAAATTGTTGTGCACAAACGCTTTTGGCTGTGAAAGAGCTTG CGTGAACTCTTCCACTGTGTAGAGTTATGGCGAAGAATAAGGGTGATCTT GCAGTTCTTATGACCTCTTTCTTCTCAGGCCTCCCCTTCAGGGGGCTAAA TGTAGAAGAAAAGACTAACCAAAATTGTTGTGCACAAACGCTTTTGGCTG TGAAAGAGCTTGCGTGAACTCTTCCACTGTGTAGAGTTATGGCGAAGAAT AAGGGTGATCTTGCAGTTCTTATGACCTCTTTCTTCTCAGGCCTCCCCTT CAAACTGCAAGATGTAGAAGAAAAGACTGACCAAAATTGTTGTGCACAAA CCCTTTAACCATATGCAATGTTATATTTCTTTTTCTTTTTTTGCCTTTTT ATAAATTTTCTAAATTTTCAAATGTCAAATTTTATATTTGACGTCACTTA CACAAACCTTGATTTTATTGTCAATGAGATTCCTACAACTCAGTTCAAAT TACGTAAATTTCATTATTATCTAAAGAACCATAAAATTGTTTCGATTAAA CTATTTGTATAATAATAGTGCTTTGTGTTTTGATGCCGTATTAATTTCCT TATTCTGAGACCCGAGCTTTTCTAAAATTGATAATGATAATAATATGCCT AGCCTCGATGTCGAGTTAAATAGTAACAAGTTCATATCTCTGAATACGAT AGTTTAATAAACTCTTTTTTACAACCAAACCGTCGTTGGTTTACGCATTG CACAGGATCAGTATTTTATACTAACATTGTACCCAAACATTTTACCCCAA TGAATTTCCTTATGGGCCTCACCCTATACACTACACTCAACACTCCGTAC TCATTTATGCCTAGTTTTGTCTTCCGGTAGAAAGACACCTTTTTACGGTG AAAACTTTTCTTGATCATCTTTTCCCATAAACATTAAACCTCAATGAATC TTTTCAGGGTCTAACCTTAAAGTCCCCTTAAACCCTGCATCCATGATTCT GCACCCATGGCCAGGCTTCTATCGGTGAGGCAGATTTTTTTCCGTCAAGA GATAGGGACCTACGTCAGCGGCCGAAGTCCCTCAAAACTTCAACGCGGGG CTCCATCTGGCAAAGACCTACACGAACGGTCGAATACCTACAGATTATTG TGTGATTACTTTTCAACTGTCGAAGACCTACAGGAACGGCCTGTAATGTG ACCTAGCGGACGAATATCTCTGAATCGATTTTCTCTTTTTGCATCGCTAA ATTATCGCGTACAAATAATTGCCAGTTAAGCTATAATTTCTTATTCACGA TATATAATTTGTGAATAGAGTAGCCTTTGCAAACGTTGAGATATTCAATT ACTGATTTGATTGACCAGTATTCACTTGGCATCAAACTTGCACAAAATGT ATTTCTTATTTTTTTCCCAAAAGTGTCATCTGTGAAGCTAAGATCAGAAA TGTGCTCAACCGAAGATTTATCCTGGAAATTTGATCGCGCCTCGAATGGT TATAGCAGATTGAAGCTAACAAATCTCCTGTATTTTTAGTTGAATCTAAG ACCAAGTCCTTCAAGAAAATGGGAATTTCAGTTCATTCTAATTTCTTATG TCAAAAATTACTTAACAAACGAATTTTAACCGAATTTTCTCTACCGGTTT TAAAGGGCTCTGACCATGTCGGAAAATTGGTTTTAGTATTTGAACATAAA TGTTATGTTTTAGGTTCTTAACACTTTTAACAAGGAATTGCCTTTATAGA TTGCTTTTTAATCAAATCCCTTAAGAGTAATTAAGATTTTAGTTACAAAA ATAACGTTATGAACTTTAAAAAGACGTGCTAAGTTTTAATGGGTAATTAA CCTTTTTGTTTCGAAGTTTTTTTCAAACTGTCCGCCAAGAATTGAACTGT TTTAAATTTTTCGTTAAATAAATGCATCAAAAGTTATGGCTGTTTTTCTA TGAAGAATTGGGATGGAAAATGGTCAATTTTCAAGATTTTGAGACAAATA AGCTTTTAGAAAAACTTTCCGAAAAAATAATTTTAATTTGATAAAAGATA CACCATCTACTGCAAATATTTTTTTTAAATGTTTTTTATCCGCCGAAACT AAGCTCTTCANAAAAGATACACTGCAAATATTTTTCTTAAATGTTTTTTC TCCGCGGAAACTAAGCTCTTCCAAGTTGAAATACTCTTCTTCGCAAAAGT CTTCATTTTCTTCTTCATCAAATTTTTTCATTACGATTATTAAATTTTCA GACTCAAGGATAATTGGCCTAACAGAAAATGTATAACATGCCACAGTTTT GTGGGCTATATGAAGTAGAAATTTACATTTTGTAAGTGACAAATATCAAA AATTCACTATGGTCAGAGCCCTTAAATCATACAAGTACCGACTCTTTTTA TTATTACCGACTTTTTGTAGCTTGCCTCGCACAAGTATATTAGTCATTAG CGTTGAAGAGCTTTCAAATCTTTCAACGAGTCATCCTCAATTTCAAAATT TTAACAAATGACTTCGAACCTTCTTGAAACGATTTTTATTATTCCTGATC GAAGGTTTGTAAGTATTTATAAGCAATAATAAATAAGCAACTCCAATAGT TTGCCCAACAGGGTTTGATTACTTTGATTTCCAATCACTTTCCGTCCACT CCGTCACATTTGGATTCTCAAATGTCCAAGTCTTGATGTTTGCCTTCAGT CTTCTTCGACCGTAGAAAACTAATTACACATATTAAATCTCTAGATATTT TGCCGTTTTTGTCTTTCATCGCTAGAATACCCCATGTTAATTTTTTGGCT TTTGGCGTAGGTCCTCGTCCGTTGACGGAAAAAATCCGCATTTGCCAGAA GCCAGTTTTCATATCTATATTTATTTATCACTGGTCATTTAAGGCTTATT TTTGCTTAGAGGTAGGTCCTAAAATATAATAAGAAAATACTCACACGCAC CAAAATGATGACACAGGAAAATATTAGAAAATGAAATGGTTCTTAGACAC TGACAAATGTTTTCGGATTGTTTGTTTGTGAGTGCAAGTATACTTATGAC CAGACAGGTTTGATTTGTTGTCCGATTAACAACAAGCTAATAATCACATC ACTGCCATACCAAAACACTCTGTAGGGACACTTCCATTTCTAATATTTTC CTGGTTAATTGATCGCCGAAACACTGCTTTTTCCAAGTCAAGTCCATTTC TTATTGAAGTAAATCCGTATTCTAATTTTAATGCGACAATTCTAACAAGC ATCAGCTTTCAAATTATTATTTGACGTCAGTTATCAAATTTCCTGCATTA TTCTACGTCACCCAGTTTCATTATCGATCGAAGTGTAGTTCTCATGAATT CTGATAGTGTTACCGTGTTAAAATCATATCATAGTCATATGAACATGTTG CGCTAGAACTGAACCCCCTGAAGGGAAATGAATTACTATTTAAATCATAA AATACTCCCAAAATTTGATGTGCTCGTAATTTTGAAATTTTAAGGCTTCA TGTCATATTCCTATTACATAAACTTTAATTTGTATAAGATCCACTTTTTC TAGTATCAGGGTTTTTTACTCATTGTTCTCATAAAATTCTTCTTAAATGT ATAACAAAGATTTCATGGATCCAATCATTCACGTCTTTTTCTTTGTTTAT TACAATTTTCCCTTTATTTGTTAGGTGTGAACCTTCCAGCTCGCCGTGTC ATCATTCGATCCCCTATGTTTCATGGAAAATTGATCGACGCCTTGGTGTA TAAACAAATGGTGGGGCGTGCTGGGCGGAAAGGCGTCGACACTCAAGGAG AAAGTATCTTGATATGTAAACCAAACGAGAAACAAAAATCACTTGCTATG ATGACGTCACTCTTGAAACCTGTCTATAGTTGTTTGTTAGGTAATACGCT TTTTAGAAGTACACATATATCACTTTTGGAATTTAAAGTTTAATGCCGTC CGTATGAACGACGATCTTCAGCCAAATTCAATGAAACCTAAAATTCAAAT TAGTTTTAAATTTCAAAATAGTGTCCACTGTGTTTAAGTTTTTCATAAAC TGCGTAAGAAGATTTGTGTCTTCTAAAGCGAAAACTATTCATAACATTTT AGATGCAAGTCGTACTATGAATCGTGCATTACTGGAGGTCATTGCTGGCG GAGTCGCAGTGTCCCCACCTGACGTCGAGCTCTACGCAAAGAGTACTTAT TTGAACACGTGTTTGGCCGTTCAAACGGGCCGTCACCCTGAAGAACTGAT ATGCACATCTATGAAGTTTCTACTGGAAAATGATTTCATCAAACTGCGCT TTGAGAAAAATAAGGTATAGATGAATGTAATTTGTCTTTTTCAAGTTACG TCTTCTTTTCTTATATCTTTTTGTAGAATTTGGATGAAAAAATCAAGTTG ACGCTTCGAGACAAAATGTTACTAGAAACCTCTGAGGATAAAATGGCGAT CTTACAAGATGTCAAGAGGGGGCGAGGACCCAAATTAGTACTTTCGATGA TTTAGTGTACATATTCTGACCGTTGTGCTAGCAATGGCCTGAATGGAGCA GGGAGAGAAAAAAGCCGTTAGCCCCGCTGTCAGGGGGATAATTCTACGTT CTTTAAAAACTACCAAAACTCAGATGGAAAAATAATTCGAGTGATAGTAT AGATTTTAATTTATCAAGCTTCGGATTAGAAAAGTTGGACGGCGTGTTTT TTACACAAAACTGCAACTTAAGTTTGAGTTTCTTACATCCACGTTTTTGC AAGAATTGCCTTTTGATTCTTTCTCATAGGATGATGTGAACGAGAAATCG AAAGAACAATACTTCCCATCACAATTGGGCACCGCTACAATGGCCTCTTC TATGAAACCAGATGAAGCCATAATAGTTTATACAGAGTTGCAAAAAGCAC GCCGTAATTTTTGCCTGGAAAACGAACTTCATATCATATATCAGGTGTCG TATTTTTACATTCTTCTTTTTTACCCCTGAAAAACAGTACCTGTTTCCAT TATGTAATTTTGATACCTGNGCGGAAAGGCGTCGACACTCAAGGAGAAAG TATCTTGATATGTAAACCAAACGAGAAACAAAAATCACTTGCTATGATGA CGTCACTCTTGAAACCTGTCTATAGTTGTTTGTTAGGTAATACGCTTTTT AGAAGTACACATATATCACTTTTGGAATTTAAAGTTTAATGCCGTCCGTA TGAACGACGATCTTCAGCCAAATTCAATGAAACCTAAAATTCAAATTAGT TTTAAATTTCAAAATAGTGTCCACTGTGTTTAAGTTTTTCATAAACTGCG TAAGAAGATTTGTGTCTTCTAAAGCGAAAACTATTCATAACATTTTAGAT GCAAGTCGTACTATGAATCGTGCATTACTGGAGGTCATTGCTGGCGGAGT CGCAGTGTCCCCACCTGACGTCGAGCTCTACGCAAAGAGTACTTATTTGA ACACGTGTTTGGCCGTTCAAACGGGCCGTCACCCTGAAGAACTGATATGC ACATCTATGAAGTTTCTACTGGAAAATGATTTCATCAAACTGCGCTTTGA GAAAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001020XLOC_001020Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001980-exon-sc0000012-1575043694:1162582..1162739TCONS_00001980-exon-sc0000012-1575043694:1162582..1162739Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1575043694:1161959..1162181TCONS_00001980-exon-sc0000012-1575043694:1161959..1162181Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1575043694:1161408..1161556TCONS_00001980-exon-sc0000012-1575043694:1161408..1161556Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1575043694:1160127..1160988TCONS_00001980-exon-sc0000012-1575043694:1160127..1160988Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1575043694:1146700..1146915TCONS_00001980-exon-sc0000012-1575043694:1146700..1146915Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1575043694:1145035..1145241TCONS_00001980-exon-sc0000012-1575043694:1145035..1145241Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1510915933:1162582..1162739TCONS_00001980-exon-sc0000012-1510915933:1162582..1162739Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1510915933:1161959..1162181TCONS_00001980-exon-sc0000012-1510915933:1161959..1162181Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1510915933:1161408..1161556TCONS_00001980-exon-sc0000012-1510915933:1161408..1161556Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1510915933:1160127..1160988TCONS_00001980-exon-sc0000012-1510915933:1160127..1160988Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1510915933:1146700..1146915TCONS_00001980-exon-sc0000012-1510915933:1146700..1146915Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1510915933:1145035..1145241TCONS_00001980-exon-sc0000012-1510915933:1145035..1145241Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1491911889:1162582..1162739TCONS_00001980-exon-sc0000012-1491911889:1162582..1162739Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1491911889:1161959..1162181TCONS_00001980-exon-sc0000012-1491911889:1161959..1162181Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1491911889:1161408..1161556TCONS_00001980-exon-sc0000012-1491911889:1161408..1161556Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1491911889:1160127..1160988TCONS_00001980-exon-sc0000012-1491911889:1160127..1160988Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1491911889:1146700..1146915TCONS_00001980-exon-sc0000012-1491911889:1146700..1146915Clytia hemisphaericaexon
TCONS_00001980-exon-sc0000012-1491911889:1145035..1145241TCONS_00001980-exon-sc0000012-1491911889:1145035..1145241Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:1145035..1162739 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.0912937 0.188206 0.253403 0.104876 0.634539 1.45653 0 0 0.214148 0.583613 0.066176 0.105401 0.117009 0 0.0629809 0.451636 0.289537 0.0534072 0 0.075857 0 0.0574968 0.14172 0 0 0 0 0 0.697084 0.568343
Blast
BLAST of TCONS_00001980 vs. Swiss-Prot (Human)
Match: DPOLQ (DNA polymerase theta OS=Homo sapiens GN=POLQ PE=1 SV=2)

HSP 1 Score: 571.622 bits (1472), Expect = 0.000e+0
Identity = 288/551 (52.27%), Postives = 395/551 (71.69%), Query Frame = 3
Query:  201 KKRLSAEKKNSMPSPELNSSLQLSQWGLPEVILENYKAKGINKMFEWQKECLLQDQVLDGANLIYSAPTSAGKTLVAEILMLKRVLETEKKAIYILPFVSVAREKMYSLRNQFEEAGINVGGFMGNETPPGGLTNIDIAICTIERANSLINRLMEEDKLSLLGSIVIDEMHMIGDPSRGYLLELLLTKIRFLMAKNATNVGENNESSSNHDNGIQIIGMSATLPNLDMMARWLDARFYVTDYRPVPLDEYLKTSKTIYDCADTVVRTISPEDTIKGDDDDVINLCLETMRDTNSVLIFCPTKNWCEKLSISIA------NYLANNVLSKESDTENIFDKEGLQDVLSELQQTPAGLDPSLEKVVSSGVSYHHAGLTMDERDIIEGAFRRGVLKIIIATSTLSSGVNLPARRVIIRSPMFHGKLIDALVYKQMVGRAGRKGVDTQGESILICKPNEKQKSLAMMTSLLKPVYSCLL-----DASRTMNRALLEVIAGGVAVSPPDVELYAKSTYLNTCL-----AVQTGRHPEEL--ICTSMKFLLENDFIK 1799
            K   + E K ++P  E +  L L+ WGLP+ +LE Y + G+ KMFEWQ ECLL  QVL+G NL+YSAPTSAGKTLVAE+L+LKRVLE  KKA++ILPFVSVA+EK Y L++ F+E GI V G+MG+ +P    +++DIA+CTIERAN LINRL+EE+K+ LLG +V+DE+HM+GD  RGYLLELLLTKI ++  K+A+      + +S+  N +QI+GMSATLPNL+++A WL+A  Y TD+RPVPL E +K   +IYD +  +VR   P   +KGD+D V++LC ET+ D +SVL+FCP+K WCEKL+  IA      ++ A  ++        I +++ L +V+ +L++ P+GLD  L+K V  GV++HHAGLT +ERDIIEGAFR+G+++++ ATSTLSSGVNLPARRVIIR+P+F G+ +D L YKQMVGRAGRKGVDT GESILICK +EK K +A++   LKPV SCL      + + +M RA+LE+I GGVA +  D+  YA  T+L   +      +Q  +   +L  I   + +LLEN+FI+
Sbjct:   50 KAAAAGECKPTVPDYERDK-LLLANWGLPKAVLEKYHSFGVKKMFEWQAECLLLGQVLEGKNLVYSAPTSAGKTLVAELLILKRVLEMRKKALFILPFVSVAKEKKYYLQSLFQEVGIKVDGYMGSTSPSRHFSSLDIAVCTIERANGLINRLIEENKMDLLGMVVVDELHMLGDSHRGYLLELLLTKICYITRKSASCQA---DLASSLSNAVQIVGMSATLPNLELVASWLNAELYHTDFRPVPLLESVKVGNSIYDSSMKLVREFEPMLQVKGDEDHVVSLCYETICDNHSVLLFCPSKKWCEKLADIIAREFYNLHHQAEGLVKPSECPPVILEQKELLEVMDQLRRLPSGLDSVLQKTVPWGVAFHHAGLTFEERDIIEGAFRQGLIRVLAATSTLSSGVNLPARRVIIRTPIFGGRPLDILTYKQMVGRAGRKGVDTVGESILICKNSEKSKGIALLQGSLKPVRSCLQRREGEEVTGSMIRAILEIIVGGVASTSQDMHTYAACTFLAASMKEGKQGIQRNQESVQLGAIEACVMWLLENEFIQ 596          
The following BLAST results are available for this feature:
BLAST of TCONS_00001980 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
DPOLQ0.000e+052.27DNA polymerase theta OS=Homo sapiens GN=POLQ PE=1 ... [more]
back to top