Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001076 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001076
Unique NameTCONS_00001076
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length3288

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001076 ID=TCONS_00001076|Name=TCONS_00001076|organism=Clytia hemisphaerica|type=transcript|length=3288bp
TCTGCGCATGTGCAATACAGACCACAAGCGTTAACAGCCCCtgtaatgat
aattgaataaaatccattttctcGAGAATGTAAGGCTTGGGCAATGATTG
TGGAACGAATACTCACAcatcttttttttctcaggaaGAACTTTTTCTCC
GCTCTTAAGCATAGGAGAAAGCGATAATTTAAAACTGTAGATTCGTGTAT
TTGGTCATATTTTATGGacagaaaaataaatgaagatACAGTTGGCTTTC
CATATGTGAGTTTGAGTGGGACAGTATTTGGACTATTTTTTCTCTCTATC
AGTCGAACTTTCTATTGCTTGAACGATCAAGGACTCCCCTCGTCGTTCGA
CTTCTCAAATTCAACTGTAGTTGTGTTGAATTCAGTATTCTTTAAATGAG
AATATTCTTCTTGTTGTTGGAACTTACCGTTAATGCAATAAACATGTTTA
TCTTATGTCTGTTATTTCTCTTTCACCATCACGTCAGTATATTTTCAATT
ACAAGTATAAACTGTCACTGTCTTTCACGAATTAGGatttttttcgtttc
ttttccCTTGTGATTTCCAATTCATTATTTCACAGTGAATTGTTTTTCAT
TGTCACCTGGTAACCTTTCAATGTTCGGATTCAACCCagataaaaataga
atgaaCTAACCTTAGCCTTTTGATTCATACCATTTGAATATATTAGTGGA
ATGATTTATTCATGACATCTATGTACATCAAAAGTTAGCTACTCACTACT
GAATAATAAACAAATTATAACATGGAAGAAAAACCCACTAAAAGATTTAT
AtgatttatattatattttgaaataattcatTCAACTCGCAACGTTTTTT
CTCGTTCGATTTCAATTTTCGTAGTAATTTGCTTTCTCCGCACCCATAAA
CATGCACTTTCTAATATGTATCTTACGCAAAGTGTTAAAAACGGTATATA
AGATGCAGTTCTTTACTCAGTGCAAGTTCATCAGTGTTTCTCAACAGTGT
TTCATACAGAAGGTCTGCTTTAGACTGCTATTACTCGTCTCTGTCTAACA
AAATTACATTAAAAGGTTAAATGAATGAGATGAAGGAGTCAATAAACACT
TTCGTCTAACATGATTTCATCGCCAAGAGATGAAGATGAAGTGTATCTCA
TTTCGTACGAGTCCTCACTTTTCTCCTCCATTGCGTCATAAGGATTGTCC
TTGTAACGTATACGAATGGGAAGTCCTTTCAAGAAAGATAAGGTGGTCAA
CTTCTTTTTCTCCTTGATACGTTTCTCCTCGGTCATCGCTTCCACCACCC
AATGGTTGCGGTAGAAATAAAAGTAAAGCACTTGCAATCCAAGACATACT
TGAGCGATAGATGCTGCGATGAGAAGAAAATTCTGCAATTTTGCTTCAGT
GCGCACTGACACGCTCATCAAGGTCCAGCCGATCAGGAGGGTGGGTAAGA
TGGCTCCGGTGGCAAACACACTCAACTGCGCTTGCTGGTAGTTGAAATCA
TTCTCTAGAAACTTATCCTGGCCTTGATATTTCTTGAAGGTGATGAACTT
GATTAAGAAGCTGGCACAAATGATGGCTGTGATAGGGTTGATGAAATACC
AAAGCCGTAAGTCGTTGGCGTACACCCAACAGATGCGGAGTGAGCTGTAC
TCGTCATACGGGAAACCTTGCATTGCAATCATATTGGAAAGGGGGATACC
CAGGCCGACGATGTGATATAAGAAATCTCTGTTGGTGTCTTTGTGGAAGA
AATGAAGGAGATTCGACAAGCGATGTACACTCTCCATCATTAGCCAACTC
AATATGTTGATGAAAAAGAACTGTATCCAACCTGTATATATAGCACACTT
TTCCCAATCGTCACGATGGCGGAAGGAGAAAACGATCAATACTTGCATCA
TGAACAGACTGAGGTTTGCGTAAATATACAATCTGTTAGCGCTATTCTTA
TGGCACTTCAAGGAGAACATCCCCGCCAAATACACCAGTTGAAGGAGGGC
GGAGAACGAGATAAACGCTAGGAAGAGAATCTCGGTGACATCCAGAGGTT
GGCTGTTATTTTTTGGTACGTATGGTTCCATCAGTACAGCGAACGAACCA
AAAGTATACGCTTTGCAAACGGTCATcgatttgttggttttcaatATCTT
CATATGGTAATTGGTCCAATATCCTGCTTCTGGGTCCGCTCCTTCTTTGC
CAGCATTCAACGGTTGCCAATATACGCAGATTGGATTGACCATTTTCCGA
TCCTTGTGTGTAAACGCGATGGTGTTGTACGTGGGAAGCTCAGCCATCGC
TGGCTCGATATCGAAAGTGACCACTATTGAGTTGATCACGTGATTAGTAT
AGTGCTTCCATCCGGTTTCGCTTCTGAAACTGATGTATTCTCCATTTGAG
ATTGGATGCTGGTCAGGCCAGTTGTCTTTCAATCgatatttctctttttc
ttgttttgccACGACCACTTGATCAAACATGGCAAAGTTATAGATGAAAT
CGCCACGTAGGATGTTCCCGTAAGGCACGGTTAGCGTATCGTTAATCCCG
TTCCAACGTCGCCGCGATCGTTTGAACGGGTTCTTATGATAACCGGGTAA
TACAATATCAGACATGCGGAACGATTCTTCGCCATACCAAACTAACTTTT
TGAAGACCTCAATCGGGAAAGGCGTTTTCTTGATCATTTTCAGCACTTCA
TCCTTCATAAAGACTTTGGTATATTTGATCAAATGGTAGATTAACAACAT
TGGCGCAGCAGGGTATTTGTAATGTTGAGTTCCCTTCTCTTCTAAGCATT
CAATATGTTGACTCATATTGAGAAAGACGTCCTTTGCACACAAACTGAAG
CGCGACGAACATTTGTTTTTGAATAGCCAGTATTTGTATTGGTCGCACTC
TTCTTGGCGTAGTTGTTGCATGGAttttgttgttgtggttgtAGTCGTTG
GTGCAGAGGTCGATGTTTGTTTTGGAAAACAACTGGTGTTTGAGATGGTA
TCTTCGATACAAGACGTGTTGAGACATGACATTTCGACACAACTTTCCTT
CATCGGTAGCGACACTGTTTGTTTGAGGTATTGTTGAGCGCACTTCAAAT
CCATACAATCTGCTCGAAAGCATGTTTGGTTGTCCAGTTGAAGAAGGGTG
GATGTTGTAGTGTTGAGAGTAATCGTTGTTGAACACTTCTCACTGCTGTT
GCAAGTGATGTTCCAACATACTGTCTCAGTAACTGTAGTGTTTTGTTGTG
AGTTTATTGTGTTGTTGGCCAAGGACCATGAACCACCA
Run BLAST on NCBI

transcript from alignment at sc0000007:1401407..1404748+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001076 ID=TCONS_00001076|Name=TCONS_00001076|organism=Clytia hemisphaerica|type=transcript|length=3342bp|location=Sequence derived from alignment at sc0000007:1401407..1404748+ (Clytia hemisphaerica)
TCTGCGCATGTGCAATACAGACCACAAGCGTTAACAGCCCCtgtaatgat aattgaataaaatccattttctcGAGAATGTAAGGCTTGGGCAATGATTG TGGAACGAATACTCACAcatcttttttttctcaggaaGAACTTTTTCTCC GCTCTTAAGCATAGGAGAAAGCGATAATTTAAAACTGTAGATTCGTGTAT TTGGTCATATTTTATGGacagaaaaataaatgaagatACAGTTGGCTTTC CATATGTGAGTTTGAGTGGGACAGTATTTGGACTATTTTTTCTCTCTATC AGTCGAACTTTCTATTGCTTGAACGATCAAGGACTCCCCTCGTCGTTCGA CTTCTCAAATTCAACTGTAGTTGTGTTGAATTCAGTATTCTTTAAATGAG AATATTCTTCTTGTTGTTGGAACTTACCGTTAATGCAATAAACATGTTTA TCTTATGTCTGTTATTTCTCTTTCACCATCACGTCAGTATATTTTCAATT ACAAGTATAAACTGTCACTGTCTTTCACGAATTAGGatttttttcgtttc ttttccCTTGTGATTTCCAATTCATTATTTCACAGTGAATTGTTTTTCAT TGTCACCTGGTAACCTTTCAATGTTCGGATTCAACCCagataaaaataga atgaaCTAACCTTAGCCTTTTGATTCATACCATTTGAATATATTAGTGGA ATGATTTATTCATGACATCTATGTACATCAAAAGTTAGCTACTCACTACT GAATAATAAACAAATTATAACATGGAAGAAAAACCCACTAAAAGATTTAT AtgatttatattatattttgaaataattcatTCAACTCGCAACGTTTTTT CTCGTTCGATTTCAATTTTCGTAGTAATTTGCTTTCTCCGCACCCATAAA CATGCACTTTCTAATATGTATCTTACGCAAAGTGTTAAAAACGGTATATA AGATGCAGTTCTTTACTCAGTGCAAGTTCATCAGTGTTTCTCAACAGTGT TTCATACAGAAGGTCTGCTTTAGACTGCTATTACTCGTCTCTGTCTAACA AAATTACATTAAAAGGTTAAATGAATGAGATGAAGGAGTCAATAAACACT TTCGTCTAACATGATTTCATCGCCAAGAGATGAAGATGAAGTGTATCTCA TTTCGTACGAGTCCTCACTTTTCTCCTCCATTGCGTCATAAGGATTGTCC TTGTAACGTATACGAATGGGAAGTCCTTTCAAGAAAGATAAGGTGGTCAA CTTCTTTTTCTCCTTGATACGTTTCTCCTCGGTCATCGCTTCCACCACCC AATGGTTGCGGTAGAAATAAAAGTAAAGCACTTGCAATCCAAGACATACT TGAGCGATAGATGCTGCGATGAGAAGAAAATTCTGCAATTTTGCTTCAGT GCGCACTGACACGCTCATCAAGGTCCAGCCGATCAGGAGGGTGGGTAAGA TGGCTCCGGTGGCAAACACACTCAACTGCGCTTGCTGGTAGTTGAAATCA TTCTCTAGAAACTTATCCTGGCCTTGATATTTCTTGAAGGTGATGAACTT GATTAAGAAGCTGGCACAAATGATGGCTGTGATAGGGTTGATGAAATACC AAAGCCGTAAGTCGTTGGCGTACACCCAACAGATGCGGAGTGAGCTGTAC TCGTCATACGGGAAACCTTGCATTGCAATCATATTGGAAAGGGGGATACC CAGGCCGACGATGTGATATAAGAAATCTCTGTTGGTGTCTTTGTGGAAGA AATGAAGGAGATTCGACAAGCGATGTACACTCTCCATCATTAGCCAACTC AATATGTTGATGAAAAAGAACTGTATCCAACCTGTATATATAGCACACTT TTCCCAATCGTCACGATGGCGGAAGGAGAAAACGATCAATACTTGCATCA TGAACAGACTGAGGTTTGCGTAAATATACAATCTGTTAGCGCTATTCTTA TGGCACTTCAAGGAGAACATCCCCGCCAAATACACCAGTTGAAGGAGGGC GGAGAACGAGATAAACGCTAGGAAGAGAATCTCGGTGACATCCAGAGGTT GGCTGTTATTTTTTGGTACGTATGGTTCCATCAGTACAGCGAACGAACCA AAAGTATACGCTTTGCAAACGGTCATcgatttgttggttttcaatATCTT CATATGGTAATTGGTCCAATATCCTGCTTCTGGGTCCGCTCCTTCTTTGC CAGCATTCAACGGTTGCCAATATACGCAGATTGGATTGACCATTTTCCGA TCCTTGTGTGTAAACGCGATGGTGTTGTACGTGGGAAGCTCAGCCATCGC TGGCTCGATATCGAAAGTGACCACTATTGAGTTGATCACGTGATTAGTAT AGTGCTTCCATCCGGTTTCGCTTCTGAAACTGATGTATTCTCCATTTGAG ATTGGATGCTGGTCAGGCCAGTTGTCTTTCAATCgatatttctctttttc ttgttttgccACGACCACTTGATCAAACATGGCAAAGTTATAGATGAAAT CGCCACGTAGGATGTTCCCGTAAGGCACGGTTAGCGTATCGTTAATCCCG TTCCAACGTCGCCGCGATCGTTTGAACGGGTTCTTATGATAACCGGGTAA TACAATATCAGACATGCGGAACGATTCTTCGCCATACCAAACTAACTTTT TGAAGACCTCAATCGGGAAAGGCGTTTTCTTGATCATTTTCAGCACTTCA TCCTTCATAAAGACTTTGGTATATTTGATCAAATGGTAGATTAACAACAT TGGCGCAGCAGGGTATTTGTAATGTTGAGTTCCCTTCTCTTCTAAGCATT CAATATGTTGACTCATATTGAGAAAGACGTCCTTTGCACACAAACTGAAG CGCGACGAACATTTGTTTTTGAATAGCCAGTATTTGTATTGGTCGCACTC TTCTTGGCGTAGTTGTTGCATGGAttttgttgttgtggttgtAGTCGTTG GTGCAGAGGTTGAGGTTGGTTTTGGAAAACAACTGATGTCNGTTGTAGTC GTTGGTGCAGAGGTCGATGTTTGTTTTGGAAAACAACTGGTGTTTGAGAT GGTATCTTCGATACAAGACGTGTTGAGACATGACATTTCGACACAACTTT CCTTCATCGGTAGCGACACTGTTTGTTTGAGGTATTGTTGAGCGCACTTC AAATCCATACAATCTGCTCGAAAGCATGTTTGGTTGTCCAGTTGAAGAAG GGTGGATGTTGTAGTGTTGAGAGTAATCGTTGTTGAACACTTCTCACTGC TGTTGCAAGTGATGTTCCAACATACTGTCTCAGTAACTGTAGTGTTTTGT TGTGAGTTTATTGTGTTGTTGGCCAAGGACCATGAACCACCA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000608XLOC_000608Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001076-exon-sc0000007-1491911889:1401407..1404364TCONS_00001076-exon-sc0000007-1491911889:1401407..1404364Clytia hemisphaericaexon
TCONS_00001076-exon-sc0000007-1510915933:1401407..1404364TCONS_00001076-exon-sc0000007-1510915933:1401407..1404364Clytia hemisphaericaexon
TCONS_00001076-exon-sc0000007-1575043694:1401407..1404364TCONS_00001076-exon-sc0000007-1575043694:1401407..1404364Clytia hemisphaericaexon
TCONS_00001076-exon-sc0000007-1491911889:1404419..1404748TCONS_00001076-exon-sc0000007-1491911889:1404419..1404748Clytia hemisphaericaexon
TCONS_00001076-exon-sc0000007-1510915933:1404419..1404748TCONS_00001076-exon-sc0000007-1510915933:1404419..1404748Clytia hemisphaericaexon
TCONS_00001076-exon-sc0000007-1575043694:1404419..1404748TCONS_00001076-exon-sc0000007-1575043694:1404419..1404748Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:1401407..1404748 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.253495 0.116681 0.575856 0.92078 0.0621549 0.0736734 0.0444419 0.0970807 0.116517 0.0841899 0.0116738 0.115109 0.694853 0.701158 0.111228 0.0445425 0.846996 0.960777 2.89929 2.79285 5.0308 5.03559 0.0905768 0.332649 0.300935 1.50778 0.0751111 0.0304244 0.0511563 0.056319
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
TermDefinition
IPR000203GPS
IPR000832GPCR_2_secretin-like
IPR017981GPCR_2-like
Vocabulary: Cellular Component
TermDefinition
GO:0016021integral component of membrane
Vocabulary: Molecular Function
TermDefinition
GO:0004930G-protein coupled receptor activity
GO:0004888transmembrane signaling receptor activity
Vocabulary: Biological Process
TermDefinition
GO:0007186G-protein coupled receptor signaling pathway
GO:0007166cell surface receptor signaling pathway
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0007166 cell surface receptor signaling pathway
biological_process GO:0007186 G-protein coupled receptor signaling pathway
cellular_component GO:0016021 integral component of membrane
molecular_function GO:0004930 G-protein coupled receptor activity
molecular_function GO:0004888 transmembrane signaling receptor activity
Blast
BLAST of TCONS_00001076 vs. Swiss-Prot (Human)
Match: AGRL3 (Adhesion G protein-coupled receptor L3 OS=Homo sapiens GN=ADGRL3 PE=1 SV=2)

HSP 1 Score: 92.0485 bits (227), Expect = 1.270e-18
Identity = 106/460 (23.04%), Postives = 179/460 (38.91%), Query Frame = -2
Query: 1098 TNH--VINSIVVTFDIEPAMAEL-----PTYNTIAFTHKDRKMVNPICVYWQPLNAGKEGADPEAGYWTNYHMKILKTNKSMTVCKAYTFGSFAVLMEPYVPKNNSQPLDVTEXXXXXXXXXXXXLQLVYLAGMFSLKC-----------HKNSANRLYIYANL--SLFMMQVLIVFSFRHRDDWEKCAIYTGWIQFFFINILSWLMMESVHRLSNLLHFFHKDTNRDFLYHIVGLGIPLSNMIAMQGFPYDEYSSLRICWVYANDLRLWYFINPITAIICASFLIKFITFKKYQGQDKFLENDFNYQQAQLSVFATGAILPTLLIGWT----LMSVSVRTEAKLQNFLLIAASIAQVCLGLQVLYFYFY----------------RNHWVVEAMTEEK--RIKEKKKLTTLSFLKGLPIRIRYKDNPYDAMEEKSEDSY-EMRYTSSSSLGDEIMLDES 2348
            TNH  ++NS V+T  I    +       P   T+    +  +  NP C +W              GYW+    ++L TNK+ T C      +FAVLM     K++    D+             L  + ++  + SL C               ++R  I+ NL  SLF+ ++L +      D    CA++   + FFF+   +W+ +E V     L+  F  + +R   +++VG G+P   +       Y  Y + ++CW+  +   +W FI P T II  + +   I   K       L+ +       +  +  GAI    L+G T    LM ++  T        +I A +  +   LQ ++ + +                R H      TE      K     T   +  G   RIR   N  D + ++SE S+      SS+SL  E +L+ +
Sbjct:  758 TNHSVIVNSPVITAAINKEFSNKVYLADPVVFTVKHIKQSEENFNPNCSFW------SYSKRTMTGYWSTQGCRLLTTNKTHTTCSCNHLTNFAVLMAHVEVKHSDAVHDL------------LLDVITWVGILLSLVCLLICIFTFCFFRGLQSDRNTIHKNLCISLFVAELLFLIGINRTDQPIACAVFAALLHFFFLAAFTWMFLEGVQLYIMLVEVFESEHSRRKYFYLVGYGMPALIVAVSAAVDYRSYGTDKVCWLRLDTYFIWSFIGPATLIIMLNVIFLGIALYKMFHHTAILKPESGCLD-NIKSWVIGAIALLCLLGLTWAFGLMYINEST--------VIMAYLFTIFNSLQGMFIFIFHCVLQKKVRKEYGKCLRTHCCSGKSTESSIGSGKTSGSRTPGRYSTGSQSRIRRMWN--DTVRKQSESSFITGDINSSASLNREGLLNNA 1188          
The following BLAST results are available for this feature:
BLAST of TCONS_00001076 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
AGRL31.270e-1823.04Adhesion G protein-coupled receptor L3 OS=Homo sap... [more]
back to top