Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001580 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001580
Unique NameTCONS_00001580
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length270

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001580 ID=TCONS_00001580|Name=TCONS_00001580|organism=Clytia hemisphaerica|type=transcript|length=270bp
TTTGTGTTTATTTTAGACTAGATGAGTATAAATAATGCAAGAGGATTTCG
CGGTTTTGTTAGCCGccataatatgaaaatattttatacaGTCATAACAA
TGTCAACAGTTACAAACTTAATCATGCTGAAGAAGAAACATGACGATGAA
AACCCTATATTGCCATtgGATAAAGACGAACTTGCTTCTGGAGAGGTTTG
GGTGAAAGGATGGAATCAATGGATGGAAGATTTCAATAGATTAAAGaatt
ttGTTCTTGGTGGACCTTCA
Run BLAST on NCBI

transcript from alignment at sc0000011:315819..319168+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001580 ID=TCONS_00001580|Name=TCONS_00001580|organism=Clytia hemisphaerica|type=transcript|length=3350bp|location=Sequence derived from alignment at sc0000011:315819..319168+ (Clytia hemisphaerica)
TTTGTGTTTATTTTAGACTAGATGAGTATAAATAATGCAAGAGGATTTCG CGGTTTTGTTAGCCGccataatatgaaaatattttatacaGTCATAACAA TGTCAACAGTTACAAACTTAATCATGCTGAAGAAGAAACATGACGATGAA AACCCTATATTGCCATGTAAGTATATAATTAGTCTCAAAAGAACTTACAC TTTGAGTGTATTACACCTGCATGCTTTATTATCAAaatgaatatatgttt tatttttattctctGCAGGTTTTTACTTACAAGGATAAACATATCAAACA ACACGAGACATACACAGAATCTCTCGGCTTTCTTCACTAtttaccttatt acatgaatattaGGAGACGTGTAATTAACACGAATGGAAAATATTCGTTT TCGATAAAAACCCTGTTTATTTCTGAAGGCTTATTCTAAAGGTTAAACCT GCTCATTCGTGTTAATTTGATGCTGTGttaattttgttgtttatttcGTT TCAGTTAAATACTTCAATACATATATATTACTTATGTAATAaggtatttc atttttttctatttcaaaattttcagtgGATAAAGACGAACTTGCTTCTG GAGAGGTTTGGGTGAAAGGATGGAATCAATGGATGGAAGATTTCAATAGA TTAAAGGTCTTTATTCtcatatttctgacattaaaataatttttcttagc AATTTAGTGTACCTATTTATCTACAGTTAGAAGTTACTGCATTACTGCTA CAAGTTATAATTATAACACAAAAACGATCTTTATTTTCAGTTGAAATATT GCTTACTACTTCGGATCAAATGTTGCTTACAAAAACATTACAATGACATG TTTCAAGATAAAATCATTGCACTGTGATGTTGGAACTTTCGTAAAAAAGA CCTTCTTTTTCAGAAACCAGCATTGTTAGATACTCAGTTCTTTCATcacc aatttttttatgaattatcTTTTAGAATTTTGTTCTTGGTGGACCTTCAG ATTGAACATAATGTGATGATAACCATTGGTGCAATCTCATGTGATCTTTC TCCTTCTCCATTTAATATAGGAGTATGATATTATGCTGAAGAGAAAATTC TATATTTTCATACATCAATTAGcagtttcaaataaaataaaatagattgg atcattaaaagcaaacaGGCTAAGATCTATTAAATTTTGTTATAATTTAT TGTTATAATATAtctcttttgatatataaataatGTTTGAGTGGTTTTTG ATTGCTTTAAAAATACTTGTACTGGATGCAATTAGGTTGAATTAATTGAT ACATCCTTCTATATTCTAACTTGTCCAATACTTTCATCACAACCGTTTGA TCAATATATTGATAAGCAATCATATTTAACTTTGTGTCTTGCGCTTTTTC TGACCTGAAAAGTACATTTTCAAGCTTTCAGTAAAGCAAGTAGACAAGCT TTTGTCTTTAATTAATAACTAATTGTTGGGTGTTGCCCTAAAAGCCTTTT CCTATGAGAAAAGTTTGTGAtgggcaaaatttcaaactaccATCTAGTGT CATGTAATGAAGGATGTAAAAGTCACCAAACCCATCAATGCTATgtattt ccattttttcaaaataggaaGCACGTAAAGGAAAGatctctaaagatatt tcaactGAAGTTAACTGTCCATTGATTAGGCGAAGAGATTTACTGGCAAA TAGCAAGCTATCAATGAtgaccaaaaaaattgaaatgcgATGTTTTATTG AAATGTTATAACAATGCTTTTGGAAATAGTTGTCATACTTTTGGCTTAAT TTATTTGAAATGAGAATCCTTCTGGCTTGAGCTTTATTTGTGAATATTAG CCAAAACTTTTGAGTTTAAGCCTCAAATTGGTTTTATCCTGTTCTTAAGT TAAGGGAAAAATTAGGTATATTTAGGCCTTGTATTCTATCATTAataatt tgattaatttttaaatGTAGCAGTGTCAAACCTGCGGtcatctatttttt tttttttttgggagggCGGGTTGAGCCTTATTGGTTCTATAAAATCCTAG AAAAGTGGGAATCCTGAAAATATATAGCTCTATGTCCATAACATAGAGAA AGATATTTatactttcaaatttttggtcAGGGTATAAGGGGTAATTTTAG GGACGGTTTAAAGTCTGATTTTATGTCTCACTCCCTCGTTTGTGGTGTTT CTACTTTATGAAAATGATTGCACTTTACTTGTTGCTTCCAAAGAAAGTCC TTTGGAGTGTTACCCACTATTATGTCAAGGTTATGATATGTATccaaata tatttatttttgaatggAAAAAGTTTATCTTATTTTCATCCATTTGTTTT TTCTAGTAAAATGAANAATTTATTTTTGTACGGAAAAAGTTTATCTTGTT TTCATCCATTTGTTTGTTCTAGTAAAATGAATACACATATagataataaa aacaaagcaTGAAAATGGCAGACGATGTATTGAACGACCTGCTGAATgga gaaatgaaagaaaatgttgTTTTGTCTGCGTTATCTTCCAATATCTACAT CCCAGTAAGTTGACCTAGATTGATTTGTTCAGATCCATACATTCTGGTCA CACTGTACAATCTTTTAATGCTTAAGCTACTTCTAGATTGAACAATTATG ATTTATggcatttttgttttatttttcagtacAAAGGCAATGAAGTCTCC ATATCAGAATTTATCCCTCATTTCATGGCCTTCTTACGTGCTCGATTACT CCAAAACACAGATCAAAGTAATGGCCACACTCCTTATTTCTCACCGAGAC AAAAAGAAGAACAACGAAAAGCTGAGAGAAGCAAAATCAAGAACAAATCT AATAACATCGGTGGGAAAACAGCTCGCCTCAGTCTCCAATATGCAAGCTC TCCTCTAAAAACTGTCAACAAAAACAATGAGAATCGAAATTTGAACAACC AATTACATTCTGGCATTTATGGGATTTCACCAATCAAAGGCATTGAAACA AAGCGCGGGAAATCTGGCAAACATAAGAGGTTGAATAAGAAagatatttc tgacattaaaacattttttcttagCAATTTAGTGTACCTATTTTTCTACG GTTATAAGTTACTGCATTACTGCTACAAGTTATAATTATACCACAAGAAT GATCCTTTTCTTCGGATCAAATGTTGCTTACAAAAACATTACAATGACAT GTTTCAAGATAAAATCACCGCACTATGATGTCGAATCCTTCGTCCAATAA AGACCTTCTGCTTCAGAAACCAGTATTGTTAGATACTCAGTTCTTTCATC AccaattctttttctttttcttttagaattttGTTCTTGGTGGACCTTCA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000825XLOC_000825Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001580-exon-sc0000011-1491911889:315819..315984TCONS_00001580-exon-sc0000011-1491911889:315819..315984Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1510915933:315819..315984TCONS_00001580-exon-sc0000011-1510915933:315819..315984Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1575043694:315819..315984TCONS_00001580-exon-sc0000011-1575043694:315819..315984Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1491911889:316395..316474TCONS_00001580-exon-sc0000011-1491911889:316395..316474Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1510915933:316395..316474TCONS_00001580-exon-sc0000011-1510915933:316395..316474Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1575043694:316395..316474TCONS_00001580-exon-sc0000011-1575043694:316395..316474Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1491911889:319145..319168TCONS_00001580-exon-sc0000011-1491911889:319145..319168Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1510915933:319145..319168TCONS_00001580-exon-sc0000011-1510915933:319145..319168Clytia hemisphaericaexon
TCONS_00001580-exon-sc0000011-1575043694:319145..319168TCONS_00001580-exon-sc0000011-1575043694:319145..319168Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000011supercontigsc0000011:315819..319168 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
36.5856 33.9046 20.757 13.5106 34.1182 38.5818 26.4147 13.6762 16.3727 16.7925 0 15.3455 15.5636 10.9587 21.0181 9.86875 22.9103 28.8674 2.78521 10.5026 27.1176 18.2414 33.1738 27.8875 21.7752 13.4079 10.6372 9.47067 13.1297 23.0907
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001580 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top