Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001052 (transcript) - C. hemisphaerica

Unique NameTCONS_00001052
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2138

The following sequences are available for this feature:

transcript sequence

>TCONS_00001052 ID=TCONS_00001052|Name=TCONS_00001052|organism=Clytia hemisphaerica|type=transcript|length=2138bp

transcript from alignment at sc0000007:1027363..1041137+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001052 ID=TCONS_00001052|Name=TCONS_00001052|organism=Clytia hemisphaerica|type=transcript|length=13775bp|location=Sequence derived from alignment at sc0000007:1027363..1041137+ (Clytia hemisphaerica)
GTTTGAGCGCGAAAAGGGTGGTAAACAAAGATTGACTTTCGATTTCAACA CCAAAACACACAGGACGCTAGTTTAGTGTGAAACATCCAAACGAATTTGT CAGTTTTGTCATTAATAGTTTTATGATATGGATTTTTCCAAAGCAAAAGG AAGATCTCGTAGAAGAAACAAAATAGACGATGGTCATCTTTACACAAATT TTCCGAATCCATTGATGATGTACAACAAGGAACCTCCGAGGGGAGATATC GCTCTGGAAGAATTTGAAACTTATGCGGTTGATCGCctgaaatgtaaaaa attgtattttcactaacagtttattattttttttattatcttaaTCTTGC CATGAAAgctctttttgaaaaactgaaGATCCCTGACCATGATATGGATT TTTccaaagtgaaaaaaagatcgaccgtcaactgctccaacttaaGGCCG AAGTAAGTTACATGTGAGTTTACCGTCGTCAACTTACCCgaaaatagatg cggcatgatttcattattcattattcattattttcccaacagcaccttat ccaccNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNAGGCAGATAGATGGGCGTGACGCCCGCT GTagttgtaggattgagggcggtcacattttctgtaaaaaatcttctttg tttacccgtgTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTTAtcgaaataat gaaattttcatgcgggtgctttttagagatgcgggcggccgacggtaaac tcacATGTGACTTTCATCGgcctaatagacctttttttaaagaggcaacc ctgttgaataattatgtagtccagcataaaaataatgatacagccatgca taattactgtttcatgcatattataataattatattatgcatggctatat cattgtttttttgctggatggactacataattattcaacagggagGGTGG cctcatttaaaaaaaggtctatggctTGGGACTATCTGgcgcaacatggg acggccattccaccaccatttcaccgaacctcaaaagtcatttgatttga ttttaatgaaccgcgtattaaaaaatacacgatttctacGACCCTCGgca aaaaacttttattggaattcgcgtaaagcccgagtatggcccgagctggc ccgagaattcgggccgtgttctggccacgcacgggccacactcgggccaa tttttgaaaacatgatataaacaggcgtgtaatttcaggactgaattttt ttaacattttctttgagaaaaacttggttttaattatattaaatatatga atgttatgtatgacaaaacagacaaatcttgttttgtactattttgtttg actggacatgctgaatcaatttaacatttaacatggcccgaacatggccc cgaatgactcgggtcatgttcaggccaaaagaattgatagggtctctcgg cccgaacatggcccgaagaggcccgaacatggcccgaagaggcccgagaa ttctcgggccatgtcgagggtcgtcgatttctttttcgtaacgagtaggc ttttaagtcgaaataagaaaaaatctgtagtggaacacgcgCAAGTGTCT GAAACAAAGAAGctaaaattagtggcaaaacgatggagcattTGATATCA CTCGTGCGGCAAGTTGCACACTTGTtatatttgttaatcccatcaggtGA TAAGCTGTTaggcagtctaaacttaaactcctaaatcaggattagaaact aggctagtcttacctcttttatcttttcctttataacaatacaatgctga caagttgacacaacacatgtgtacatgtacattgacaagtaatccttGAG ACAGTGTaaacctaactcttcatacaaaaattacgggaaacgcatatttg gactttgtaccctatgctgcactcaagcacttgagccgaaatcccgcaaa ggcgggacaaaaatcagttttttgaagtttgcaaaaaaacgccaaaagtt aagggataatgataattgaatactatccattgatgatccacggcactatc gtaaagctagaatcgcttcgcgtactcttcacttgagaaaatgattgaca gattgaagttttacATCTTGTTTTACATCCTGCGGTGCGCGCCAcgcggg agctcgggcgctctgcgagagttctcggctcaatcctcagaccgtgctaa aaatggtagactgagctgtgatagatcatttcgatggaagttgcaTGGCT CCaaatggggttctaggtccccccaacaaatttaggtcccccctaagttT TATGTgcccccacttttcagtaagcttcaggtcccagttgaaatctTTGT ACCACCCCCTCTCGCACgcagataaaaataaaacggtagaatatttagaa acaaaacattaaaaccaaacaaaaaattatttttacaatttcttaattAG TGTAGTTAGCCCCCAGAACTTTAGTGCAGCCCTtcaggtccccccacttt tttagaccccccccctaaatttgaaaaatgagacagctcccacccacttt tagaccgattttagatttacacccccccccaaataagtgggggggggggg ggaaattaaaaaaaggccaaaaagggggggggggggggccccaggggtgt tggaatgtttacaaggcttttgacagaatattgtttgttttattgtcaat gatgacagtgccgttataaattttgttagatctgacaaattaaTGTATGT AAGTgctctttatagttttgattcccattgaagaatcatattcaggtttt catgttattagatgctgttttagagctttagagctacactgtgagagaag tttttatagaaatctgcaacaaaacaaataaaagtggtctcttctactga ttgcttcccagcgctcctttgcagctgtttatcaaatttcctgcaatgag gttgccgcatttcaaacggcccttctttttggcacccgtggcctttcagt gccttgcacgacaagcggctgtaaaatcccacccagGGATGTGGTGATTG TTATAAACACTTTATGTAACCTCAATGAACAGTAACTcgaatatgaaaat aaaatgttcttTCACCCGCTCACCATCTTTTTCAACTCACCATCACATGT ATTTGTTCAAATCTATTTGACACATATTGAGTTTTTTTATATCCTTGTTG ATGtcataaatcaaaacaaagtttcaaTGACAGAATGTGTAGCCTTTGCA CAAATTGCTTACATTCAGGTTGGTACAGGCTAGCTCGACAAAGCATTTTT GCACTTTTACACTCTATTTGTCACAGAATTTAGTGTTTATGTCAACTGTC AGTGCTGAAACTTTTTATACCTAAACCAGTGGGTGAACAGGGCTGTCCTA ATTATTGTACGTTTATTACTTACAGTGTTACGTGAAGTGGAAAATATCAA CATCAGATTCAAGAAGAATAGTCCTGATCACTacactaaaatgaaaaaag ccCTCGTAGATTTTAGTCCCAATTATTTTgaggtaaacttttttttgtat ttttgctgGTTATAAATTTAACACCATTTCTACtcttaattcactttttt taatagTCTTTGAAAAAGCACATaagtgtaaaaaatcattgaaggcGTCT CCTTCAATTTAAATCAACCATTGCCAAATAGCTGATAACATAATTTGTCA ATCAATAACAttagataaagaaaaataattaactCCTTCAAGCTTCAAGT TTGAGTAATTTTATAAACtttattaaaaatgtttattatattttttcttt attgctaGAAAACAAACCCTGCGGATAGTAAAGAGTTTGAATTCAAAGCa gacaaagaaaagaaagagaagGAGATGAGAATCAAACTTggggaagaaag aagaaaagattaTGTTTCTCATTTCATTCTTCGCTTAGCTTTTGCTAGAA GGTATTTTGTAATTGATTTTATGAATAGCCACGGTTACTAGTTTCCAGCC CcaataaatttcaaaagctaATCAACTTGACAAGCAGCCTGATAAATAGC TTGTGTCTTGATTGATAAAAAGGTGACCATTTCGTGATTTTGAAACAGAA CAAATCATAGCAATTGAATTCTACTTTTCTTAATCTTCTCTTTTCATACT ATTTCAGTGAAGACCTAAGGCGGTGGTTTTTGACCCAAGAATTGGAATTG TTTAGGTATGTGATTTTGCTAAGAATTAAACCTTAGAATCTTGAATTTTT AGATCCTTCAGTAAGAATAATTGAGGATAAGAACAGTTCTTTTTCAATCC TATTGAattgtttttctcaaaaagacGCAAATCATTCTTTTAGATTCAAA TTTACAGAGCTGAAACAACATATTCAAAGCTTCCTTCAAGAAAATCAGCT CGAGTATAAACCAGTGAGTAAACATGAATGgagttttctttgtatttgat AAGAGATGTTATTAAGGAATTTCATGTATATTTACTAAATTTTGTGAATC CTTTTTCAGATTGATGATACAGAGAAAAACAAACTTGCCAATAAACTCAA AGCAGCAATGTTCAATGCAAAAGAAGTCAATTTTccggaaatgaaatttt ataaaGTACCTTTCACAAGTGTGTTGGATTTGGTTCGCTCCAGGAAGGTC TACCTAGAGAAGGTATGCTAATTTTGGTTCTTTGATTTgtgtatttcatt ttcaaattatttgacCTACTTACCATTGAGACTGAGATTTCGTTCTCTTA AAGGGTTTCGTTTTGCATTTCTAGGGCGAGGCTTATGTTCCTGAAACAGA ATTAGTTTCCATCATTCTGGGAATCTATCGTACGCATTTATCGCAAGCAC TTGCTGTAAGTAAATTAATCCATGTTGAAACTAAATCTTTCTTTCATTGC AAGGGATTACATATctgcttttttttctttgctatGCTAAACCAGACTAT TTTCGATTGATTTTTTAGTTAACGGCAAAGAAACTACCATATATCGAAGA GGATACAAGACTGCTACCAATGCTGAAAAATTTGAGGTAATTCTTTAAAT ATATAACAAAACGTCATTTGTCCTTTCCCTGTACGTTACTTCTCAAACTT TATGTTTTCTGATCCTAGCTCTGCATACATCGGAGATAGCTACAcctcga aaaaagaaaatgCAGATGATAAACTGAGCTTAGCCAACATGGAAGAGGTA TACATACTTTAATTCTTTTGTATAAATTATTTatcaatttataaaaaaat tgtgtgtCATCATGGtagaggagtgaaatgtagagatgacaattcttcag gaaaaagcGGGACATCCACAAAGAATAGCGcatctctttgtttttatcat attaaaaaaataataagacaaTTCTAAATTGCTTACGAATTAAATATGTA AAACGACGTCcacactttttaacagtaacgacgactcgaatgtttttatg tgaAGAAAGAGGTGGACTAATTCTCACATTCTccttttgctttttatcgc cctttgaagGCTGTTGTTGTCgacaaacttttgatttttatgttttgatt tttatgttatgATTTTACATTTGAAaggattttgttttgttttgaaaaga attcgaatgtcattaatatatacgatcgttaaatacattcgaaaacattt aaaacaaaagaaaagagaaaaacagcgTCGGGCAtgtctgggcagaaatt aaaattacttaatgtagatgggccttaaatttcaaaacaaaggatgaata aagtctaaaccaggctctatccgatctgtcaatcaaaacaaacttatcga gaacaaaaaaatatattgctggcgaaaacgaaagtgacacacaaaaaaca aacagacatacagactacggctattaatatatagatatggAGGATCTTCT TCGATTCTTCTTCATCGCAGTTGTTCTCAGAAGtataaaaaagtatttct acTTTTCTACCAGGATGTTGTAAAATCTTACCCGATCTGCATGCGAAATT TACACGAAGGTCTACGCAAAGACCATCATTTGAAACATTGGGGTCGTCTG CAGTATGGCTTGTTcataaaggtttgttttttggacctaccccggtgggg tggaggtcctataaattaacccgtgttcgttagttagttagttcgttcgt tagttaccaacttttctcgagaNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgatatataaatcgaaattta aaattatacattacttccattaaattctaattattcgttttataaatagg taggtccattaaagtattacttgtttatTTGTGTAATAATAATGATTAAA AATATAAGATCGAAGAAgaagagtctgctaaatcgcgtgccacgcgtgcc agcgtgccatcggTTTTTAAGCGTGTCAGCGTGCCATGCGTGcctgcgtg ccaacgtgccttggcgtgccagcgtgccaacgcgctttggcgtgccaacg tgccagcgtgccatccaaattcgGCGTGCCATtaaaatttcggcgtgcca ttttcggcgtgccatccgaatttcggcgtgccatccttattccggcgtgc catccgaattttggcgtgccatccaaattttggcgtgacATCCATGCGCT GAtaattgtttttgaaacaagagccgcaaagatgcggataaatatttcct ttacaaatgttaaaataataattgtcctcaaaagatttcaaagtgcttta aatctcagataacacaaagcaacacaagtccctaagaatttcaaaattcc atttatgtaattgccagtatttacaggattattcataagatgactgtagg ttcaaagctacggatcNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNgactgagaacaacaatgcagtaatcaaattggctggaactt taattttcgttaggtggactttaaatggattttagtattatactagcggt cacccggcgtcgaACCGCCAattagagtgttgttgaacacatcaaaagac ctgataGTGCATAATTTAATAAttatatcattattattttaagcgctgat ttccagaaatattatatagccaaaaagggcaaatatctaaaatgaaagaa tgacaaaaaggagaatatttcacagtaagaaaaccaaaggaaattttata tattttcaaaatgagatgaaatattttgcattatacttataccgggtgac ccacgaaaaagttcagacgtttcccgacgtcttgaggccgaaaaaatgtc ccaaagtgcttggagttttgatatttagaaagNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgagcttttaaagtcaa aattcactttgcggaaagtgtaaaaaacacgtaaaaaaggggtatcaaat ttggtatttttagacgtttttgatgtacagtttttgaaaaacatttatga aagcgccaatttttataaaaactagtcttgttttaaacaaaaactacttt caaaggtttttttattaattattaatgtcataaaactcgttaaataagtc aattcgtaagtgattttctaattgattgcatgaatttaatacctcttttt tacgtgttttttgcacttttcgaaaagtgaattttgacttaaaagctcat aagtagagaacaagttggtcaaatttaaaaagtgatggctcaaattttaa gttaggatatctactttctaaatatcaaaactccaagcactttgggacat ttgttcggcctcaagacgtcgggaaacgtctgaactttttcgtgggtcac ccggtacattatactataaaaaatgtaaaaatttaaagtaacttttgctt tggagttttttgaaatactgtacgtgccaaaaagtaaaaatctttcaaaa cagggaaacaatttcataatttccgacagaatgcaaaaaaaaagaagaaa agaatctcatttttatatatatatactgggaaacatttcataatctgaaa gaatgtcgataggaaaaaattccccttacagaagccattttatgatttcc aaaagcatgctgcaaaaagtcacatacttggaaacaatcataatttccaa aaaaatgtcagaaaataaaataaattgtcatgccaggaaatcacttgagt tttgttcattttttaaatgcatgtggaaggaAATGTCTatttcatgacaa aagttttccacgttttgaaagcacgtgtaagaaaatctccaaatttatca caaaagtttccacgttttaaatgcacatactgtcaactgctctaacttgg gacgattggtcgaaacatgggactgtttgatatctggcctgtattttcag gagtttatcaatcatacttcctgtcataacatgtcacgataactttcaat gatagcgcgcccttttaacttttttgttttcattcaaaatcaccggacgc cgattggagaattagtgAACGctcgccgcctaaccgcctaaccgcctatt tcccgatgggattaacaaataatgagtgtgtaacttgccgcgcgagtgac ttGACGcgccactaatttgttcttcttcgttcttgacactcgcgtgtgtt ccactacagatttttctatatttcgatttaaaagcctgcGCAGAGGGAAA GAgaaatcttgttttttttaatacgccgttcattaactcaaatcaaatga ctttggaggttcggtgaaatggtggccaaattgccgtcccatgttttgtc agatagtcccaagttggagcagtttacggtaagaaaatctccaaattcac gacaaaagtttccacgtttgaAACGCACGTGGCAAAAGATCcctaaattc acaactaaagttttccacgttttaaatgcacgcggggaagaaaatctcca agttcaagaaaaattttaattgtacattTGAGGtgattttcaattattta catccatattcaatgcaataaaccttttcagaaatataacataacattct tcatattggcgCCGTGGTGttccggttatcagctttaaaatttgaaattt ataaccgcaacaTAATTTTCCTCACAAAGAGTTTTCACTAATTGTCACTa accagttaattcattgttgtagataaaaacaccaagggaaattcaatcat taaccagtcagtTTTTCTCCATGTTTGAATTTTTAGctaatcagttcatc aaccattcccattgcATTGTTGCATTTTGTCGCATTGCATTGCATTggtt gggtgcaaacttttttgatgttgcgCAAGTatatatgtaatttttcaggt ataacatggtcagatttattcacagtcacttgccttcttacaatttatgt aaatatacaagcaaaattgaagttagtttgttgtgaaagtcgataaaatg tcctgtttttccaagaccaagaccaagagattgtatctctcattccaaac caacagaatgtaaaagaaacatcaaatccagaaaggaacAATAAGAAAAG TTCACCATCGACtattccttgtgacaatcgtacaaaaatcatgatccaat tcaactcattaaagcataaaaaccaaagcaaagaaaagtagcgaaagagc aaggagaatagagcgccgtacggatattttccacagacgtttctcgaaga aatgacgtcttccgcctcgaaaaaagaacatcctactgtttttaccgccg gagcttgatttaaaaagagactcatgtacaaactcacgaaaatGACTTTT TCTAAACCTTGGAAAAGAATAAGAAGGAGGAAAATGCGGAGAAAAAACGC CCGTTTTAACAAACATTTCCTTctcaaaggaaatatttaaaaaaaacctg gGTAAAAGAATAATAATTGTAGAGAGCTAGCTAAAGAGAACGAGAGAACG TCTATGatattttaaatcaattttttataatcacaaaagaaaaacttaga TTATGTGATTActgtaaatgcataattagaataactAACATAAATTATGC ATGGGTCGcgcatcgtgcatcgtgaatcgttggatcgcgcatcgcgAATT ACACAAACCCCAATATTTATCTATCTATTtatcaaaggcatctcattcgg tacaattgaaatatttggtgtaataaagctTGCAGGTAACCCACTTAATT GTCATGtcaataattttgtcaaaaagtgtcactttgtcaagaaaatgaca ggTAGACTACTGCCTTTCGCGTGGAAGAAACACGTGTATCtccttcaaaa cttttaaagttatgtaatgttctgttcatataaaaatgaaaataataaaa taataataaaagtgctactattttcatatctctaatgTTTTCACTGCATG ACAATCTATATCCATTTGCACcgccagcatcctattgagcatgagaaaac atcttgttgtaaattggtgtatacACCTCATATTTTGTGATAATGCCATT ATTTACATAATTTAAGTGTCATTACATAAAATAATCTTGAAAATGCTTTC CCGCTaattttgagggggtccatattggggtccatattTGGGGGGTCCAA GTTGTGTCATCTTCTCCCCCAAGCTTTACCGAAGTTGTGGTGAAAATTCG GAcgagcacgccgaaattcggatggcacgccgaaattcgaatggcacgcc aaaattcggatagcacgccgaaattcggatggcacgccaaaattcggatg gtacgccaaatttggatggcacgctggcacgttggcacgccaacGCACAT TGGCAcgtaggcacgctggcacgcataGTACGCTGGCAAgcgtggcacgc gatttagcagactcgaaGAAGAAGGACCCATGAAGtagtttttcaaagat tatCTTGTACCTCCAGCATGGTGTAGTTTAACTGAGGCTGAGCATTAATg ctgaaatttcaatttttctattaAACATGAaagcttttatttgaaatcaa taTGATGTTACATTGTAAATTTGTGATTACATATAGGCCGCTGGTTTAAG TTTGGAAGAAGCACTGTTATTTTGGAGATCAGAATTCACAAAGAAAATGG ACCTTGATAAGTTCGAGAAGCAATACGCATACAATGTGAGACACAGTTAC GGGAAAGAAGGCAAGAGAGCTGACTACACTCCATACAGTTGTATGAAAAT CATCACCACAAATCAACCAGGACCTGGAGATTTCCATGGATGTCCCTTCA AACATAGCGATAATGATATTCTTAAAAGAAGATTACAAAATTACAAGATT CCCAATGATAGCATCAAAGAGGTTGGTCTTTATTGGTTTAAATGAAAAGG ATTGGAATAATTTGCATGTTGGAAAGTCATTGAAAATTCGTTCTAGTCTT AGAATGACGATGACAATatgttaaatgatttttttgtatttcttaTTTCA TAGATTTTGGACCTTGCGAAGCAACAACACTACCAAATAGCATGttccag atattttgaagtAACTCATAAGGTCAGTTGATTGCCTGCTTCCTTATCAA TTGCCTGTTCGTTCTTAACAACTTTCTACCGTCCTGAATCTTCATCCATC ATCCATTGAATTTCTTTACTTTCCAGCTTCCGAACGGCGTGACTATGATA AATCATCCCaatcaatattttgatgaaagcAAAAAGTTCTTGTCTGGGGA GAAAAGGTAAGCCTTTCAAGCTCTATTAAAGTAATCCAGTTATTGAAACT AATCTTACGTACCTATTAAACggaggggttggaataagcggggtgggtgg aaattttttgaaagaggaggctaatacagcagaattagggcataGGGcat aactttcaaaaacatttttttcccaaaaattaataaacgggggggggggg gttaaacttTAAAATTCACGTTACAATAataaccgtttttttttttccca aaaaaaaaaaaaggggggggggggggggttgaattTAGGCTGTCCGCTTA ATATAATGACGCTTATTAGGTTCCCGAAAGTACTAAGAAATATACGCTGT CAAATCAAAGTATGTCTATCCTCGAAAAGACTTGCATGTTGTCTAACTCT AATTAATAATCTGGTACTCGTTTTACATTAAGATTTTCAATTCTCTTCCA GTTTCACGAACATTTTGAAAGAAGAGAAAGTGATGGTGAAAACGGAAGTG AAAGCGGAACCACCCCCGCCTCCGCAAGAAGCGATGGATGTGAACTTCGA CGAAGATATGGAAATGTGCTGAACCCATAATTTAGAAACAATATGTTATG TTTTAACCATTTCCACTCAAGTTCTCTTGAGCAAATTTTTTAActacttt tataaaaaaatcacaataatgattttgaaaattccgCATAATGAAAATGG TGCTTCCATATATAACATTTTTTCTTGGCAAAATAAGGTTTGAAATATAG GTTCAGAAAGTATCTTTTAGATATGAGCGAACGTTTTATAGCCGTTTTAA GAGGCCCTATTATTTCTACAACGGCCGTAAAATCCGCTAAGATTATATCT AAAAATAAATTACAAATTTTAGTAAGAAAtgattttttggtaaatttttg ttgACAAAAGTCTTTGTAAGTAATTGTTTTAGATTTCCTCTGTTTTAGCT TTTTATTGTTGCTTAATGATGATGATTTTATGTAATGTAAATATAACCCT ATAAAAAATTGGAATATCATTGAGCTTTTTCAGTGAAACATAATCGAACC TAATTACCGGAGCAGAAAGGCCCCC
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000596XLOC_000596Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001052-exon-sc0000007-1491911889:1027363..1027655TCONS_00001052-exon-sc0000007-1491911889:1027363..1027655Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1027363..1027655TCONS_00001052-exon-sc0000007-1510915933:1027363..1027655Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1027363..1027655TCONS_00001052-exon-sc0000007-1575043694:1027363..1027655Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1031488..1031594TCONS_00001052-exon-sc0000007-1491911889:1031488..1031594Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1031488..1031594TCONS_00001052-exon-sc0000007-1510915933:1031488..1031594Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1031488..1031594TCONS_00001052-exon-sc0000007-1575043694:1031488..1031594Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1031871..1032013TCONS_00001052-exon-sc0000007-1491911889:1031871..1032013Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1031871..1032013TCONS_00001052-exon-sc0000007-1510915933:1031871..1032013Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1031871..1032013TCONS_00001052-exon-sc0000007-1575043694:1031871..1032013Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1032220..1032267TCONS_00001052-exon-sc0000007-1491911889:1032220..1032267Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1032220..1032267TCONS_00001052-exon-sc0000007-1510915933:1032220..1032267Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1032220..1032267TCONS_00001052-exon-sc0000007-1575043694:1032220..1032267Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1032572..1032724TCONS_00001052-exon-sc0000007-1491911889:1032572..1032724Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1032572..1032724TCONS_00001052-exon-sc0000007-1510915933:1032572..1032724Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1032572..1032724TCONS_00001052-exon-sc0000007-1575043694:1032572..1032724Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1032837..1032917TCONS_00001052-exon-sc0000007-1491911889:1032837..1032917Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1032837..1032917TCONS_00001052-exon-sc0000007-1510915933:1032837..1032917Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1032837..1032917TCONS_00001052-exon-sc0000007-1575043694:1032837..1032917Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1033031..1033098TCONS_00001052-exon-sc0000007-1491911889:1033031..1033098Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1033031..1033098TCONS_00001052-exon-sc0000007-1510915933:1033031..1033098Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1033031..1033098TCONS_00001052-exon-sc0000007-1575043694:1033031..1033098Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1033181..1033259TCONS_00001052-exon-sc0000007-1491911889:1033181..1033259Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1033181..1033259TCONS_00001052-exon-sc0000007-1510915933:1033181..1033259Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1033181..1033259TCONS_00001052-exon-sc0000007-1575043694:1033181..1033259Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1034026..1034133TCONS_00001052-exon-sc0000007-1491911889:1034026..1034133Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1034026..1034133TCONS_00001052-exon-sc0000007-1510915933:1034026..1034133Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1034026..1034133TCONS_00001052-exon-sc0000007-1575043694:1034026..1034133Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1039399..1039683TCONS_00001052-exon-sc0000007-1491911889:1039399..1039683Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1039399..1039683TCONS_00001052-exon-sc0000007-1510915933:1039399..1039683Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1039399..1039683TCONS_00001052-exon-sc0000007-1575043694:1039399..1039683Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1039816..1039884TCONS_00001052-exon-sc0000007-1491911889:1039816..1039884Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1039816..1039884TCONS_00001052-exon-sc0000007-1510915933:1039816..1039884Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1039816..1039884TCONS_00001052-exon-sc0000007-1575043694:1039816..1039884Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1039989..1040068TCONS_00001052-exon-sc0000007-1491911889:1039989..1040068Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1039989..1040068TCONS_00001052-exon-sc0000007-1510915933:1039989..1040068Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1039989..1040068TCONS_00001052-exon-sc0000007-1575043694:1039989..1040068Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1491911889:1040514..1041137TCONS_00001052-exon-sc0000007-1491911889:1040514..1041137Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1510915933:1040514..1041137TCONS_00001052-exon-sc0000007-1510915933:1040514..1041137Clytia hemisphaericaexon
TCONS_00001052-exon-sc0000007-1575043694:1040514..1041137TCONS_00001052-exon-sc0000007-1575043694:1040514..1041137Clytia hemisphaericaexon
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:1027363..1041137 +

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.15748 0.331619 1.76295 0.388615 0.823558 0.417552 0.533297 0 0 0 2.23817 1.82853 0 9.89472e-07 0 0 0.956302 0 0 0 0.791396 0 0 0.938559 0 0 0 0 0 0
BLAST of TCONS_00001052 vs. Swiss-Prot (Human)
Match: PRI2 (DNA primase large subunit OS=Homo sapiens GN=PRIM2 PE=1 SV=2)

HSP 1 Score: 330.487 bits (846), Expect = 7.460e-104
Identity = 153/278 (55.04%), Postives = 206/278 (74.10%), Query Frame = 1

HSP 2 Score: 89.7373 bits (221), Expect = 1.043e-18
Identity = 55/156 (35.26%), Postives = 86/156 (55.13%), Query Frame = 2
            M+FS   GR  R+ ++       ++P+ L  Y  +PP  +I+L EFE  A+DR+KLL+ VEN+ + + K +  + +K++  L     +Y E  N  D                      E RR+D++SHFILRLA+ +SE+LRRWF+ QE++L R 
The following BLAST results are available for this feature:
BLAST of TCONS_00001052 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
PRI27.460e-10455.04DNA primase large subunit OS=Homo sapiens GN=PRIM2... [more]
back to top