Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001578 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001578
Unique NameTCONS_00001578
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length467

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001578 ID=TCONS_00001578|Name=TCONS_00001578|organism=Clytia hemisphaerica|type=transcript|length=467bp
GTCGAACGAAAGAAAATGTGCCAGAAAAGCCAAAATCCTGattaatttct
tttgtaaaagctACTAGATGAGTATAAATAATGCAAGAGGATTTCGCGGT
TTTGTTAGCCGccataatatgaaaatattttatacaGTCATAACAATGTC
AACAGTTACAAACTTAATCATGCTGAAGAAGAAACATGACGATGAAAACC
CTATATTGCCATtgGATAAAGACGAACTTGCTTCTGGAGAGGTTTGGGTG
AAAGGATGGAATCAATGGATGGAAGATTTCAATAGATTAAAGAATTTTGT
TCTTGGTGGACCTTCAGATTGAACATAATGTGATGATAACCATTGGTGCA
ATCTCATGTGATCTTTCTCCTTCTCCATTTAATATAGGAGTATGATATTA
TGCTGAAGAGAAAATTCTATATTTTCATACATCAATTAGcagtttcaaat
aaaataaaatagattgg
Run BLAST on NCBI

transcript from alignment at sc0000011:307286..316968+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001578 ID=TCONS_00001578|Name=TCONS_00001578|organism=Clytia hemisphaerica|type=transcript|length=9683bp|location=Sequence derived from alignment at sc0000011:307286..316968+ (Clytia hemisphaerica)
GTCGAACGAAAGAAAATGTGCCAGAAAAGCCAAAATCCTGattaatttct tttgtaaaagctgTAAGTAAGTTTTCGCTGGTAAGTTTGTAGACCTGACT TTCAATTGTGTCGAAATTTGTTCTCTCAACAAGCTGTATTATTGCTCCAA TATGTGAGCTGCAAAAAACTGTGTGTTTTGTTTAAACAGTTAGTTAGAGT TACATCAACAACAGATCAacatgccaaaaacattttgttcaatcatcttc acttcaagataggccaccatagaacgAATTTCCTTTTATAggtgaaccat attcatgtcgTGGCTTTCagcattagtcaaaaaagtcattaaaattgttT AACCTctgcaaaaaatcccgacgatgAGAGTGCGCACCATttaagttgaa gttggtttgatattctacgtttgacgtttgatattcgattgatattcgtt tgatattctcaaatttgcgttttgaagtttttgtgactacttttggaact ggaaactattggaagccatcaataatagagtttattctcaagcagttagt cacactaggaaatctagcttttagaaaaaacaacatcagtcatctacagg atatatttcaacaacaaggatgagagttacctgaatcaagtttgcaagac aatattaattaaaacttgaaagttggaaacaaaataaaacgtgcaNttgc ggtgcatttttttgcttgagagtcaagtaaacgatatagcgcttttgcag cattaatctttgatacgcattttggcgggacgctagtgtggctaactgtc AAGGGTAGGGTGCGCACTCATCGGATTTTTGGCGCGGAACGaagaagaat ttacaaaaatgaacttcaaggcattagtacttaccgtgagaggtcctaaa gccgacagcccagcttaattccgacaccccaaataactgttatgaaaaaa aattctatgtttacaaacattccctctccaagttNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtttaaatcatccaaat ctgttcattcttttttttaaatcaatcaggaattatcagggaaacaagta aaaaaaactgcatcaaggtatctattttctttccaaagatatNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNaaattctcgacccacattgaaa caaatggctgtcgctattgagctggttcatcttttcaatcgcggtttttt tagtaaacccagggtaagattaggctacaaccTATCACAacctgctttat ttgaaaatctacaggccgtctggaatttcgaaaaataagaagaaattttt taacaagattgcggattttttcatttaagcaccattcaccatctgaaagc tgaggatttcagctttctagtggtgaaatttggataactttggaactact taaccaattttaacaaatggcccctcatttttctcacgaaggtaaggact ttcaaataaaattacagtagtttggttttcaaaatttgaggggaaaattt tggcctgtccaccctaacAATGTTTTCCTTTAGtaagattgaccattttg ttgttttggatTTGAGCGAAATTTctggagcccaacttgtcattttggcc gaaatgaggtttaacggttacaaatttttagagggagcacgctgtgacgg agagcgctgaaattttgcacacacacccttgagaataaactctattggct tcaaatgttttccagttccaaagataaccgctctcccccacaggagccca acttgtcatttcggccgaaatgaggtttaacggttacaaatttttagagg gagcacgctgcgacagagagcgctgaaattttgcacacacacccttgaga ataaactctattggcttttccaatagtttccagttccaaagataacagct ctcccccacaggagcccaacttgtcatttcggctgaaatgaggtttgaca gttacaaatttttagagggagcacactgcgacggagagcgctgaaatttt gcacagacactcttgagaataaactctattggctagcttccaatagtttc caattccaaagataaccccTCTCCCCCACGGTCAccctcccccacaggag cccaacatgtcatttcggccgaaatgaggtttgacgattacaaattttta gagggagcacactacgacggagagcgctgaaattttgcacagacaccctt gaTAGGGTGGACAggacaaaattttcccctcaattttaaaaaaccaaact aattttatttgaaagtccttacctttgtgagaaaaatgaggggtcattta tNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtggtt aagtattcccaaagttattccattttcaaaacacaaaaaaatcacctttt caaagaatcgcctccttacaccacgccagcaagaaataattttcagaacc aaaatcgcgccaaaaatggcggatgaaatctagtcttccgtgtggcgggg tgtggggagttttgccgGTGCGGTCTAAAAATcagcccgatgactgttaa actttagcctatcgctaatgagctggaaatgatagctaaaaacaaatttt accaatgaaaagctgaaacccttagctttccaacgatatatgatagccct gataaaaatttcaggaaagtgccgaaaaatcgaaatttcttcttttttct cgatttaaagacagcccgtagattatcgaaaaggctaccacgtgacatac taaagtactatctttcccgcgagtctataactaatccagctcaatagcga tagctatttgaaaaatggtggtcaaggtAGACGGTGGTGCCACAAATTCC GAGTTGCCATTTTTTTACCTTGATGTCTAATAAATGGTATACCAGCCATA TTgaaccaattctaataaatgacccctcatttttctcacaaaggtaagga ctttcaaagaaaaattagtttggtttctaaaaattgagggggAAATCTTT GCCTGTTCACCCTATCAGTGGTATGTATTTAACAGTTACATCAacatgcc aaaaacattttgttcaaccacctttaCTTCAAGGATAGACCAccatagaa tgatagaatgaacttccttttacaGGATGAAccattcatgtggctttcag ccttgaactccatcacagagcctatttgagatattacTAACTAGCccgga gaaaaattttaaacctttattatttgaatgcatgcctttttaatataata ctcaaatataaaaaaattaaaaaattttaacttgatcaTTAGTTAGGGTG GACatgccaaaattttcccctcaatttttagaaaccaaactaattttatt tgaaaatcctTACCTTTgtaagaaaaatgaggggtcatttattagaattg gttaagtattcccaaagttattcaattttctaaacacaaaaaaatcacct tttcaaagaatcgcctccttacaccacgccagcaagaaataattttcgga agcaccaaaatcgcgccaaaaatggcggatgaaatctagtcttccgtgtg gcggaGTGTTGGGaggtgcggtctgaaaatcggcccgatgactgttaaac tttagcttatctctaatgagctggaaatgatagctaaaaacaaatttcac cactagaaagctgaaatcctcagctttcagatggtgtaaggtgcttaatt aaaaaaatctgcaatcttgttgaaaaatcgcaatttcttttatttttcga aaattccagaCGGACTGcagatttttaaataaatcgcaatatgatagatt gtagcctaatcttaccctggtttataaaaaaaaccgtattgaaaagatga accagctctaTAGCTTCAGCCATTTGTTTCCATGTGGGTcaagaattttc cggtgccgtggtcagcgctaagtcgtgttttcaccttgacgtcgaaaaac atcaatatctttggaaagaaaatagatacctggatgcagttttttttact tgttttcattttttcagttttttgttcattttcatttgtttatctttttt gcaactgtttgcaatgtcagctttttccataaattatgcgcgcatagaaa aatatcgaaaaccccgcgaaaattctgctcagtgactgggcgcgtattGG CCAATTAGACAAATATCCCTGCAGAagagttagttggaccagaccgtaaa ccagagacaaaattataaaaaactagatggtgaaatagtttacggtctgg atatccaggctacaatGGAACTAAATCAAACTCCATCAAATGATTTAATT TCAATCAAGATAAATGAACCTAAtcaaacactcacaatttttgaagcaaa gtATTAAAAATTGGATAATTTTCGGACCTAGAAAAAAACGTTAGTAATGG GGGgacttgataagttctatctatcaattaactaaaaatcgattcacttg AAAACTGTAGGaaattcgaagggcaaattttttgtcaattctacacccta ttagtagcatcaggggggggggggcagggtNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNGGGGGGGGCagggtccaggataccaaccAAGGGC CCAACAacctgacttttcgagatttgaaagtagtagacaccaccaccccc taaatCAGTATCGATACGAACTTGAAAATCccgttttttctgaaaaaggg ggaaCCACCCCCCCTAAATTGGCAATAAATAAAAATGCAAGAAGTTATGT GCATAGGATACTGCATACAAGGGACGCTAAACAAAATCTGtggatatttt taatcaaagaacattcctcttattaatcacttatattatgtaccacactt tagactcctgaaaatgaaaacaagtttttttcattctaacacaacgtaaa ttaagtttcttgcactaaattggcaaaatgtatcaaattcataaaactag tTGATAAACTAGACTAGATAAAAAACTCATTGTATTAGGCACGCCTAGAG TCTTTGTAATAGCCTATATGATGAACGTTATGtacagaaaaattttatca cgactaaaaaagctctaagatctgctaagacttgatacagtttgttcaac tctagttttgaatgaattttggttgattgaaaggattgagagcagcaaaa gttataataaaaataaaaatggcggatgaaatctagtcttccgtgtggcg gaGTGTTGGGAGTTTTGccggtgcggtctgaaaatcggcccgatgactgt taaactttagcttatcgctaatgagctggaaatgatagctaaaaacaaat ttcaccactagNgcccgatgactgttaaactttagcttatcgctaatgag ctggaaatgatagctaaaaacaaatttcatcaCTAGAAagctagacggtg aaatagtttacggtctggatatccaggctagttttacttttgaattttct ttcaaaaaatgttaaatagtTAAGAGAGGAAGGAGCAATTTGTATGTTGT ATCTTGTATGTATATACTGCAAGCATGagaatttcaagtaatttttttta gtaaccCTTTTAATTTAATTCACCCCTTCCTGGTATCTTTAGAAAATGTT ACGTAATTTGATCTGGAAAAACCAACAATTATTCTTGAGGCCATCACAAT CCCAATTATTGAAGCCTATTTTCAATTTACACACAACATGTATAAAAAGT GGAACTCATGATTATGAAGCGGTAGATGTCTTGTTAAATGCAAAGCGACA TAAAGAAGCAACAGGTAATGAATCGATTCTCAACCAAGCAGCATCGCGAT CTGGAGCTGTTGTTCGATGGAAGAAAGTGGAGGGTGAAATGCTTCTGGAT GAAGACCCAGTACTAGTTGTTGGTCGCCCATTTCAAATTAAAGCTGCAAC TGATGTTTTGTTGAATGGGGTTGTGGAAGATACAGAAAATGTAGATAGCC AGGATGAGCGTTTAGTATGGCATGGCTATAAACGTAATTTTAAAGGACAA TTTCCCCCTGAAAAACCAAGAAAGACTTGTATCCGTAATAATGGAAATAG AGTATCAGGAAATCCATGTCCACTTTGCCAGATTAAATTGAAGTCAAGCT ATAATGTACATTTTACTGACGTACAGCTACTTGAGCAGTTTATTTGCCCG CACACTGCTGAAATTCTTTCACCCAAGGTGACAGGTATCTGTAAGAAACA ACACCTTCAAGTTGAAGCAGCTATTAAGAAAGCTCGAAATTTTGGTTATT TACCTTTTACATTGCCACTACATTCAAAGGAACAAGGAAAACATATACCA GCCGGTATACCaacagataaaaaaatcaaagtgaaaatgcactgaaatta GTATTGTTAATCAGATTTTGTATACTTAccatgttttattttttgattca tATTTTAATTAGATAAATCTTAAAATAAGCCAAAAAGCTTTTTATTCTGT TTCATTTCCTCCAAATTGCTCgatcttttaaagtaaaatcgaaatttatt tgaatgaattttggttgTTGTTTGTCTTCTATATCTCCAGagttgaattt ttcatttttgtttttatttctgacTCATGTTCATTTGTGTTTATTTTAGA CTAGATGAGTATAAATAATGCAAGAGGATTTCGCGGTTTTGTTAGCCGcc ataatatgaaaatattttatacaGTCATAACAATGTCAACAGTTACAAAC TTAATCATGCTGAAGAAGAAACATGACGATGAAAACCCTATATTGCCATG TAAGTATATAATTAGTCTCAAAAGAACTTACACTTTGAGTGTATTACACC TGCATGCTTTATTATCAAaatgaatatatgttttatttttattctctGCA GGTTTTTACTTACAAGGATAAACATATCAAACAACACGAGACATACACAG AATCTCTCGGCTTTCTTCACTAtttaccttattacatgaatattaGGAGA CGTGTAATTAACACGAATGGAAAATATTCGTTTTCGATAAAAACCCTGTT TATTTCTGAAGGCTTATTCTAAAGGTTAAACCTGCTCATTCGTGTTAATT TGATGCTGTGttaattttgttgtttatttcGTTTCAGTTAAATACTTCAA TACATATATATTACTTATGTAATAaggtatttcatttttttctatttcaa aattttcagtgGATAAAGACGAACTTGCTTCTGGAGAGGTTTGGGTGAAA GGATGGAATCAATGGATGGAAGATTTCAATAGATTAAAGGTCTTTATTCt catatttctgacattaaaataatttttcttagcAATTTAGTGTACCTATT TATCTACAGTTAGAAGTTACTGCATTACTGCTACAAGTTATAATTATAAC ACAAAAACGATCTTTATTTTCAGTTGAAATATTGCTTACTACTTCGGATC AAATGTTGCTTACAAAAACATTACAATGACATGTTTCAAGATAAAATCAT TGCACTGTGATGTTGGAACTTTCGTAAAAAAGACCTTCTTTTTCAGAAAC CAGCATTGTTAGATACTCAGTTCTTTCATcaccaatttttttatgaatta tcTTTTAGAATTTTGTTCTTGGTGGACCTTCAGATTGAACATAATGTGAT GATAACCATTGGTGCAATCTCATGTGATCTTTCTCCTTCTCCATTTAATA TAGGAGTATGATATTATGCTGAAGAGAAAATTCTATATTTTCATACATCA ATTAGcagtttcaaataaaataaaatagattgg
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000825XLOC_000825Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001578-exon-sc0000011-1491911889:307286..307347TCONS_00001578-exon-sc0000011-1491911889:307286..307347Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1510915933:307286..307347TCONS_00001578-exon-sc0000011-1510915933:307286..307347Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1575043694:307286..307347TCONS_00001578-exon-sc0000011-1575043694:307286..307347Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1491911889:315835..315984TCONS_00001578-exon-sc0000011-1491911889:315835..315984Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1510915933:315835..315984TCONS_00001578-exon-sc0000011-1510915933:315835..315984Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1575043694:315835..315984TCONS_00001578-exon-sc0000011-1575043694:315835..315984Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1491911889:316395..316474TCONS_00001578-exon-sc0000011-1491911889:316395..316474Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1510915933:316395..316474TCONS_00001578-exon-sc0000011-1510915933:316395..316474Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1575043694:316395..316474TCONS_00001578-exon-sc0000011-1575043694:316395..316474Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1491911889:316794..316968TCONS_00001578-exon-sc0000011-1491911889:316794..316968Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1510915933:316794..316968TCONS_00001578-exon-sc0000011-1510915933:316794..316968Clytia hemisphaericaexon
TCONS_00001578-exon-sc0000011-1575043694:316794..316968TCONS_00001578-exon-sc0000011-1575043694:316794..316968Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000011supercontigsc0000011:307286..316968 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
24.1614 28.7835 18.0066 14.5438 24.73 18.1876 16.5736 17.7014 14.5677 12.4318 10.1701 10.6548 8.38702 9.59286 8.25237 7.57706 18.8538 17.6484 7.5101 6.4765 12.9457 10.9433 25.0608 20.1817 6.82287 13.7443 8.73225 6.7574 10.0927 16.012
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001578 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top