Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001866 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001866
Unique NameTCONS_00001866
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2543

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001866 ID=TCONS_00001866|Name=TCONS_00001866|organism=Clytia hemisphaerica|type=transcript|length=2543bp
TGTCTGAACTGTATAACAGACCGGTCCATATTGCTCACGTTGCCAGGAAA
GAAGAGATCCTTGTTATCAAGGCTGCTAAGAAGAAAGGGCTTCAAGTGAC
CTGTGAAGTTGCACCCCACCATCTCTTCCTTTCCACTGACGATACCAAAC
GTATCGGTGAAGGACGTGCCAGGGTCAAGCCTCAAATTTGCAGTGCTGAA
GACCAAAAAGCATTGTGGGAAAATATGGACTTCATTGATTGCTTTGCCAC
TGACCACGCACCTCATCATGTGGACGAGAAGAATTCTGAAAACCCTCCTC
CAGGTTTCCCAGGCCTCGAAACTATGCTACCATTATTGTTGACTGCAGTC
AAAGATGGCCGACTCAcccttgatgacgtcattttacgTTTGCACACCAA
CCCGAGACGCATTTTTGGCCTTCCAGAGCAACATGACACCTACGTTGAAG
TGGACTTGAACGAAGAATGGACCATCCCCGATGCTATGGCGTACACAAAG
TCCAAATGGACCCCTTTCGCTGGGATGAAAGTGTTCGGTAAAGTTTGCCG
CGTGGTGGTCAGAGGTGAACTTGCTGTTATTGAGGACCAGgTGCTAGCCA
AGCCAGGTTTTGGTGAAGATGTACGCGCATGGGAGCCTCCAAATTGTCTA
CCACCTCTCTCCAAAGCTCAGAAACAGAAGCTCGATGCCATTAATAATGA
ACAACCAACACCAGCCAACTTACCTGACATCGAACAACCTTCATTGCTTA
GCGGACCGCCCACGCCAATCCGCAAAATCTCTAACATTATGGAAAAGCTT
CACACACAAGACGGTCTATCTGCAGAGCACCACCATGCACCTCACTTCTT
ACCACCATTCCTTCATTCTCAACTACTGGTCGGCAAACACGTCTTAAAAG
TGGAGTCCATTAACAAAGACCAGTTAAATGCTTTATTTAACATCGCACAA
CAATTGAAAAAAGAGGAGAGGCGTGGTCGACAGATCGATACACTTAAAGG
TAAAGTTTTGGCGCTGATGTTTTTCGAACCCAGTACTCGCACTGCATGCT
CGTTCCAGTCTGCAATGCAGCGTCTCGGTGGAACTACCATCGCTATCAAA
CCTGGAAACTCATCACTCACCAAGGGAGAATCTGTTCAAGATACGGTTGC
CACTATGGCTTGTTACAGTGACGTCATCGTCATGAGACATCCTACCAAAG
GCATGGTTCAGCAAGCAGCGGAGAAGTCGCGACGCCCGATCATCAATGCG
GGAGACGGGGTTGGAGAACACCCCACACAAGCTTTGTTAGATGTTTTCAC
TATCAGAGAAGAAATTGGTACCGTCAACGGAATTACCGTGACAATGGTTG
GTGATCTGAAGAATGGCCGTACCGTGCATTCATTGGCTCGCTTATTGACA
TTGTACCGAGTGAACTTACAATACGTTTCACCTGACTCTCTTCCAATGCC
TGACAACGTTCAAAACTATGTTCACAAGCGTGGCATCCCACAGAGACAAT
TCAAGACAATTGAAGAGGCGTTACCGACAACTGATGTGCTATACATGACA
CGAATTCAAAGAGAAAGATTTGCAGACCAACAAGAATACGAGAAGgtgCA
TGGTTATTTCGTGTTGACACCGAAAATGTTGACGAAAGCGAAGAACAAGA
TGATCGTTATGCACCCATTCCCAAGAGTCAACGAAATCAGTACTGAAGTG
GATTGCGACCCAAGGGCTGCTTATTTCCGTCAAATGGAATACGGGATGTT
TGTTCGAATGGCTTTACTTTCCATGTTGACTGGTCGATTTTAATGGACAG
AGAAAACCGAAAATTTACGTAATCTTTGTCATAAAAGAAAACGTCACAAA
AAGCGAAAATATTGTAGCCATCTGAGCACTAATTTTATAGCTCGACAAAA
GAATATATTATAATGGATTGTAGGGCAATTTTGTAGTCATTAATTTTTAA
GTCGGACAATTTTCGGTCAAAGAATTTATCACTTTCCCAAAAGAGACATT
GCAAATTCGTTTCTAATTATTTCGTTAATTGGTATTGTCGACAGTAATTA
GATGTTTGTGATATTATTTTTGCGGTTcatatttgagatttttttatttt
tgtagctTTTTTTCCAGATcccttttttagttttatatatttttactttt
gGGATAAATAGGCTTTTTTATTATcatattattgaaaaaaataatcaaaa
aatcttgacaTAAAAAAGGAATACAACATTTGATCATTTGCTTATGTGAA
AGATTGTTTATTGTAGACCACAATCCTCGCAAAACCAATTTCCTGAAAAC
CGTCACTTTCACCTAAAGTGCGGACTACATTCTTGCGAACTTTTACGAAA
GGTATTAGCACTCTTCTTGCCGGAAATTTAGGAAGTTCTTTCAACCGTCA
AAATACACTCTAGATTGCGGTTTTTCCATAGTGAATTTTCGTTTTGAATG
AATAATTTCTTCTTTATCTTAAACTCTCACGATATAAGTTAGTACTATGA
AATTAAGGGGAATGAATGAAAGAGTACTATATTCAAATCAGCC
Run BLAST on NCBI

transcript from alignment at sc0000012:62297..95754-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001866 ID=TCONS_00001866|Name=TCONS_00001866|organism=Clytia hemisphaerica|type=transcript|length=33458bp|location=Sequence derived from alignment at sc0000012:62297..95754- (Clytia hemisphaerica)
TGTCTGAACTGTATAACAGACCGGTCCATATTGCTCACGTTGCCAGGAAA GAAGAGGTAATGTAGACTAAGCCATAAGCTCAACGAAATCATAATCGACC GTTTCATTTGACGTTTCTTAGTTAACCTTTCTCTGGTCTGCATTATTTCA CTCTAAAAATGATTTAAAAAATCTTATTATTTATGATTTTGAGCTCTCAT ATTCAACTTATTTTCTATTTTATATTATGATATTTATTATAATTCACTGG AGTTTTTATCAATTTTATTCATCATTTCCACACTTGATCCACTTCCACAG ATCCTTGTTATCAAGGCTGCTAAGAAGAAAGGGCTTCAAGTGACCTGTGA AGTTGCACCCCACCATCTCTTCCTTTCCACTGACGATACCAAACGTATCG GTGAAGGACGTGCCAGGGTCAAGCCTCAAATTTGCAGTGCTGAAGACCAA AAAGCATTGTGGGAAAATATGGACTTCATTGATTGCTTTGCCACTGACCA CGGTTTGTTTTTTCCTTGTAATCCTTTTCATTCCTATAAATTCTGATTCT GAAGATTTTGCCCTCCCCTAATATTATTAACTTATGTGAATATTTTGTCT GGTTTTGCGCCCAAGAGTTTTGTTCTTTTATTTATCTTTTCAAGAAAAAA CTATACGCCTTGTAAGTTAAAACTAAAGGGAACTAATTTTCGAAATAGCC TTATCTGTTAAAATTAACCTTAGCTGATTGTATTTGTTTTTAATCACGAT ATATTATGCAAGCTATTTTGGAAGCAATTATAATATTTTCAATGGGATTT ATTAGAGGTCGGTTAGTGGGCAAAACCTCAAAACACACCTTTTTATAGTA TTGTTAATGGTTTTTTAATGCCCCTTGCTTTTTTCTCATAACCTAAGAAA TTCGATGAATCTAAATTTTACTCTATAACGGTTTGTTGATTGTGATTAAA CGAAAAGGATCCTGATTGGTTCATTTGAAAACAATGAAAAGCGGGTCAAG GTATTGTGAATTAAATCAAGTTGTAAATCAATTTAGGCTTGCCATTAAGC TTTTCTTCCTGAGGGAATCTGAGGTAGTTTGTTTTATAAGTGTGAAAAGG AAAGCTCAAAAGAGACGAAATGCCTGACTGGGTTGGAAATTAAAAACTAG GTGCGACGGTTTTTGGAACCGACTCGAGACTAAAAGTGTCTGATGAAAAT CAATAACACTGAGGTTTCTTATGAAAGATTCCATCCGACGATCCGATACC TTTGCATGTCATATATTTTTTCATTAAAACGACCAAAACTAATTTAGTGG TTTCTTCTTAATTGGACTTTAACAATGCAATCCTCATCAATGGAAACGAG GTCTATCTAAACGGATCTAAATTTAGAAATTGTGATGAAGGCATGGTATG ATTTTCAGGTGATACTGTCGATAGCTTCAATAAGTTTACTGCGAAATTAA TTGGTTAAAAGAAACCTTGCTTTTTGTAATTTTCTTTTTTCTCCGACCAA TTAACCTTTGAACCAAAAACTTTCAAAAACCTCCAGAAAGGCGGCTACTT TAACACCGAACTTTTGATAATTAAATTCCTTTATACAAAGCTCTATTTCC CACAGTAATTACAAACGATTGTTTTGTCTTGGTTTGGCATTAGACCAAAA AGAAGAGTATATTTAATTCAATATATACGACCAGTCATCTTTGTAATCAC TTAATGATTGACTGGCTGCTGATTTTTCTTTTCAACAGTTACATCTCTGA TTTGGCTTTTCATTCATTTCTTTGGAAGTTCTCTTTCCCTCCTATAATAT ATGTGATGTCATAATTTTATTATCCTGATTTGATCAAAATCAAAGCATTT AATTTGGTTCCTTGGTCTTAATCAAGTTACTTTTCTTCTTTCTCTCCGTA ATTGCTAGTCTTGACGTACGATTGTCTAATAAAATTTCACTTTTATTTAT AATCAAAGGCAGTCAAAATTGAATGATTTAAAAAAAGAATCATACCCTGT ATTTGATCAACCAAAAGCCGTGAAACTATGTAAATTACAGGCTCTGAAAT TATTAAGAACCTTGTGTTCAACAACAAATAGAGACTTATTTAATCCTATT CCCCTGTCTCAATATTAAATTATATTGAATTTACGTCAATTCCCCCCTCC TTTTTCAGCACCTCATCATGTGGACGAGAAGAATTCTGAAAACCCTCCTC CAGGTTTCCCAGGCCTCGAAACTATGCTACCATTATTGTTGACTGCAGTC AAAGATGGCCGACTCACCCTTGATGACGTCATTTTACGTTTGCACACCAA CCCGAGACGCATTTTTGGCCTTCCAGAGCAACATGGTAAGAAAAGAATTC TCTAAAATTAAGTTGAACAACTTTATAACCCTTATAACCAACTTAGTTGC TACATACCAAGTAGAGAATACAGGTTTTTTTAACTTCTAGCCTTCCTTAT TAGCCTGTTCTCGCTTAAAAGAAATTGAAAAACCGAGTCCGTCTTAAGGT CTGGAGTCAAGAACTCTTCCAGAAATGGATCTTGTTTGATAAACTGTAGG TTTTATGCAGTCAACGAATAGTTATAGTCGATACAAAGACTGGGCCTTCA TTTTGAATACTCTGACTGATGGATGGGCTATCAGTAAAAAAGTTCTATGT ATTGTCAGCTTTATGTAGAAAGACTCTTTGATATTGTCTTGAACTTCGAA AATGTTGATTAATCATCTGAATGAAGGGTTTTCCTCTGATAATGAAAATG CAGTCATTCATTTTAATTATATCATTTTTATCAACAAACGAAAAACAGGG ATGGTGATAGTCTTATTAAGTTGGGATTAAGACACATCTGACTTGCACAC TTTATCCTGCAATTATAAGCTTTTTGACATCTTTGAATACTTTCACTGTG TTACTCAATTTGCCAGGAAAGCTAGCCTCAAAAGTTGGAAAAAGGATCTT GAAATTAGAACCCTTCCTTTTGTTTCAACATGGAACACAATAGACAAACC ATTCCACTCTACATGGGGTACTAGGTGTTTGATGGGTTTATATTAACTGT ATGCGATGAAGAATTTGTCGCCCGTTATCAACTACTACTCCACAACTAAA AGGGCTTTAAGAAATTTAAATGGATAGGATTCGCCAGCACTCTTTAAAAA TGCATTTACACTTTGTTTCTTTCAATACTTTTACTTACCATCCCGTAATG TTTTTCAAATGAGTAATTATCACAAGATTTGCACAACATGATTCGACCAA CACATTATTGACAATCTTATTTCCGTTTTTCAGCTCGTATCACCAGCACA ATGAGCATTCAGCCATTTCACCCTTAGTGCTTGAAACCCAATCACTGTCA TAATTATTGCCATGATTATGATGACCCCCATTTCCTCTGTCAATGTGATA TTGACTGAAATTATTATTTGTTCATCCTTTAGGACTCGCTTAGTATTCGT TTATTATATTTGCATCTGCATTTGAATTTTGAATTGAAGAATTTTAAAGT TATTTTTATAGTAAGGAAAAACACTAGAGGTACCAAAGCTCTTTATTTTA TGCTGTTAAACTAGATATCTTCACAAATGAGGGTTTTTTTTCTCGAAAAG GCTAATTCTTGAAGCTAAAAAAATGAAAAAGTATTTTTTCACTGTCGGAA ACCATAATACAATATATTTGCCGGCAGTCGTCAGCTGATTTTCGACGTCA GAAAAAATTAAAAGACATAAGTTAAATTGTGGCTTTTTCGAGACAGTATA ACAAATTGTGTCATTAGAAAATAGCAGGGAAAATATTTTTTTTGTAAATT CAATCGAATTCTATTACACAAAATTTCTCATTGACGGAAGCATTCTGTTA CAAAAAAGAAACTAATCAGTGAGAAGGAAGATAATTATTTGCTCCCACCG TGATTTTGTAAATCATACCCCAAAGTACATGCTAGTTTATAAGAACCAGT AATTTAGTTGTTCTTATTTTTCGTGATTTTAAGGCATAATGTCCTTAAAA TGTTCTCAATGTGATTTCATGCTTTAATTATTTTGTAATGTTCTTAACGT GTTTACTTCACTTATCAACTTAAAAGGGATTGGGATTGGGGATTCTTCTT CATTGTTCTTAAAGAGCTTTTCTTCTAAAAAAATAGAGCGTATTCAAAAA ATATCTCCACCTTTAACATCACAAAGTAAATCAACGAATTGTTTTAGTAT CTGAAAAAATTGCATTAGCCACTTATCGGATGACTGGTTGACTACCCAGT GTCATAAGTAATATCAAAATCAAAGCTCTGCTATAAGAAAATTCAAGCTA TTCATTACGCTAAGATACCCCAATTTCACTCAATACCTTCCATTTTCCCA TAGACACCTACGTTGAAGTGGACTTGAACGAAGAATGGACCATCCCCGAT GCTATGGCGTACACAAAGTCCAAATGGACCCCTTTCGCTGGGATGAAAGT GTTCGGTAAAGTTTGCCGCGTGGTGGTCAGAGGTGAACTTGCTGTTATTG AGGACCAGGTATGGCTAAATTATTTACCAACCATTTTTTTGAATATTTTT TATGGTGAAAAAGCGCGAATGTGCTTTTTAAATATCAAATTAACTCTTGT TTTTGCTCCTCCATTTGATTTTTGTGATAAAGGTTTTAGAGAGTTTTCAA AAATTTCCTACTGGACCATTTAAAGAAGAGGTCGTTTTCTAAAAAAACAA TTATTTTTACCAGATAATTTTCTTCTGTGGACGAAATAGTCTAATTTGAA ATCGATTAACTGAGGAAAATGTCTCCACAAATGGCTTTAATATCGGTTTT TCTTTTCTGCCTGTCTCACTTTCACCTCTTTACAACCAATATGATGCATT ACTGCGTTTCTGCAACAAAAGAAATCGTGCTACTAATTGAAATTTCTTAA CGAGATTCTGCGGTTTAACCTCTTCATTTAACGACCTCCATGCTTATAGT ATTGGTATAAAGAATCCTCATTATCGTGCGGGTCATTAATTTATACGAAT GATGTTGCTATAGTAACAACAATTATATGGAATGCTAAATTTAGGCTCTT TTGCACAACCCGTAATAATTTTTTTGCGATGGGTCATAAATTTGAGGATT TGTATCCCCAGCTGTATTAAATGTCATCCAAATTTTCACCATCAATTTGA CCAGATAATTAATTTGCTGGGATAACTTTCTGACAGTGTGGTTACATTGT TTGTGTGATTTGTCATTTTTGTTGGTCATTTTTGAAAAATTCCTTGTGTT CAGTCATTTTTGGAATATTTTAATGTCTGTTTTTGAATGCTATGCTTTCT CTTCGTCACACACGCCCTTTATCATTATCACCCAAAACAAAATTGCACAC TTTAATTTGTTTTAGAAATTTCTGATCCGAACCCTATCTGCAAAATTTTT CGGTGGGAATGCTCTGCCTTTAACGACAGGACAATTCTTTTTTTCCAAAA GAAGTTTCTCAAATTTTGTCGAGATCTCAGCGCACTGTGGGTCAACTTTC GGAAAGGAAAGGATTTTTACTGTGACTTAAAATATCATTCAGAATGTCTT TCTTTGGAGGATTATTTCTAGTGAAAATTACAGATAATGAAAAAGAAGAG GATTTTGGGTCTACTCTTTGAATAAATCCCATCTCACTTTTTTACTTTTC TTTAGGTGCTAGCCAAGCCAGGTTTTGGTGAAGATGTACGCGCATGGGAG CCTCCAAATTGTCTACCACCTCTCTCCAAAGCTCAGAAACAGAAGCTCGA TGCCATTAATAATGAACAACCAACACCAGCCAACTTACCTGACATCGAAC AACCTTCATTGCTTAGCGGACCGCCCACGCCAATCCGCAAAATCTCTAAC ATTATGGAAAAGCTTCACACACAAGGTAGGAATCTTTAAGTACTTATGTT TTCGACTCGATCGTTTTCTCAGAAATGTTAGGAAAATCCAACTCCTGATG TACTGCGTTCAACCCAGATTCAGAAAAGTTCGAAGGCGTAAATTATGCTT ATTTTTTATAGACGGTCTATCTGCAGAGCACCACCATGCACCTCACTTCT TACCACCATTCCTTCATTCTCAACTACTGGTCGGCAAACACGTCTTAAAA GTGGAGTCCATTAACAAAGACCAGGTTAGAAATGTTTTTTTAGAAACTGT ATTTAGAAATACCTTAGATTTAGATTTGGGATCCTCGATTGCGGCCGTGG CTGTTTAAACTTAACACAAAAGGCATCTATTGTTTGGTTAAAGATCCGAT GATTAGTCGATTGGTAAAAGGCAGTGGAACGCCTTGAGCTAAATTTCGGT TTCTAAATTCCTTTGTCACTGTAGCAATAGATAAAGTGTGAAATAGGTAA TCGTCGTACATGAAATTCAAAACGATACCTTCATGGGTATGCCTTTTTGG TTTCGTTTTAAAGTTTTCATTGAGGTGAAAACGATTAGTTTTTGGGTTTA ACTTGTGACGAATCTAATGTTTATCTTATGTCTTGTGTTTCAGTTAAATG CTTTATTTAACATCGCACAACAATTGAAAAAAGAGGAGAGGCGTGGTCGA CAGATCGATACACTTAAAGTATGTCGACGCCCCTTTGTACATTTTACCCC TTTGTGTGCACACAGTGAAATCTACTCCACTTTGACTTTTCTTAGAGGGG TCTTGCTTCAAACTATCGTTGCCTTGCAAACAATGTACCCTAATGTACCT TTCAAATGTTTTTTTCCTATCCAATGTAGCTGACCTAGTTTCCTAAAGCT ACAAAATTTGAAATAATTTCAAACCTGTAGATTGATAGTCAAAGCTTAAA TCCCTAACAAAAAATGAGTTTTCTTAAAGCAATACCTTCATTTTGGCTTT TCACTTAACATAGAACCTTAGAAGAGCCATTCTGTTTATTACTCAAATCT AGAAGCTGGCCGTTTCATCAAGATGTTTCTAAGACGATATGTCTCTGAAG ATGGTTCGAATTTTAAATATTCTTCTTAATTTTGATAGGGTAAAGTTTTG GCGCTGATGTTTTTCGAACCCAGTACTCGCACTGCATGCTCGTTCCAGTC TGCAATGCAGCGTCTCGGTGGAACTACCATCGCTATCAAACCTGGAAACT CATCACTCACCAAGGGAGAATCTGTTCAAGGTATACTAGCCTACTTTCTT TGTTTCATTTGCTTGATATCCCGCTGATTGCATAACATTCAATAACTCAG CTTCTAAAGGATGTGATTTAAGGTACCAAAGACTGCGGAAAATATCATTG TATATTTTAAAATCACGGGGCTTACAAAGTCTCTTGGTACTAAAGGTTCA AAAACCCAAAATAATACTTTCATAAAGTTTTGGCTCTACGAGGTTTAGTT AAAGTAGTTTATCCTTATAAAAGCTGTTTCATGAAAGTGTCGAAGATTTT TTTTCTCCCTCTGTCTTATCACTCGTGTCCTTTGGAATTTCTTTTCGTTC CTCTTGTTGTAAAGTAAGAGCGTAGACGACCAACTGTCTCCTCTATGTTC TATATATAGAAGTATGACATCATCGATCTACCATTATCCCTCCGTAAGCA ACTGACAGACCAGCACGAGAACTATGAAGGTTTTTCCTTTTCTACTTATG AAGATAAAAGTCACGATACTTTTTGTGGGTTTTTTATGGTTGGTTCAGAA AACACTGATTGGTCAAACTTAGACGTCCGGTCTTTTGAAAGCTCTCTCTC TTTTTGATGGTGTTATTCTCTCATCTCTAGAAAACTTGGACCATCCTTCC TGTTTAAGGGATAACTTCTTTACTTTTACTTATTTGTTTCATGGCAAAAT TTGGTAAAAATCTTCATTAGCCCATATGAGACTAACCTTTCTCGTGTAAA ATATCTACTTTTTTTGGCCTACTGATGAGTATGATGCGAGTCGTTTAAAA AATGTTCGAATAATCAGAATCTACGTTATTTCTAAAGGGTTCTATTTCTT GAACGGTAATATCAAATTGCATGCAATAGTTTTGCACACGGCACAGAATT TTTTTAAATGCCTAGATACCCTCAAAAGTGGACATTCGACCCCATGAAAT CTTTTTTCTACACTTAGATTATTTTCAATGGCGGCTTCGATTTACTGAAT TTTGACAGATTTATGCAATTGATCAATACACGAGCTCAATATTTTTGGCA TTTCAGCTGAGTGTCAGCAGTTGTGTTTCCTGATATAAGAACAAAACCGA ACCATAGCTTATCCGATTACATGTATCCCATCAAAAGACTCTCGAATTAC CTTTTATCATCTCTAACAGGGTATGGGTCGTTTTATGCAACTAAAAATAA AATCTCTCGATGATATAATTATTTTTCCTGTGTCAAGTTAACACTATGGA GTTTAAAGCCCAGAGAAATACCCTAGATAAAAGGAAAATTTATGCTTAAT TTAACTTATCAAGAATATTTTAATTGTGAGAACAGACAAGGCACAGCCAA AATTCACTCGCTTTCATAAAAAATATCACGTCAATTTTTCTCATTTTATG CAATAACAAATATGCACAATATTTTTAATGGAAATAGAAAATTACTTTCA TTAATTTCATATAAGTAGTGGTAATATCCAATTTGAAAGGGTTTAAGTCT TTAATTGGGTCAACAAACTTTTATATTGATGGTACTTTTACTAACCCCAT ATCTCTGTCTCGTTTTGATAACGATTGTATTCAATACAAAGCCTGAGACC AAAGCTGAGACTAAAGCATGTTTTCCACTGTTGTTAACAAACATGTGGCG CACACTTCAATCAGAACTTTCTCGGGCTTTCTTCTCTAGATTGACCTTAA TTACTCTTGATCTCACAAATTTGTTTAGAAGAATATCAGGGTTGTCCGCC GAACGGCAGTTAGTTTTTCAGGTTTTTCAGTTTTTCAGAGTTTAACCAAC GATATCTTGGTTAGGGTTGTTATTCAAAGTCTTTATGGACGAGCTATTGT TGCAGGGTCGCCGTTGTCTCTGTACCATCTATCTTACCACGCGTATGACG CTTGTTTCTGACAATTTAGTAGAACTCGATGTTTTCTTATCTTTGAAGTA AACCATCGAGCTGTTTAGAGGACTTTTTCACAAAACTACTCTATTACGAT CTGTGCCCCATTTGAGGTGATAATCAGTTGAATTCTTGACTATGCAATCT TAATTTTAATCACTTTGGTTAACCCAAGTGTATTATATAGGCCTTTGGTT TTTGGAGAGCTATTTGCTCGTTATGGCCGCTTTTCCTCGTTAGCTAACCT AAACGAGTTTATAAGGTAATCAAATTGTAGTCGTACCGAAACCTTTCGAA CAATGCAACTGAAATGTTTGTTTTGACTTCTGCCATCCTTTACGTTTATT GCATTGGAATTATCTCGTTGTGTCCACCTTGAGCCAATGAGTAATTTTCC TATTCAAGAATAAAAAATGTCATGTTTTTTCAGTAGTAAGAAGTCTGGAT ATTTATTGTGAAACGACAGAGACGTTTCAGATTTACATAATCAACAAAGC CACAAATGATTTTTCATTGTGAATTAATACTTTTTTCTTGTGACACACCG TAAAAAAAAGTATAGTATTTAAACTTAGATAGTTTTTATGGCTCTGAAAA CCACAAATCTTTCATCATCCATTCTTTTTTCGAGGCACACTGTATCAAAA GGAAGTTCATTATGATTGACACACACTGTAGAGGAATTTGAAATTAGATA ATTCACAATGTCTCTGAAAACCACAAATCTTTCATCATTGAAAATTGATA CTTTTTTTGAGGCACACTGTATAAAAGGAAAGTTCATTATGATTGACACA CACTGTAGAGGAATTTGAATTAATTGGATAATTCACAATGTCTCTGAAAA CCACAAATCTGTCATCATTGAAAATTGATGCCTTTTTTTTTAGGCACACT GTATAAAAGGAAAGTTCATTATGATTGACACACACTGTAGAGGAATTACT TTTTGATACACGCTGTANGAGGCACGCTGTATAAAAGGAAAGTTCATTAT GATTGACACACTGTAGAGGAATTACTTTTTGATACACGCTGTATTAAATG AGGAAGTAAAACAGATTAGTTTGAGGCACACTGTAGACGAGTTTGAAATC GGATCAATATTATGTCAATTTTTATTGTCAAAAACACGTCATTCATTCAA ATAATACGTTCTCGTGATCTGAGAGATGCAATAAAAAAGAAGGAAGGATT GAGCCTTTATTTGAAACACTCTGTATAAAAATGCTGAGTTAGATATACTT GACAACAATGTTTATCAGATACTATAGCGGGAACCAAGACCACCGTTGAA TTGGAGTTGTGTTGTTCCTTTTATAGGCATAACATATTAACCATTTGGAA TCAGGACTCCATTTGTTTATATAAATAAACCTCATTTTTCTGAGGTGCTC TCCATCCTATCCTTATTTAAAAAAAAAGAAAAATGAGCCAGAACGTCAAA CGTCCATAAACCATTGCAACGAAGTGCTTTTAGATTTGGAATTCTTTGGC TCTTTTGGTTCATCCGACGTGCAGCACTCTTAGAACTTACTCGACGTGGT GTTGTCGACGGACATGGCACTTCATATATGTGGAGATGACGTCACTGACA GCAAACACGAAGATATTAGTCAGCTGTCAGTTAGCTAACATTGCTGTCCT ATTGTCATTTTCTTACCCGTCTAATAAAATGGTTTTCATGAGCATGAAAT TTTCTCACACTTCAAAAATTATGAAATGAGTAAAAAGTCTGAAGTCTGTG ACGCTTACTATAAAAACTTGTCAATTCTTTTCGATGTCTACACGTTGTTA ATTTTAGCTCAAAGGCCGGATATCAATATCGTCTAAGCCTGATCTTTTGC TCACTCAAAAATAACAGTATATTTTAACGACATCTTATCGTAATAAACTA AGGAGCTTTTGACAATTCAAAGTAGCTGTTATTGATTCTAAATACTAAAA TAACGTGATCCTTAACTTTTTAATAGCCGTAAAAATTTTCTAACATTGGA ACCATGTTTCTGAAATTTGGCTTTTTGTCAATTTATGGTCTATCGTGACA GTAAAGTCACGTGTGGAAAAATACGAATCCTTGCACTCGAGCCCAAACTA AATTCTGTAAAGCCTTCGGTTGTCCTTAGAATGTTCATAAATGTTTTGAC TTCGAAGCCTTATGTTCTAATAAAGTTTGTTCTTTTATTGTGTATGGAAG GCATACCATTGAAAGAAAAAGAGAAAAACTTGAGATCTGCCACTCGAATG GAGTGTTTATTATTTCTATAATGTTTTCTGTCTGCAACATAACATCTCTT CCATCTCCTTAGGTAGGCCTCTTATCGAATGTCAACAACATCAGTCATCA TACTCCTGCTAAGGGGATTTTTGTTACCTATCTTGTGGGGGGGGCGTACG GTATTTCGGAATTCCGGAAATCGATCTTCGGAAATCGGGCAAAATTCCTT CGGTATTTCGGAATGCTGAAACTGTTTCGGTATCGGAAGTCCGTGAACTT TTACGGAATCTCGGAAATTTCAGCAAAATTATTCGGTATCTCGGAAATCG CAAACCCCCATACGCCCCTCCTTTCTGATCCATGGTTTTGAGCAAAATTT TTGTTCTTTTGGCAAGGAAACCATATCCAGCAATATCCAACGGACTATCA ACCTTTTATAGTTGATTAAGAGCCAGTGTTACTTTCAAGGGCACGATCAA TCTCTGCTTCGCATTAGGATCTAAAAGATCCAATGATTCTTCGATAAAAA TACATCTCTAAGAATTAAATTCTAATGCATTGACATTATTTTGAACACAG GACACGGGTTGACGGTGAAATTAAGAACATTTTAGACTCAAAAAGTTGAA AACATCCACAAGGCTTCAAAATAATTCGGATGTTCTTATAAAAAAAGTGT ATTTTGTTGAAAATTTGAAAGGTGTGCAATGTTCGTTTCTTAAAGCGAGG CTACGAATTTTCTTTGCATGATAGGGCCCCCGGCTTGAGAGCTGAAGGGA GGGGGCCAAATATTGGAATAGATTGACGTTGCCCACCATGGTTGGGTAAC GGAGAAAAACTTTGAATTTTGAGGGTGAAAGAGGTATTTTAGGACCCATT TCGAGTCAATTTGAAACGAATTCATTGAAGTTTTCAAAATAATCTTTCTC GGCAAAAAAAGTGAGGGGACACGACTCAATGGGTATATAAAACGTGGCAC TCAATTGTGTATGAAAACAAACAGTGTTTGCAATTGCAATTCATTGAGCA ATAAGATATGTCGAATCAAAACACTTGTTATGTCAGACTCTTGTCAATTT TTATGGTATACTAACCCCCTTACGATGGTTGGGTTTTCCTCTGACCTCGT CAAAATAAAATTAATCAGACCATGAAATTAATTCAGCTTTCAGCAACTCA ATTATTAAGTAATGATACTGTTTTTTTCCCAAAATAATGTTTTAAAAGCA TTTCTTTTACAAAATACACATACCACAATTAACTTGTGGGTTAAAGAACA ATCAGTTTTTAATCACATCTTTTCTTTTCTTTTTTTCTTAATGCTTACAT ATTAAAAATTCCAATGGTTCGCTTCATGCTTCAAAATGAACTTGATTGCT ATTTTTTCGTTTCTTGTTCATATATACTTTTTTCACTGCATTGAAAAATA TCTGAAAAAAGCCCGACAACTTCCTTATACTCTTGAGCCTATCAAGAGCG TAATCCTGCAATAACTTGATCTAAAATACAGCCCTTTCTCAGTACACTGT AACCCAATAAGAATTCTTTTGCAAGGTGACGAAGTTTTAGCTGATTTTTT AGTATCTCCCAACTATGCTATGGTATTTATTTTCTTTCTAAAAGATTAAT TTTAAAGGAGCTATTAAGAACCGCGTACAGCACCTGACCCCGAGAATGTA GTAAACCCCGAGAATGTAGGTTTCTCATTTTTTAGTATTGTAGCCCTAAC GATAGTTCAACTTCATAAAAATTTGTTTCAGAGCATACTGTTACATCTTA CTGATTATTTCTGGACAGAAAATTTTAACTTGAATTANNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGAAAATCTGAATG GAAGTTGATTGGATATTACCCGAACTGAGACATTTTTTAAATAAATCCTC TCTAAATCGAAATCTATTGGAATTAAGTTATGATGATTGGGTATTTTCTT AGTCCTAATGCACTAAGGAAATGGGGAAAATAGTTCATTTCAATATTTAC TGTTCTAAGTTAGATATTTTGACGAAAATGTTTGACCTAACTTTTGGGGT TAGTTGACCTACAATTTGGGGGCCTTTATAACCCGACATAAAAAGTCTGT CAAATTATATAAAACTTGTTTGTTGTACTTTAATAACATGAAAGTAATAC CTGAGAGATGATTAATATTGAAATGTTGAGCTTTTACGACGTGTCCCAGA CCCGTTGGGGCCCCAGCCCAATCAGAAAATTTGCCTAAGTTTGGAGCAAT AGAATTTCTATTCCAATTTGGACTTAAGTAGAAATTTTTGGACCCGAAGT GGGAAAAAAGTTCCACCGGGGCTGTGAGGCAGGGGTGTTGTTACATTATT CACATATTTCAACACAAAATTTTCAACCTACAAAATAAAAAGAACTTTCT TGTCTCCTCTTTTCGTCCTTCCTTTTACTTTTCCTCATTTGTAGTAAAAT GAAATTAATATATTTGTTAATTTTTTGTCAGCGTATATTTCTAAAGTATG AATTTCACTTAGAGAACAATAATTTCCGATGAATACCGAAATTCCATTCC CAACAACCGAATCTTTTCACCTACATTCTGGGGGTTAAAAAGTGAAAAAA TCCAATTTTCAGAATAACAAAATGCTCTTTAGAATATTATTTTTGCATAA AACATTTCTAAAATTTGCTGTTAGAATTAATACAATTGAAAAAATATCAA CATTATACTATTACTAGATTTAAAGCCATAAAACCAAACCTACATTCTGG GGGCTATAACGAAAATGGGAGTCAACTTCAAGGACCAAAAAAATTGGTCT ATCTATCAAAAGTAATGAAACTAACCCCTGGGAAAGTATTTTGGGAGTTC AAAATTTCGTTAAAAATATTTAATATCTTTTAAAATGCAAATCTACATCT TTCAGGTCTGATTCAAATTTCACCTACATTCTCGGGGTCAGGTGCTGTAC GATTTTTATTTTCATATTTTCGGAAAGCTTTTTTATAGTTATCAAATCAC ATCACCATTCCAAAGAACCATATCCACAAATTATGAAGATGGGTTTTTTT ATAATAACATCCGAAATTTTTGAAGCCTTTGGATGTCCTTAACTTTTCGA GTTTTAAGCCTAAAATGTTCTTAAAATGTTCTTATTTTTACCATTGTTTT AGTATTTTTTCCCAAGAAATTGGGCATTTTAGAGCCCATGAAGCCTTGAA AGGTTCTTTGATATTTAGGCCATCGAAGCCTTATGTTCTTAAAAAGTTTG TTCTTACAAAAAAAACTTGTATTTGAAAAACACTACTTATCTCAATTATG ACTACACCCTTCAAAAGTTTTGCATTAGCATCTCAGTGAGGTGCTTACAG TGGCGAGACGTGAGTCTATTTTTGGTATGCATTTAATCTTTGATAGCGAC TTGAGAAAAAACGTTCAAGTTGTTACTTCTAATTGCACTTGAAATGAAGC AAAACCACTATGTTGGCAGCAGAACATTTTTCTAAATCTCATTCTCATTC TCCATGAATGCCGGTCCCTTTATAAGAAAAACTCCACCATTTCTTTTGCG CTACTAGCACTGTTTCTTACTTTACTTTTAGTTTATAGTCTTAAGAAAAC TGGCATAGGCCAGGGAAAAGAAATAATTATATTTCTAAAAAAGATATATT TTCCTTGTCCTCTAAGAGTTACCTAAATTTGAAAATGACTTTTGGTATCT CTGTTCATATCTTCTGATTATCTAGCCCAGCTCGAAAACTTTAAGCTTAA CTTGATTGTTCATTCCTTTATCAATTCATTCACTCATTCATTCATTCATT CATTCGCCTCCCATTCTTGCTTAATCATCATGAAACATGCGTAGTAAGGA AAGTAAATGTTGTTACAGTTTCTTGTTTCAGACAGCTGATTTAATTTGAT TTTGAACCACTTAAATGTCAACAGTTTGCGAACGGTAGTAAAATTCCTTT GTTTACTTCTTGGAAAACAAATTCTTTGAAAACGATACCACTCTGAGTAT TCCAAGCTAAAAGTCAAATAAATGATGCCAACTAAAGTCAATAAAAACAG TTTTTTTAGTTCTTATAGAAAAATATTAACCGTCAATCTTATTGTTACCA AAGTGATTCGACCACCAAATGGGGTCATTTAACATTTTCAAACAAGTCAT TTTCTTTTAAAAAGAGATCGTTAATGGCCATTGACAGTGTTATTCAAACC GATACCCCCTTAAAATGTTTCAAACGGAATTTATCGTATATACAGATTCT GTTTTTAGTTGAGAATTCTATAAGAACAGCAGACTGAAATTGATTTAAAT TTAAAAACAAATTATGGAAATGCTGATTTCGAGCACAATTTGGATGAAGA AAATTAAAACTCTACTGCGAATAGCGGACCAGGCTTGACCAGAAATGTAT AGTTCTTAAAAGCAGTTCAAGATATTGAATGGCCATTTTGAGTCTAATTG TTGTCCTATATTCTTGAGTTAAACCAAACCACAGACCCCTCCTTCTTTCC CATTAAACAAGCCGAAATGGGGTTGCTGTAATATTTTGGATGTCAAAAAT TCTCAATTTTTTGTGGTGTCATCGTACTTGTAATTTACGTAAGAAAAGTC AATCATGTACCAGTTTATCACTTCCTTACCTTTGTATGCCATTACCTTGA TTTCGACCCTTAAATGCTTTTCTTCCAAATCAGTCAATCTGAAAAAGCTA TGCGGTAATCCCTTTCTACACTTTTTTATATTGTTCCTCTAAAAAGGTCG AAATGTTTTTGCTTTTGTTAATTCAACTCCTTCAAAATCTTTAAAAACAA TATGGAAATTTTCACTGAATAAGGACTTTCTTTTACCACCTATGACTTCT GAAATTTATGTTAGGTAGAGACATGTGTCTTTGCCAAACACGCCGGGTGT TACCTTAAAGCAATTCGACGCCTTAGTAAGTACTAGTAACTGAAAGGAGA GGTATACAGAGTTACTTTAAGATGGAAACAAAGGGGATAGACGCACTGCA TTGCACAAATTCAAAAAAATGTCAGCAGTAAATCAGCCAAAGTTATGTAT GAAAATAAATATTGTGGTTTCGAGTTTGCTTTGTTTAGATTATTCCTATG TTTTGGGTATTAGATTTCATTGAAATCAGATCACTTTTTTACCCTCAAAA TGATGGCTCATCATAAAGGATCTATTGGCATCAAGTATCAAAACTTTTCT TTCAATCTGTACTCTTATTTCACAATGTAAAACATTCCTAAAAGAGAGAT GGACTTTAGTCGAAATAAAACTGAAAATTCAAACTATTAGTGTAAGAATA TCCCCCAAAATTGGTTCCATTTTTTCACCTATCAATCGATACGAATAAAT CCTGACAGAGCTAGCAAAATGAAAACCTTTTCTCTTGCAATTCTAAATAT CCCTTGCCCCTAACTTTTCAATCAAACCAATGATTACAAATAAGTAATGA TTGTTCTTCAAATTAATCATCCTTTAGGTCATTAGTAGACAAGACTATGC CTTTTCTTTTGAGTACTTTGTACCTGGCATTGTATGTTCTAGTTCTTCCA CCATTTTTTCATCCAATAAGGTGCGTAAGTACAGCATACTTCGTTCCCTA ATAGTACGGCATTTGTTCAAGAGATGTCTTTTTGTTATCTAATAAGAAGT GTTGGTACATTATAGACTGAAGTTGTTTTTTTCCTGTTTTAGATACGGTT GCCACTATGGCTTGTTACAGTGACGTCATCGTCATGAGACATCCTACCAA AGGCATGGTTCAGGTAAGGATATCTTTATCATGGTAACGAAAACGTTTAC TTTTTAGCTGACAAGTTTTTCGATCCTAAAATTTGAATAAAGTACTGTTG AATACAGTCTCCTGGCAAAGCTCCAATACAAAGATTTGAACTTGCTAGAG GCTTCAACAGTTTTTAATCCAAACAAAATCAATAGCGTGCCATTCTTCAC GTTATTTCAACATCCTTGATAATTTCGCGATCACGAGAACCTTATTTGAA ACGGTTTTCTGATGTTCTCAGATTGGGCAGATTCTTCAACTTCATATTTC TATAATTCTCATCTGTATCAGATAAAACATAGGAGTTGTTGTAGTAACAG TCGTATGATTTAGAGTACGTGCGTGAGTTTTGAAAATTCCATTCAAAATG TACTTGAGACTACTCGAGATGACTTTAATCGAGTGCCTTTTTGCGTAGGT TTTTTGAACCTTTCTTTATTGTGATTTGGAAAAGAGAAAAAGTTAACTGC ATTTTTGTACCTCTGTAACGAACGTTCGGGCGTCATCACTTGGGAAGCGG TCCTTCTTTGAACGAAAAACCTCCAAACCTTAATACTTCCGAGATACTCT GGAAGCCAACTCTCTGAAAAAGAACACTTTTTAAACGATTTCTTTATGCC GCCATTTAAACCAAAAATGGTCTAGTGTGACAAGTACTCTTTTCCTGAAA ATTCTTTTCCACGTTGGACCTGATTGTTTTTAAAGTGAGTTTTCCCTGAT TCAAAACGTCAAAATGCTTCTTTGTACCTAATTAAATGTTTACGGGTGAC CTTATTGCTTGTGAATGAAAATTATGATTATGAAAACATAGTGTCCTTCC CTCCTTTTTTTGAAAATCAAGGGGGCAAAGATTAGATGCAAATGGGAAAA TCTCTAGTTGAGGGAAAAGATTTTCAGGCTTCAAAGCAGTAAAATATAGC ATGTTTTATGCATTTTTTAGCAAAACAATGTAAAAACATGCTTTTTTCAG AGAAATGTCTCAATTTAAATTTTTAAAATGTCAATTTTTAGGCAAAAACG CATGAAATTGGGGACTTTGCTGGACTTTGAGGCTTCGAAAATCTAGGAGG GGTGTAAAATGGGGAGTAACCAGAATTTTTCAAATCTCAAAGGGGGGGGC AACAAACCCACTAGGACACTATAGAAAAGAATTAGCGTTCCACCAGTGGC AAACTAAGAAAATATTAACCATTTGATACATCTTTTAAGTTACTTTTAGT TAGAAAAACATCGATTACACGGTGTGCGTAACGTTAATAAACTGTACTTC GCCGTCTTTTTCCTACGAGAGAAGAATTGGAAATGCACTCAGATTTTTTC TGTTATCACCTACAGCAAGCAGCGGAGAAGTCGCGACGCCCGATCATCAA TGCGGGAGACGGGGTTGGAGAACACCCCACACAAGCTTTGTTAGATGTTT TCACTATCAGAGAAGAAATTGGTACCGTCAACGGAATTACCGTAAGTTTT TTCGCCGGAACACGTTTTTTTCGCTACATTACTGATCGCTGTACCAAAGT TTACCTGTAGCGTAGCGTAAATGAATTATGAAACTTCCTTAGATAACGGG TCTGTTAACAGGAAGAATATCTTGCGACATTAAATGTCAAGAAGCCTATG CAATAGGTTGGCTCTGGTTAACTCTTCGACTCTTCTAAGTCGCAGTCGCT GAAATTGTTGGAATATCTCTTATCATTTTCCAAGTTCTAAGTTTAAAAAG TTAAGTGGTTCGTAACTAAATTGATGTCGTTACGCTTTCCTGCAATGAAA GCATTTCAGCCGGGTCTAAGCTTTATCAAAAAAATATTTTTTTGAATGAA TAAAAAAATGTTTTCTAGAGACACACGGCGTAACACACGGATAAAAATAA GACCCAGAAAGTTAGCATGTCATTTATCAATCAAGAAAGCAAATTGTTCG TAATCGCTTCTCTCCTCCCCTAAACCACCCTACCTTTAAATCCCCAATGG ATTATCAGAAGTGAAGCATGAGATCTTTTGGATTATCACCCGAGAATATT TATATAACTTGGGTCAACGATTTTCTTTTCACAGCGCATTGATATTTTAC CTCGAAGATGGTCCCTTTCTTCATCATACCATACCTTACGGTTATACAGT CCACTGAAGCCGTTTTTGATTAGCTAAGTTAGTCAAGCTAATCAAAAGTT TGTACCTTTTTCTTTCTAATTAAAAAGCTACGCATAGTGTTCAAGCATTC AAGCATAGAATTTGTATCTTCCCTCTCTAAATGTTCTTCCACTTTAGGTG ACAATGGTTGGTGATCTGAAGAATGGCCGTACCGTGCATTCATTGGCTCG CTTATTGACATTGTACCGAGTGAACTTACAATACGTTTCACCTGACTCTC TTCCAATGCCTGACAACGTTCAAAACTATGTTCACAAGCGTGGCATCCCA CAGGTATGTGATTGACTCTCCAACGTTTTCTCGACGCCCATCTAATGTTC AAAACATGTTCTTTTTGGGGTTGGTGGGTGGGGTTTGGAATAAGCGGGGT GGATGGAAAAATTCTCAAAACTTAATAAGCGGGGGGTTGGAATAGAAATG TCCTGGATTGAATTTTTTGAAAAGGAGGCTAATACAGCAGAATAAGGGCA AGAGAGGAAACTTTCAAAAACATTTTCCCAAGAATCAATAAGCGGGGGGG GGGNAGGGGGCAAAGATTAGATGCAAATGGGAAAATCTCTAGTTGAGGGA AAAGATTTTCAGGCTTCAAAGCAGTAAAATATAGCATGTTTTATGCATTT TTTAGCAAAACAATGTAAAAACATGCTTTTTTCAGAGAAATGTCTCAATT TTAATTTTTAAAATGTCAATTTTTAGGCAAAAACGCATGAAATTGGGGAC TTTGCTGGACTTTGAGGCTTCGAAAATCTAGGAGGGGTGTAAAATGGGGA GTAACCAGAATTTTTCAAATCTCAAAGGGGGGGGCAACAAACCCACTAGG ACACTATAGAAAAGAATTAGCGTTCCACCAGTGGCAAACTAAGAAAATAT TAACCATTTGATACATCTTTTAAGTTACTTTTAGTTAGAAAAACATCGAT TACACGGTGTGCGTAACGTTAATAAACTGTACTTCGCCGTCTTTTTCCTA CGAGAGAAGAATTGGAAATGCACTCAGATTTTTTCTGTTATCACCTACAG CAAGCAGCGGAGAAGTCGCGACGCCCGATCATCAATGCGGGAGACGGGGT TGGAGAACACCCCACACAAGCTTTGTTAGATGTTTTCACTATCAGAGAAG AAATTGGTACCGTCAACGGAATTACCGTAAGTTTTTTCGCCGGAACACGT TTTTTTCGCTACATTACTGATCGCTGTACCAAAGTTTACCTGTAGCGTAG CGTAAATGAATTATGAAACTTCCTTAGATAACGGGTCTGTTAACAGGAAG AATATCTTGCGACATTAAATGTCAAGAAGCCTATGCAATAGGTTGGCTCT GGTTAACTCTTCGACTCTTCTAAGTCGCAGTCGCTGAAATTGTTGGAATA TCTCTTATCATTTTCCAAGTTCTAAGTTTAAAAAGTTAAGTGGTTCGTAA CTAAATTGATGTCGTTACGCTTTCCTGCAATGAAAGCATTTCAGCCGGGT CTAAGCTTTATCAAAAAAATATTTTTTTGAATGAATGAAAAAATGTTTTC TAGAGACACACGGCGTAACACACGGATAAAAATAAGACCCAGAAAGTTAG CATGTCATTTATCAATCAAGAAAGCAAATTGTTCGTAATCGCTTCTCTCC TCCCCTAAACCACCCTACCTTTAAATCCCCAATGGATTATCAGAAGTGAA GCATGAGATCTTTTGGATTATCACCCGAGAATATTTATATAACTTGGGTC AACGATTTTCTTTTCACAGCGCATTGATATTTTACCTCGAAGATGGTCCC TTTCTTCATCATACCATACCTTACGGTTATACAGTCCACTGAAGCCGTTT TTGATTAGCTAAGTTAGTCAAGCTAATCAAAAGTTTGTACCTTTTTCTTT CTAATTAAAAAGCTACGCATAGTGTTCAAGCATTCAAGCATAGAATTTGT ATCTTCCCTCTCTAAATGTTCTTCCACTTTAGGTGACAATGGTTGGTGAT CTGAAGAATGGCCGTACCGTGCATTCATTGGCTCGATTATTGACACTGTA CCGAGTGAACTTACAATATGTCTCACCTGACTCTCTTCCAATGCCTGAAA ACGTTCAAAACTATGTTCACAAGTGTGGCATCCCACAGGTATGTGATTAA CTCTCTAATGTTTTCTCGACGCCCATCTAATGTTCAAAACATGAACGTTG TCAAATTTTCTCTTTGGGGTTTGGGGGGGGGGGTNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNGGGGGGGGGGGTCGTCGTCGTCGTTAGATCTTACAGG GTTCGATAAACTGTGAATTAGCTGGCTCGAATGATGAAGGTTTTAAACAT CCTCGGCCCTTTTTCGTTTCGAATTATAGAAAAATTCAACTTTATTTTCC CTGATGGGGGGGGGGTGTTGCTGACACTAAGTGATGATGAAGTTAAGAGT TAAACGGTGTGTGTCTTTTCGCTATACCGAACCGATTCATCCCAGGATAT GTGTGACGGTTATTTGAGTCGCAATTGAGCTTTTCAAGGTACGAAAGGAC AATGATTTCCAACACTGAGATATTGGACTTTTTTTACTTCTGTATCAAAA AGTGACATTTTCATATTGTTTGATGGATGGGTATGTTGAGAGTTATTCAA CGTACAGAAGAGCATTATTGGATTTGACTTTGAAACCCCATTGCACTGAT CCACTTATCCACTCATAGCATTCAATCTGCACAATTTATTAACATAGAAC TGTCACATAAATTTATACTTTTCTTTTTGTCGGGGGTCTGCATACCTTCT CAAGAGAGCGAGATGAATGAAAGATTGATTGTCTATCGTGGTATATTGAA TTATAAATTTCTAATTTGTACTTAAATAGAGGTTTAGACGGTCATTTTGT TTTTGACCACTCACATTCTTTCGTTTCGGAATCCTTTCGCGTGTAGACCA TCTCACAAGGCTTATCTAAATCTTTGATGGATGGAGGAGCTCTTTCTTGC CAACATCTCACTAGAAAATGAAATATAGATTACTCTCTAAACAGTGTATA AGGATATTTGTATTCGTTTACCCGTTTGAAGCTAATAACCACTTTTTGAG GTAATCTGCTTAAAGGTTTTCTCTCGTTCTTTTTCCTTTCAATGAAAATA TTCTAGTAAAATCATAGTATCGCTATAGAGGGTGGACCTACTTATGTGCA ATTTAAAAAGACTCATATAAGAAACAATGATTAGTTTAGCGACAGTATTT GCTACAATAATGCGATACTTTACAAACCGTTTTTTAATTTGTTTAACAGT TTCAAAATCGGAATCTCAGCAGTAAGTCTCATATCAAAGTCCTTTTTTCT ACTAGTTGAAAAACTTCACTTTTTATTTAAATTAAAGCTTCTATCCTGCC ATTGACTATTGGACTAGTAAAAATAGATCTCAGGGTGAATCAGATTAAAT CTTGCTGTAAATTTGTCTCCTTGAACCCCTCTTTCATTTCAATTTTAAAA CCGCCACAGGTGAGGTAAATTTCAGACGCGCCTCTCCTCTTTTGCTCTTT TTCAGGCGCCCACCATGAGTCTTTGCCAAACTTTATAATCTCATTTTGAA GTTTTATTAGACACTTTGAAAATTTCATTTCTGCGTTTATAATTCTTTCA CTAACTGGGATGGTCACCAATTTTTCTCCTTCATTCTTAGTCTCAATTCC CAGTGTATCTTTATTGGGCCACCATTACCAAAAAGCTTCAGCGGAATTTC CCGGAACTGAACCTCTTCACTTATTTTATAAGAACCGGTAAATCTTGGCT CAGCCTTGACTGCTCTTAATTTGATATTACCAGGAATTTTGTGATGTTCT TGATATGCTTCGTTTATATACTTTGCGAATTAAAACACCCTTCAAAACAA ACATTGAACATTAGCATCGACATTATGATAGTAGTTTTTTTGTTTGAGGC TGAAGTTATTCTGAATTTGTTCAGGTTGACTTAATTTCAGCATTTCAGCA TCGTAAAATGTGTACAACTAATTTGACTTTTTCTTTCCTATATCAAGGAA TGTTGATTGATATTCAATTGCATTAGATAACGAAAATAGAATTTTATCAG TGCATAATCAGCCAGCTGAGTATGTCTGCACTTCACATTATTGCTTGAAT TAATCACGATGCCCTTAAATCGTGTCAAGTTCCAAAACGAATACCTTTTT TACTTTCCTACCCAAGATTGGTAAAAAAACCTACCTACTTAATAGGATAA AACAAAGAACTTACTCTGGTCAAACTCTATGTACTGTATCTTTATAAATT TTTTGGGGAAATGTTTAGAACACCCCTGCCTCAAAGCCCCGGTGGAACTT TTTTCCACAGTGGGGATAAAAATTGGAGATAGAAGTTCTCTTGTTCCATG GTTAAAAGATCCAGTGGCATGGTTTTGGATTTCAATATGTAAACATTGAA TTTTGAGTGGGGCTGAAATTCTAGGGTATTTTCCCACCGGGGACGAAATT TTTGACACATTTACCAGTGGGGCTGGGGTCCTGGCGGGTCTGTGACACAG GGGTGTTTTTGAAGAGTCTAGAGATTTCAACATCTAACGTTGACTATGGA TTTTATTTTATTTTATGGGTTTTATTTTCTCGACTATTCAGTCATGTCAG GAACGACATTTGATACGTTGTTAACTGTCATTTATCTTTTATAAGGCCCT CTAGGTGTTTTAAAAAGGGTACTTTTACGAAATTCACAGTCCTCCCGGAA GTAATGTTCCTTAACCAATTTTGTCTTCAAAACATGGTTGTCACGATTCA CTCCTAAGGTTTTCCTATCCAAAAGGGATACATTTGTTACTAGGGTGGTC TTGATTCTTTTCTTCTGTCTCTAAGTCATTTGTGTAAATACAAATTTGGT GTCGTCACGAGATCATTCAATGACTCTGAATCAATGAAAGTTTGTTTTGA TATAGTCTACTATTTCTTAAAGATCAAAATATAAAGTGTCAATTCACTAC AAAACTGATTCATTTTTATAGACGAGTGAGGAACCCATGGGGGGTAAGTA AAAGGGGTTACGTAGATGCGTCGCTCGTCACTAGAGAAGAGGAGTCTGTT CCTCGTAGCATTCCTTAATGGGAAATTTTCAGGAAAAGTTAGAGCTTTTT GAGCAAAATTTCCGTCTCATCTAGGGTACATAGTTCTTCTCACAAAAGAT TAAACAACTCCAATGGAAGGACCATTTCTGAACCTTACCAACATTACCCC TCGTCTTCGGTTAGCTGGTTAGAAATCATTCCCATGAAGTTGTTTCTTTA GTCCTAGTCCTCACATTATCCAACCCCCGAGTTCCCTAGCAAAATCAGAT GGCACAGTGAAGAAAAATGTCTTGAAATTAGATCACCCATTCAAGTTACT TGATTCGGCAATCATCAAAAGTCTTGTGTCAATATTTTCATTTTTCGAGC CTTGTAATCACAAAGAATAACAAGACATTACTACTGTTGGTTGGCCTCCT CATATCGCCCATACATTGATTTCTAACAATCTTTGACAGATGTCTATTTA TGCCTATTATCCGGGTGGAGACAAAACGCTGAACGGCGGAATGCCGGAAT GCCGGAACCGGAATAGCTGTTCCGGCCGGAATAGCTATTCCGCGGAATAT GATTTTTTTATTTTTTTTTTATTTTTTGTANNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNTAAAAAAAAATCATTATTCCGCGGAATAGCTATTCCGGCCG GAACAGCTATTCCGGTTCCGGCATTCCGTCGTTCCGCCGTTCAGCGTTTT GTCTATACCCCTATTATCCCTTGGTACAAAACCAATCGATCACTCGTCGA TCTTCGAATCATGACATATTACCCCTTAACAATGGACTCTGTTTTCTGTA AGACCAAGTCAGCTTTCGTCAATGTTCTTATTTTAAGGGCAACTTTAGGT CACTACCTTCAGGACGATGAATGTGTATAAAACTTTTTAATGGTCATTTG CTAAATATATGAAGGGTTAAATTGACAGCTTCAAGTTGGAAGGGGCCATC ACTGTTTGTCATCAGAATCCATATTAAGAAACAATTTGTTTTAAGCCTAA AGACTTAAAAATGGCCCTCAAGGAGAAAGGTGTTTACTTGCAAGGGTCAA TGTTTACATAGATGTCCATTGGGTCACTTTTGGCTATTGGCCAATTGAAA AAGTCTATCCTATTGAGCTTTTTGAAAGGATCATGTTTCGCTTATGGTAT AACGTTTCAACTTTTTGTTTGTTTACAATCGGATACCAAAAGATTTGGCA TCGTGTCAATCCTTAGAAAATATTATTCCACAATGTGAAAAAATAGAAAC ATATTATAGACTTTAAAGTCGATAAGTTTTTATGGCCTCGTCCAATAGAA GGTTTAATATAATGCAGCTTAAGATCGAGCTTGTCCTTAGCTTGTCCTTG ATTCTATTCGGTATCTTATTGCTAGAAACTTCATTATTTTTCTAGTCTTT ACATGAAATTAGCTCGTTCGACTTTCAATCATTTTTGACTGCAGCAAAAA TTTTCCATATTTTAGTATTTTGTGTCAGTTTTCTTAAATTTGACATTCGA AAAGATTTATGCGTTATCGGCTATCAATATAGGCTTATGCATATCCAAGG GCTTAGCCTCTAAATAAAGACTTTAAATGTATGGAATTCCATATCGTGCG AGTGTGACCTTCATCGTATATTTCAGTACATCTCAGTCTTCCCATAGACT TTATTTATCAGACCAAGTTCAAAGTCTAAAATTCCTTTACTATTGCACAT GTATTCAGGGCAAAACCGGAGAGGTCTTGTGGCGACACCGTTACAAAGAA ACAGTGTTCCCGATTCGAATCCTCGATCCTATGATGGGTATTGTTTAAGA ATTTTACAGTGATCGACATTCTCAATAGAATTTAGTTCATCTTCTTGCAT TTGCCCCCCACCGATGATTTCCACGTTTTTTTATAAGAACATTCAAAATT CTTGAACCTTCGGATCGTACTAACTTTTTGAATTTCAAGCCTAAAAATAT TCTTAAAATGTTCTTATTTTTGTGAGTATTTTTGTGCAGTTTCCTAAGAA GTTATCGTATCATGGCTTGTTCTCAATATGGCCATCAAAGCCCTGTGTTC ATATATATTTTGTTCTTACAAAAAACGTGTATTGTTTGTGATTCTAACCA AGGACAATGATTGCACTTCAACCAATTCGTTCGGCTGTTTGTCAAAGAAA ACCTTCTTCCTTCTAAAGAGTTCTTAAGCTATCCCTATCCAATATCCTTT CAATGACAATGTTCAACAAACATTATGTCATACTTGAGGAAGGAACCCTA AACCTTTTGTATATTGATATTTTTTGTTGCGCAATTCTATTCCAGATTTT CTCTGGTTTGTTGACCTAGGGGATTTGATAATTTTGGCGCTCGATTTCGT TAATTAGATTTAACTCACTATAAAAAGATGTTCACTTTTATAGTATACTC TCAATTATTCGAACTTACTTCCAGTCCCCGTCAAGGAGGAAACCTCTTAA AATACTTTCTATAATAAGAATCTCTCTGATTCGAATAAATAAGATTTCCC GCTTGAGTTCGAATTGGCGACTGTCAACTGTATATGAATTTTTTTGTATC AAGTTAGGTGCACCTTTAAATGTTTTGGGGTTTCATACTGCCTTTCAGGT ACGGAAAATTAAATGTCTTCGCGTTGGGAAGCAGCTTTTGGGTTGCGGTT TGATAATACCCATAATAGAAACTGCGAAATGTGTTTTCGTTATTTCATTT CTTTGTCATATCCTTACATAATGATTTATCTAAAATAAGGTTATTAAGAG CCGGTTTAAAAAGGTCCGGTAGTTGAAAGGGTATCAAACTTGTACATGAA AGCTAACAATTTGACTCAAAAGTATCGATGAGAACGACTTGTGTACTGTT AAGTTAAGGTATTTCTTCATCTGTTGCTACAGTAGACGTTTGCACAGTTT TCAAATTAAAAGACTGCATACCTCAAACAGTCATACAGGGTGTAGATAGA CGGTTGCCGGGGAGAAGTGCAAAGTGATGCAATTTCGTCCCATTTTATTA GTTGTAATCCTGTTATCAACTTAATTCGTTGATAAAAGTTTTGATGAGAA ATACCTTTGATTTATAGTTAGCACTCATTCTATTTATCCTGTCTAATGAT AGTTTGCCATCTTTAAAGTATACCGCGATAGTGGTTTAGTATATGCCATC ATCTCCTTTGTCCATAACCTAAGATTGTACAAAGAATATCTTGGAAGCGT GGAACCATCCATTGTGTAGTTTAGAATGATTTGCATTTGAAATCTCAGAT TATAGGTATTCCTCCCCTAAGCGTTGTCTATTAATTAGAACATGTACCTA CTTACAATGGAGTTTCTTCAACTCGAGCCTCTATAACTCGAATGTCTCCT TAACTCGAACGAGTTTTATGGTCCTTTCAGTTAACAATGCCTTAAAAACC TTATGTACTCCATAACTCGAAATTTGTGTTTCACTTTGCGTGTTCGAGTT ATAGAGACTCAACTGTAGTATCTAGACAGCATGACCAAAATATGACAAAG ACGGTGTCACACAATTAGTGCAACTGTATTATTCAAGGTTATTAAAAAAT TACAATCATTTTGCATGTAAAATATCCGGTGATTTCCAACGCAATTCACA CTCATTTCTGCTCTTATTACGATGATTCTGCGTGACGGATGTAAGGGTTG TCATTTTTTAGACATGGCAGTTTTCCAGTGAGAATGAAGTGGTCGCTTCC AAAGCCCGGAAGATTTTAATATCCGCTTGTGTTTTCAATCACAAATTAAA TCAAATAGTGTCTATTTCATAAAGAGAAAGGCGGCTTCTATTTTGTAGGT TACTTGTCCCTTTGTCTCCCGTTTTTCTTATTTTGGCGTATTTTTGTTTA GATTGTAAATCGTTTTGGAAGTTTTTTTCTCTCGCCACTTCAGTCGACAC TCGATAACTTGATTTAACTCTCAACTTGTCCTGCTCGTCACCATTTAATT AGATCTAGAAGCGATTACCTTTTTCTGTTAGTTAGATAACTCATTAATTC GTTCAATCTCCTTGTCAAAGTAGAAAAAATCGCGCGACGTCATCTTTGTG TGACGTCATGTTTTTGTTTTTCGCACCTTTTGAGAGAGCTTTGATGACAC CATTTTGTTTTTGAACAACTTCAAAAGAAGTTATCAACCAACCAATCAAT CAATCAATCAATCAATTTCATCCTAATATTTTTTCTTCTCGGTCTTTCTC TCTTCACAATTTTCAAATAATTATTTTTTTGGAATTCTCTTTTTCTCCAG AGACAATTCAAGACAATTGAAGAGGCGTTACCGACAACTGATGTGCTATA CATGACACGAATTCAAAGAGAAAGATTTGCAGACCAACAAGAATACGAGA AGGTAATTATCCCTCTCATCACGACACCTGGCCTCATCATTTAAAAATAT TACCGTCCTTTTCTCGCGAATTTTCCGTCTCCTCAGAATATTCAAGGGGA ACTGCGTCAATTCACATTCACACCTTAATGTTTATCATCCATTCCGCGCA CAACAACATGTTTCATAATGCTCTAAAGGGATGTGGCGAATATGATGATC TACCCTGGCTAGCTATTCAGTCGAAACATTCAAGACCGCGTTTTTTCTTA GAAGCAAAAGCGACTGGGTTCTAATGTTTTTTTTAACGTTTTATTGGTGC GACGATTTCCAATCATATTTAAATTTCATCTGAAATCTGGATGAGAAGTA ACGAAGCAGCTTGCCAACATTGGCAGATTCTTTGATGACGACCATTTCCC ATTCCTACCCATCGTTAACTTTACTACTTTGTCTGTTACTCGTTTTTTTT ATAAGAATAGACAATATATGTGCGTAAGAATCGGTGTCTAAAAGTGCACT AAGAAAGTTTAAGGCTTCGCAGTCTCTTAAACGCCCAATTTCTTAGAGAT TCCCACATTATGCTGAAAATAGAACATTTTTTCCAAATCTAAAAAGTTTA GAATGCATGGATCTGAATGAGATTTGAGATCCTGTTATAAGAATAACTTA CTGATATAAATGAGAATCAGGGAAACCTTGGGAGTTTGTAGTTTCTATGC CAAGCATGTGTAAAAAGGTTTCAATGCATAAGTTCTTCAGAACAAAATTT GCTGAATAACTAAACCATACGGCATAAATGAATCGGCAGCCGGTTCTCGG TATTTTTCTTCTTTTTTCGGGTATTCTCAAACGCGTGGGGTGTGTAATTA CATGTTGCAATTTTATCTCTAGTGTGAAAAAATGAGGAAAACAAAAGCGA GAAAGTATTTTCTTTTCTATTGACATTGACTCATTGTTCTATATATTGTT CTCCTGATATTGTTTAACTAGCTGTCCTTACTAACGCCCCACCACGCCAT CTATTCCATATTGACACAGTTGTCTTTTTTTCCTTTTTGCGACTGGTAGC GAAAATTCAAAACTTTCGGCTCCTTGAGAAAGCGCATAATGCTCATTCAT CTCCATGTGCTTTCATTTTCGAAATTTGAAATTGAATCGGTCGGTTTAAT CAGGTCATTAAATTAAAATTTTACCTATTATTAATATTGGCTGGTCCCTC TGATACTTGGTAGTCGCCACCTGATATTAGAGAAGTCGCTCCTTCGATGT ATTCATCGCAACTTTGGCGATAGATATATTTTTTAACTTTGGATTTTTGC CCCCTTTCCGGGCAGGTTCTTGTAACTAACACAGCCCCCTGGGAAATATT ATTGAAACATTTTCATTAGCATTTTATCTGTTTAAGATTTCTTTTCTTTT CATCTAATCAACTCGAGAAATTGACATTTTAGTAACCAGATTAAACCCTT GCTGGGCCAATTGAATTTCACTGATCCCCTTTTTCATGCTACACCACCTA ATGTTTGCCAAAATTGCCAAAATTGTCGAAAGAAATACAGTAACAAGATC AATGAATCCATTTTGATTAAAAATGCACCTTCGAACACTTAAGGGTGGCT TGAAAGAAACTTTTTTAAATGAATATTAGTTCGAAATGGTAAAAAATTCA CATTGTAACTCAATATGAAATACGGAATTGGCTTCTACATAAACATGCAA TTTATTTACGACGATAGAGGGGGAGAAATTTCCAACCGTGAATCTTTCGT TATGCTGTCAAACAGCCATTTATCAAAACAAGAAAAATATGATCCTTTTA ACCGCGCACTCAACCATCTCGCAAATCATTCCATTTATTACAAATATCAA CAGTTTTTATCCCACATAAAATTTAAACCTTTTGTTTACCACCTTGTTGC AAAAGTGAGGCGTGATTTTTCGCGAATTTTTACGAAATTTAAGCAACGGG AAGACTATAAAATTCAAATTTTGGCTAAAACTCCAAAGACAATATAAGAA ATTAAGCGGGAAAAAGCCCATTCGCGAAATTTAATCTATCAACGCGATAT TATTTGAAAAAGTGCCCGCAAAAAAAATGTATTCTTTGAAGTAAATTGGA AATGAATCCTAAAAGAAATGTTTTCAATCAAATCATTCGAGTTGAGGCTC AAGGTCTCAAAATTCAGAACAACCGGGCTCCGCCAAAAAAATACAGACTT TTATAGAAAATGGCGTTCGCTTAACTGTTTTTTTTTTTCAATTTTTAGGT GCATGGTTATTTCGTGTTGACACCGAAAATGTTGACGAAAGCGAAGAACA AGATGATCGTTATGCACCCATTCCCAAGAGTCAACGAAATCAGGTATGAA ACATCCTTCAAACTTCCCTCTCAGACGAAGTATGTACTAAAAGAAACTTT CCCGACTCAAAGTTAAGCAAAATTTTGGAAAATTTTGGAGAATATGAGTT AATGTTTACGTTTTGTGTAAATTTCAAGAAGCTAGGGGTTCTTTTGTTCC GATTCTAAATAAGCAGGACTCTCTTTATCCGTGTAACATCATTTTCGATG CTCAGATCTTTAAAACACTTTGTAGTTTTGTGGTCGTTTGAGCCTGATGT ATTGTGTATGGCATTTAAGATAAATACTATACGACAGAACGTTTTCTCTT TTCAGTACTGAAGTGGATTGCGACCCAAGGGCTGCTTATTTCCGTCAAAT GGAATACGGGATGTTTGTTCGAATGGCTTTACTTTCCATGTTGACTGGTC GATTTTAATGGACAGAGAAAACCGAAAATTTACGTAATCTTTGTCATAAA AGAAAACGTCACAAAAAGCGAAAATATTGTAGCCATCTGAGCACTAATTT TATAGCTCGACAAAAGAATATATTATAATGGATTGTAGGGCAATTTTGTA GTCATTAATTTTTAAGTCGGACAATTTTCGGTCAAAGAATTTATCACTTT CCCAAAAGAGACATTGCAAATTCGTTTCTAATTATTTCGTTAATTGGTAT TGTCGACAGTAATTAGATGTTTGTGATATTATTTTTGCGGTTCATATTTG AGATTTTTTTATTTTTGTAGCTTTTTTTCCAGATCCCTTTTTTAGTTTTA TATATTTTTACTTTTGGGATAAATAGGCTTTTTTATTATCATATTATTGA AAAAAATAATCAAAAAATCTTGACATAAAAAAGGAATACAACATTTGATC ATTTGCTTATGTGAAAGATTGTTTATTGTAGACCACAATCCTCGCAAAAC CAATTTCCTGAAAACCGTCACTTTCACCTAAAGTGCGGACTACATTCTTG CGAACTTTTACGAAAGGTATTAGCACTCTTCTTGCCGGAAATTTAGGAAG TTCTTTCAACCGTCAAAATACACTCTAGATTGCGGTTTTTCCATAGTGAA TTTTCGTTTTGAATGAATAATTTCTTCTTTATCTTAAACTCTCACGATAT AAGTTAGTACTATGAAATTAAGGGGAATGAATGAAAGAGTACTATATTCA AATCAGCC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000986XLOC_000986Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001866-exon-sc0000012-1575043694:95699..95754TCONS_00001866-exon-sc0000012-1575043694:95699..95754Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:95253..95454TCONS_00001866-exon-sc0000012-1575043694:95253..95454Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:93420..93596TCONS_00001866-exon-sc0000012-1575043694:93420..93596Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:91247..91401TCONS_00001866-exon-sc0000012-1575043694:91247..91401Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:89880..90099TCONS_00001866-exon-sc0000012-1575043694:89880..90099Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:89631..89743TCONS_00001866-exon-sc0000012-1575043694:89631..89743Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:89187..89261TCONS_00001866-exon-sc0000012-1575043694:89187..89261Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:88625..88766TCONS_00001866-exon-sc0000012-1575043694:88625..88766Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:78642..78712TCONS_00001866-exon-sc0000012-1575043694:78642..78712Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:77164..77289TCONS_00001866-exon-sc0000012-1575043694:77164..77289Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:76202..76357TCONS_00001866-exon-sc0000012-1575043694:76202..76357Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:65803..65904TCONS_00001866-exon-sc0000012-1575043694:65803..65904Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:63462..63556TCONS_00001866-exon-sc0000012-1575043694:63462..63556Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1575043694:62297..63149TCONS_00001866-exon-sc0000012-1575043694:62297..63149Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:95699..95754TCONS_00001866-exon-sc0000012-1510915933:95699..95754Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:95253..95454TCONS_00001866-exon-sc0000012-1510915933:95253..95454Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:93420..93596TCONS_00001866-exon-sc0000012-1510915933:93420..93596Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:91247..91401TCONS_00001866-exon-sc0000012-1510915933:91247..91401Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:89880..90099TCONS_00001866-exon-sc0000012-1510915933:89880..90099Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:89631..89743TCONS_00001866-exon-sc0000012-1510915933:89631..89743Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:89187..89261TCONS_00001866-exon-sc0000012-1510915933:89187..89261Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:88625..88766TCONS_00001866-exon-sc0000012-1510915933:88625..88766Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:78642..78712TCONS_00001866-exon-sc0000012-1510915933:78642..78712Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:77164..77289TCONS_00001866-exon-sc0000012-1510915933:77164..77289Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:76202..76357TCONS_00001866-exon-sc0000012-1510915933:76202..76357Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:65803..65904TCONS_00001866-exon-sc0000012-1510915933:65803..65904Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:63462..63556TCONS_00001866-exon-sc0000012-1510915933:63462..63556Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1510915933:62297..63149TCONS_00001866-exon-sc0000012-1510915933:62297..63149Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:95699..95754TCONS_00001866-exon-sc0000012-1491911889:95699..95754Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:95253..95454TCONS_00001866-exon-sc0000012-1491911889:95253..95454Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:93420..93596TCONS_00001866-exon-sc0000012-1491911889:93420..93596Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:91247..91401TCONS_00001866-exon-sc0000012-1491911889:91247..91401Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:89880..90099TCONS_00001866-exon-sc0000012-1491911889:89880..90099Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:89631..89743TCONS_00001866-exon-sc0000012-1491911889:89631..89743Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:89187..89261TCONS_00001866-exon-sc0000012-1491911889:89187..89261Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:88625..88766TCONS_00001866-exon-sc0000012-1491911889:88625..88766Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:78642..78712TCONS_00001866-exon-sc0000012-1491911889:78642..78712Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:77164..77289TCONS_00001866-exon-sc0000012-1491911889:77164..77289Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:76202..76357TCONS_00001866-exon-sc0000012-1491911889:76202..76357Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:65803..65904TCONS_00001866-exon-sc0000012-1491911889:65803..65904Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:63462..63556TCONS_00001866-exon-sc0000012-1491911889:63462..63556Clytia hemisphaericaexon
TCONS_00001866-exon-sc0000012-1491911889:62297..63149TCONS_00001866-exon-sc0000012-1491911889:62297..63149Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:62297..95754 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
32.4583 34.9356 8.99564 7.75397 61.9163 42.5984 13.3088 15.2835 8.1165 10.7186 17.8409 11.1877 9.9608 11.3718 12.8631 17.7444 10.0292 8.56005 5.27191 4.67025 11.7266 8.1834 40.125 28.1927 8.66067 10.182 7.33687 6.41864 30.6383 33.142
Blast
BLAST of TCONS_00001866 vs. Swiss-Prot (Human)
Match: PYR1 (CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3)

HSP 1 Score: 693.73 bits (1789), Expect = 0.000e+0
Identity = 352/636 (55.35%), Postives = 442/636 (69.50%), Query Frame = 3
Query:    3 SELYNRPVHIAHVARKEEILVIKAAKKKGLQVTCEVAPHHLFLSTDDTKRIGEGRARVKPQICSAEDQKALWENMDFIDCFATDHAPHHVDEKNSENPPPGFPGLETMLPLLLTAVKDGRLTLDDVILRLHTNPRRIFGLPEQHDTYVEVDLNEEWTIPDAMAYTKSKWTPFAGMKVFGKVCRVVVRGELAVIEDQVLAKPGFGEDVRAWE-------PPNC--------------------------LPP-LSKAQKQKLDAINNEQPTPANLPDIEQPSLLSGP------PTPIRKISNIMEKLHTQDGLSAEXXXXXXXXXXXXXSQLLVGKHVLKVESINKDQLNALFNIAQQLKKEERRGRQIDTLKGKVLALMFFEPSTRTACSFQSAMQRLGGTTIAIKPGNSSLTKGESVQDTVATMACYSDVIVMRHPTKGMVQQAAEKSRRPIINAGDGVGEHPTQALLDVFTIREEIGTVNGITVTMVGDLKNGRTVHSLARLLTLYRVNLQYVSPDSLPMPDNVQNYVHKRGIPQRQFKTIEEALPTTDVLYMTRIQRERFADQQEYEKVHGYFVLTPKMLTKAKNKMIVMHPFPRVNEISTEVDCDPRAAYFRQMEYGMFVRMALLSMLTGRF 1790
            ++L  R VHI HVARKEEIL+IKAAK +GL VTCEVAPHHLFLS DD +R+G G+  V+P++ S +D +ALWENM  IDCFA+DHAPH ++EK    PPPGFPGLETMLPLLLTAV +GRL+LDD++ RLH NPRRIF LP Q DTYVEVDL  EWTIP  M ++K+ WTPF G KV G V RVV+RGE+A I+ QVL  PG+G+DVR W        PP+                           LPP + +A    L A   E+P   +   + +P L+  P      P P+ + ++  + L T   L  +     H          LVG+H+L V+   KDQ++ LFN+A  L+   ++ R +D LKGKV+A MF+E STRT+ SF +AM RLGG  ++     SS+ KGES+ D+V TM+CY+DV+V+RHP  G V+ AA+  RRP+INAGDGVGEHPTQALLD+FTIREE+GTVNG+T+TMVGDLK+GRTVHSLA LLT YRV+L+YV+P SL MP  V+ +V  RG  Q +F++IEEALP TDVLYMTRIQ+ERF   QEYE   G F+LTP ++T+AK KM+VMHP PRVNEIS EVD DPRAAYFRQ E GM++RMALL+ + GRF
Sbjct: 1603 AQLTQRSVHICHVARKEEILLIKAAKARGLPVTCEVAPHHLFLSHDDLERLGPGKGEVRPELGSRQDVEALWENMAVIDCFASDHAPHTLEEKCGSRPPPGFPGLETMLPLLLTAVSEGRLSLDDLLQRLHHNPRRIFHLPPQEDTYVEVDLEHEWTIPSHMPFSKAHWTPFEGQKVKGTVRRVVLRGEVAYIDGQVLVPPGYGQDVRKWPQGAVPQLPPSAPATSEMTTTPERPRRGIPGLPDGRFHLPPRIHRASDPGLPA---EEPKEKSSRKVAEPELMGTPDGTCYPPPPVPRQAS-PQNLGTPGLLHPQTSPLLHS---------LVGQHILSVQQFTKDQMSHLFNVAHTLRMMVQKERSLDILKGKVMASMFYEVSTRTSSSFAAAMARLGGAVLSFSEATSSVQKGESLADSVQTMSCYADVVVLRHPQPGAVELAAKHCRRPVINAGDGVGEHPTQALLDIFTIREELGTVNGMTITMVGDLKHGRTVHSLACLLTQYRVSLRYVAPPSLRMPPTVRAFVASRGTKQEEFESIEEALPDTDVLYMTRIQKERFGSTQEYEACFGQFILTPHIMTRAKKKMVVMHPMPRVNEISVEVDSDPRAAYFRQAENGMYIRMALLATVLGRF 2225          
The following BLAST results are available for this feature:
BLAST of TCONS_00001866 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
PYR10.000e+055.35CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3[more]
back to top