Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001177 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001177
Unique NameTCONS_00001177
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length108

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001177 ID=TCONS_00001177|Name=TCONS_00001177|organism=Clytia hemisphaerica|type=transcript|length=108bp
ACGAGTTTTAACTTGGAGTCCTCGCCATCAACATGAAGCTCTTcttattt
tttgtctttttcgtGGCTTTTGCTGCTGCTGAATTCGTATACGATGAATC
AAGCTTTG
Run BLAST on NCBI

transcript from alignment at sc0000007:705657..705875-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001177 ID=TCONS_00001177|Name=TCONS_00001177|organism=Clytia hemisphaerica|type=transcript|length=219bp|location=Sequence derived from alignment at sc0000007:705657..705875- (Clytia hemisphaerica)
ACGAGTTTTAACTTGGAGTCCTCGCCATCAACATGAAGCTCTTCTTATTT TTTGTCTTTTTCGTGGCTTTTGCTGCTGCTGAATTCGTATACGGTGAGAT TTTCATATATTTTATACTCCGTGTTCTATTCTAAATACGAACCATAATTT TTAATTCATCTTTTATATGTACAGTCATTTGACAATGATATTTTCGTTTT TCAGATGAATCAAGCTTTG
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000639XLOC_000639Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001177-exon-sc0000007-1575043694:705783..705875TCONS_00001177-exon-sc0000007-1575043694:705783..705875Clytia hemisphaericaexon
TCONS_00001177-exon-sc0000007-1575043694:705657..705671TCONS_00001177-exon-sc0000007-1575043694:705657..705671Clytia hemisphaericaexon
TCONS_00001177-exon-sc0000007-1510915933:705783..705875TCONS_00001177-exon-sc0000007-1510915933:705783..705875Clytia hemisphaericaexon
TCONS_00001177-exon-sc0000007-1510915933:705657..705671TCONS_00001177-exon-sc0000007-1510915933:705657..705671Clytia hemisphaericaexon
TCONS_00001177-exon-sc0000007-1491911889:705783..705875TCONS_00001177-exon-sc0000007-1491911889:705783..705875Clytia hemisphaericaexon
TCONS_00001177-exon-sc0000007-1491911889:705657..705671TCONS_00001177-exon-sc0000007-1491911889:705657..705671Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:705657..705875 -
Expression
No biomaterial libraries express this feature.
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001177 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top