Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001063 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001063
Unique NameTCONS_00001063
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1200

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001063 ID=TCONS_00001063|Name=TCONS_00001063|organism=Clytia hemisphaerica|type=transcript|length=1200bp
TCCACTGGTTTTCTCAATAACACAACGCCCAATCCTTTGGACGCTGTGTT
AGGCCCTCAACCCACTCCAAAAACGACGACCTTGAAAACGAATCCTCCAC
ACATGTATCCTTCATCTCAAGTAAAGCAGGACAATCTTGTTACAGATACA
CCTTTTTCAAGAAAGCCTCTCGCATCTACAACAACTACGACCAAATCTGT
CCCTTTGATAAAAGACATGGCTGAAAGGCCATCTACAACGACCACTACAT
CAAGTACGACATTCATGAGATCAGCAATGAGCACTATCAAACCAGCAACA
TCAACTAAAACTTCCACAGTAGTGACACCTGTTCCAACAATAATGGAATT
TTTACAAACGAACCAATCAACAACAGATTTACCATTGACCAcTCCAAAGA
AGACGCATATTCACACGAAAACACCAAAGAACGTAACCAAGTCATCTTCA
AAGGGGGTCATTGAGGCAGGAAGTGGAATTTCTCATTCTGATAACATCTC
TTTAACTGGTGCAGTTTTCTTTGGACTTGCTTTTTCCTTTGTGACCATTT
ATTTAGTTGGTAAACGGTGGATAGAAGGACTTCGAGAATCTAAAGGCAGG
CGTGGTTACACTCGTATTTCCTATCTTCTAAATGGAGTTTGAGTTTCGAT
ATTCGTTTGAATATATTAGGTTTGATAAGTTAGGGTTCGTAGATTTCGAT
ATTCGTTTTTGAGTATCTGTTTTTTGGATATTTATCGACGTTTGTAAATA
TAAGTTATTTTGGAGTAAAATGCAATAAGTTCTCATCAAATTACATCACA
AATGTTTTCAAGGAACAAAATTTTGACACCCTGACTTCTTTATTCGTTCT
CAGTTAATACACTATTTTTGGAGACtctaaaaaaaactttcctGATTATT
TGACTTAATTAGGTTTGCTTCTCCGTTCTAGATGTTATATTTTGATGATT
GTTATCTATAATCATTcttaaaatatttaatttttggttgtacatgtttt
tttttaccttgCTTTATTTATTTCACTTGATGATTCACTTGAAAAAGGGA
TAATTTCGTAATATTAGCGTCTTATATACATTATTcacatcatttttgaa
attatgcatTTTTAAGAATGATATTTTGTACAACttgataaaaaatatga
aagagcttgaatttaaaagaagaatttttcctTCTCATATTCATCTAATT
Run BLAST on NCBI

transcript from alignment at sc0000007:1254222..1256195+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001063 ID=TCONS_00001063|Name=TCONS_00001063|organism=Clytia hemisphaerica|type=transcript|length=1974bp|location=Sequence derived from alignment at sc0000007:1254222..1256195+ (Clytia hemisphaerica)
TCCACTGGTTTTCTCAATAACACAACGCCCAGTAAGTCCACTGGTTTTCT CAGTATCTCATCTCAATTAATATTCTTATGCCATATTCGATCATATTTTA ACCATTCTTATTTCTCGTTGCCTATTCACGCCTAAAAATTAGAGATTTCA ATTCTCTTGAAACAAATCTTAAAAAGACCTATTCATATATCTTTTTTAAT AGGCATAATTTTTAATGTCTTTTTATTTCAGATCCTTTGGACGCTGTGTT AGGCCCTCAACCCACTCCAAAAACGACGACCTTGAAAACGAATCCTCCAC ACATGTATCCTTCATCTCAAGTAAAGCAGGACAATCTTGTTACAGATACA CCTTTTTCAAGAAAGCCTCTCGCATCTACAACAACTACGACCAAATCTGT CCCTTTGATAAAAGACATGGCTGAAAGGCCATCTACAACGACCACTACAT CAAGTACGACATTCATGAGATCAGCAATGAGCACTATCAAACCAGCAACA TCAACTAAAACTTCCACAGTAGTGACACCTGTTGTGagttttataatatt ttttctaatcCACGATACACATCTCGCATGATTACTCCTTTTTTCCTATC AGAACCATATAGACCAGCAAGCATGACCTGTATAGACCGCAAAACTGGAA TTAATTTCTATTAGaggtgaaatttatgacttttaTCTTTTGAAATCATC TGCAGATCGTCCAAAAACTGAAAGCCTTAGAAATCGCCAAAATAGTTAAA TATATAAGTTGATATATTCAAAGTCTTTTAATGTctattttgattaaatt ttaaAGTACACCTTTTCTTCTACTTTCCAGCCAACAATAATGGAATTTTT ACAAACGAACCAATCAACAACAGATTTACCATTGACCAGTATGTTTTCTT TCTCATGCTCTCTTTTCTCCATTTACCTTTAAAACTTTCATGGGCTCCCT CTTGTTTGCGAATCAGTCAGGCTTGATTTATTGATGTTTTGGTTGGTTGA ATATATTTGAAATAAGTTGATGTTTTCGTGATAAATTTTGTCTTCGTCAA GCATTAAAGTAAATTTCCAATGTCACGAGACTCGTCATTAGAGACTTCAA AGGCTAAGAATACGttcaaggttaaaaaaaacTCTAATATTCACAGccaa tgttttttgttttagcTCCAAAGAAGACGCATATTCACACGAAAACACCA AAGAACGTAACCAAGTCATCTTCAAAGGGGGTCATTGAGGCAGGAAGTGG AATTTCTCATTCTGATAACATCTCTTTAACTGGTGCAGTTTTCTTTGGAC TTGCTTTTTCCTTTGTGACCATTTATTTAGTTGGTAAACGGTGGATAGAA GGACTTCGAGAATCTAAAGGCAGGCGTGGTTACACTCGTATTTCCTATCT TCTAAATGGAGTTTGAGTTTCGATATTCGTTTGAATATATTAGGTTTGAT AAGTTAGGGTTCGTAGATTTCGATATTCGTTTTTGAGTATCTGTTTTTTG GATATTTATCGACGTTTGTAAATATAAGTTATTTTGGAGTAAAATGCAAT AAGTTCTCATCAAATTACATCACAAATGTTTTCAAGGAACAAAATTTTGA CACCCTGACTTCTTTATTCGTTCTCAGTTAATACACTATTTTTGGAGACt ctaaaaaaaactttcctGATTATTTGACTTAATTAGGTTTGCTTCTCCGT TCTAGATGTTATATTTTGATGATTGTTATCTATAATCATTcttaaaatat ttaatttttggttgtacatgtttttttttaccttgCTTTATTTATTTCAC TTGATGATTCACTTGAAAAAGGGATAATTTCGTAATATTAGCGTCTTATA TACATTATTcacatcatttttgaaattatgcatTTTTAAGAATGATATTT TGTACAACttgataaaaaatatgaaagagcttgaatttaaaagaagaatt tttcctTCTCATATTCATCTAATT
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000602XLOC_000602Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001063-exon-sc0000007-1491911889:1254222..1254252TCONS_00001063-exon-sc0000007-1491911889:1254222..1254252Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1510915933:1254222..1254252TCONS_00001063-exon-sc0000007-1510915933:1254222..1254252Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1575043694:1254222..1254252TCONS_00001063-exon-sc0000007-1575043694:1254222..1254252Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1491911889:1254453..1254754TCONS_00001063-exon-sc0000007-1491911889:1254453..1254754Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1510915933:1254453..1254754TCONS_00001063-exon-sc0000007-1510915933:1254453..1254754Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1575043694:1254453..1254754TCONS_00001063-exon-sc0000007-1575043694:1254453..1254754Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1491911889:1255052..1255109TCONS_00001063-exon-sc0000007-1491911889:1255052..1255109Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1510915933:1255052..1255109TCONS_00001063-exon-sc0000007-1510915933:1255052..1255109Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1575043694:1255052..1255109TCONS_00001063-exon-sc0000007-1575043694:1255052..1255109Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1491911889:1255387..1256195TCONS_00001063-exon-sc0000007-1491911889:1255387..1256195Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1510915933:1255387..1256195TCONS_00001063-exon-sc0000007-1510915933:1255387..1256195Clytia hemisphaericaexon
TCONS_00001063-exon-sc0000007-1575043694:1255387..1256195TCONS_00001063-exon-sc0000007-1575043694:1255387..1256195Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:1254222..1256195 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
14.3092 10.1531 8.2532 3.47404 5.67034 5.98576 7.52159 2.62779 5.11303 7.38395 2.75027 5.34119 1.65346 0.957881 0.67357 2.81923 1.39552 3.28294 0 2.76746 5.22687 0.739534 7.7434 8.41084 4.32632 2.61126 4.27977 1.09888 5.74648 5.52515
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001063 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top