Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001039 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001039
Unique NameTCONS_00001039
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length371

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001039 ID=TCONS_00001039|Name=TCONS_00001039|organism=Clytia hemisphaerica|type=transcript|length=371bp
CCTAATGGTAACCTTGGTAACAATAATGGCGTCACGTTTGAAGAAGGCGG
CATTGTGCAATTCCAACGTCGACCAGCAAACTGTTTCTTGCATTCGAACT
CTGATTTGAATTTGGCGTCCAGCAACAAATCCAGATGTTTCTCTTTGAAC
TGTTTGCATAATTCCACTTGCTCCGGCGTTAAGTTTCGTCTTATATCACA
TAACGGTATTGGAAGTAGAATACCGAGAACAGGTACCATGAAATAACTAT
AAAACGAAGGAGGAATGTTGGCATAAACCACCTCTGGTTGTGTGACAATA
TTATTTCCCAACATCTTTCTCAACGACTGATAGACGAAACTAATGTTTGT
TGTTTACTAAATTTTTCCACA
Run BLAST on NCBI

transcript from alignment at sc0000007:946957..947398+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001039 ID=TCONS_00001039|Name=TCONS_00001039|organism=Clytia hemisphaerica|type=transcript|length=442bp|location=Sequence derived from alignment at sc0000007:946957..947398+ (Clytia hemisphaerica)
CCTAATGGTAACCTTGGTAACAATAATGGCGTCACGTTTGAAGAAGGCGG CATTGTGCAATTCCAACGTCGACCAGCAAACTGTTTCTTGCATTNAATGG CGTCACATTTGAAGAAGGCGGCATTGTGCAATTCCAACGTCGACCAGCAA ACTGTTTCTTGCATTCGAACTCTGATTTGAATTTGGCGTCCAGCAACAAA TCCAGATGTTTCTCTTTGAACTGTTTGCATAATTCCACTTGCTCCGGCGT TAAGTTTCGTCTTATATCACATAACGGTATTGGAAGTAGAATACCGAGAA CAGGTACCATGAAATAACTATAAAACGAAGGAGGAATGTTGGCATAAACC ACCTCTGGTTGTGTGACAATATTATTTCCCAACATCTTTCTCAACGACTG ATAGACGAAACTAATGTTTGTTGTTTACTAAATTTTTCCACA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000592XLOC_000592Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001039-exon-sc0000007-1491911889:946957..947002TCONS_00001039-exon-sc0000007-1491911889:946957..947002Clytia hemisphaericaexon
TCONS_00001039-exon-sc0000007-1510915933:946957..947002TCONS_00001039-exon-sc0000007-1510915933:946957..947002Clytia hemisphaericaexon
TCONS_00001039-exon-sc0000007-1575043694:946957..947002TCONS_00001039-exon-sc0000007-1575043694:946957..947002Clytia hemisphaericaexon
TCONS_00001039-exon-sc0000007-1491911889:947074..947398TCONS_00001039-exon-sc0000007-1491911889:947074..947398Clytia hemisphaericaexon
TCONS_00001039-exon-sc0000007-1510915933:947074..947398TCONS_00001039-exon-sc0000007-1510915933:947074..947398Clytia hemisphaericaexon
TCONS_00001039-exon-sc0000007-1575043694:947074..947398TCONS_00001039-exon-sc0000007-1575043694:947074..947398Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:946957..947398 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0.485183 0.172617 0 0 0 0.956426 0 0 1.02165 3.42156 2.21944 0.29521 0.774111 0 0 1.56071 1.01502 0.960019 2.60983 0 0.467076 0.732091 1.11164 0.30029 0 0 0.12373
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
TermDefinition
IPR005817Wnt
Vocabulary: Molecular Function
TermDefinition
GO:0005102receptor binding
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organism development
GO:0016055Wnt signaling pathway
Vocabulary: Cellular Component
TermDefinition
GO:0005576extracellular region
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0007275 multicellular organism development
biological_process GO:0016055 Wnt signaling pathway
cellular_component GO:0005576 extracellular region
molecular_function GO:0005102 receptor binding
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001039 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top