Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001026 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001026
Unique NameTCONS_00001026
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2140

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001026 ID=TCONS_00001026|Name=TCONS_00001026|organism=Clytia hemisphaerica|type=transcript|length=2140bp
TTTCTTTATCTGACTTTCTGATAATTAGCTTTTATAGCGTGTGTTTATTT
CGAGAGAAGAGAGGGGAGAGAAAATCAGCTGATTGCTAGAAACTTGATAA
CAACGAGATGACAGGGTCCAGCATGGATGACGAAGAAAGTATGCGCAAAA
TCTCCGCTCAAAATGTGGAAGAGCTGTTTCAGTTGACGTCAGAACAACTT
CAAGAAATGACAAATATGTACAATACTGGAAACTTCGCCCATCCACCTTC
CATCTTGTTTGAGGAGATCGAGGAGCTAAAGACAAAGCTGGGAACCATCA
GCAAGCAACGAGATGAATACTCAGATGCAATGAAAAATGGCACCGCCCCT
CCACCCGTACCGCCCCAACAACAAACTTCCACAAACTCTAATAATTCAGA
TTCTGACAGTCAACCATCCTCACCTAACTTAACAAGAAGCACATTAAACT
CGTTCAGCGATGGAAGTTACAACCAAAGCAATGGAAATTCCCCTCATTCT
TCGCTAAGAGCGCACATTCGTGCTTTTCTACCAAATAATCAAAGGACTAT
GATTAAATATAAGCTTGGACAAACGGTGAGAGAAGCACTTTACAAAGCAA
TGTCGCGTCGTTCACTGACCACTGATTCCTATAGAGTTTACAACAAAGCA
AATCGAGAATTAATCGCTTGGGATTCGGACGTCTCACTTCTAGATGGAGC
AGAGGTGATTGTCGAGATGATAGACGAGGAAGATCCAAGCACCCAAAATA
TTTCACATAATTTTGTGCGAAAGACATTCTTCCGGTTAGCGTTTTGTGAT
AAATGCACGAAGCTTCTAATCACGGGATTCAGatGCACAACATGCAATTA
TCGGTTTCACCAGAAATGTGCTCAGGGGATACCTCCTCTTTGTGAGCAAG
CTGAACATTCACAGATTTACAAGAGGCTACTAGCAAAACAGAATCCAAAC
AGTAACACGAATATCCCTTCAACACCTCGACCAATCTCTCAACGCGAACG
TTCCATATCTGCTCCCAACGTTAATATGATCGGACAACCTGACTCGGGAC
TCATTGAGGCGGTTCTtgaaaaacattacaaaaacCGAACCAATCAAGAA
ACGGCAACTATATCAGgtGGTCTCACACGTCAAATGTCAAGTGGACCAAG
TAGCGGGCGTGGACGGATAACCAATACTCTCTTCACGCCCACTAGCGTTA
GTGCGCCCAATAGCGGCGAAAATTACTTCGATTTCAACACTGCTAACAGT
TTGCCCGCACCAGGAAATTCCAAGGCACAACAAATCTCCGGcattcctga
ctcgctaatacaCCCGGCACGCGACCGTAAAAACCGGATACGATCGTCTT
CGGAAGAACACAAAAAGCCTCGCCGTCGCGATTCGAACGATGATTGGGAG
ATTTACGCAGACGACTTGAAGATCGGAGAGAGGATAGGATCAGGCTCTTA
TGGAACTGTCTATAAGGGATACTGGCATGGCACAGTGGCGGTAAAAACGT
TGAATGTGAAAGACCCCAATCCTCAACAACTATTAGCATTTCAAAACGAA
GTCGGAGTTTTGCGAAAGACTCGTCATGTCAACGTTCTACTATTCATGGG
TTGTCTCTCCTCACCTAACCTAGCTATCGTTACTCAATGGTGCGAAGGTT
CCAGTCTCTACAGACATTTACACGTTTTGGAGAAGAAGTTTCCTATGCAT
AACTTGATAGAAATTGCGAGACAAACTGCTCAAGGGATAGACTATCTTCA
CGCAAAACAAATTATACATCGTGACTTGAAGTCAAACAACATCTTTCTAC
AGCAGGATTTAACAGTGAAAATTGGAGATTTTGGGCTTGCTACCGTCAAA
ACAAGGTGGAGTGGTGACCATGGCTGTGAACAACCTTCTGGATCCATCTT
ATGGATGGCGCCGGAAGTCATCAAGATGCAAGACCCAAACCCATACACTT
TCTTCTCAGATGCTTATGCATTCGGCATTTGTATTTACGAGTTGATCACC
GGCTCATTGCCTTATTGTAACATCGGGAATAAAGATATTCTTATATATAG
AATTGGGCGTGGTTTTATCCGCCCCGATCAAAGCAAGATTCGTTCGGATT
GTCCGAAAGCTTTGAAACGATTATACCTGGATTGTATTAA
Run BLAST on NCBI

transcript from alignment at sc0000007:783172..810107+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001026 ID=TCONS_00001026|Name=TCONS_00001026|organism=Clytia hemisphaerica|type=transcript|length=26936bp|location=Sequence derived from alignment at sc0000007:783172..810107+ (Clytia hemisphaerica)
TTTCTTTATCTGACTTTCTGATAATTAGCTTTTATAGCGTGTGTTTATTT CGAGAGAAGAGAGGGGAGAGAAAATCAGCTGATTGCTAGAAACTTGATAA CAACGAGATGACAGGGTCCAGCATGGATGACGAAGAAAGTATGCGCAAAA TCTCCGTAAGTCACactcaattattttcaattatgTTACCTATCCATTTC AAGCATTTTTACAAGGTTTTTGTAAGTTGAAAACCTATCAAAGTTGTTAT GGTCAACATATTTTGTACCCATCAATGGTAATTAAACGTAATTTAGTTGA CGACAATATCGTCTTAGTGAAAGTAAATGGACGTCAGATGACGGATTTAT AATTCTAGGAAAACATGAATAAAGGGAagcaaatgaaaaatatatagaaa aaaactttgcaaaagcTACCTTCGATGGTTTACTGACAGTCTTCGTTGAG GTGTCCTCGGCAGTCCTGAAAGAACAATAAATCAAGCACGCTCTTTGTCA ATTAGACACTATTATACAACCAGGGGTTGTTCGAGTTTATCGTTAACATG TAgaatatgagcaatctgattggctaaaaacgcgtacataaatgtACCGT GCAAATACAAGAATTCATTCAAAAAAGGGGTCTGGCAAGCGAGATATCAT ATTTTGTACTTACTTTTGTATCTTATCCCAAAAGTTATTCTCaagaatgt ttttattttttctctcaatactcacaaaagttgtcatgtTTTAATACTTT AATGACCATTCGAATCATTTTCGAagatttgaatgttttgatgttgattt caccaaaatacagaaagtgaaaaaaaaacaaagaagagaGAAAACACAAA TAATGAAATGGAGAGAGAAAGGTTTgctgatatttttcaagttgatcCCG TTTTTGTGCTCTGTACCGTGCGGTAACTATTACTTATTCTTAGAAACAAA CGAATTATAGAAATCACATGACACGAACCGTTTCTTTTTCTCTAATTGGT TTTTCACGATTTCTGGCATCACCCAAGTagattctttgaaggaaaaaata tatcaaaaattgtGTTAAATATCATCCGTAAACCCTTCAAAAAAACGATA ATGTTACCCAGAGATTACAAGACCACTAAAGAAATCTTGGTATATCATTA AGCTGTATACTTTTTAAAAGAGTAATCTTGTACAAATAAAACCAAGAGAT GAGACAAACGATACAAAGGTATACCTCAGAAGGAACGACTAGTCGTCAAC AATACCTCCACTCGTTGCATTGTAGTAATATGTTGTTCCTTGTGGCCCAG CCATCACTTGCCATGGATAAATATCTTTGTTACTAATATCATCATTTCCC GATTCTTCTGTTTTAGAGTgagctattttttcaaaagaaagtaATTGGTA CAATAATGAAACACCTCTTCTGTTATTTCGATTTGAAATTTAAGTTTGAT CGTCGATTGCTCATGCTTCTAAAGCCTCCTTATTCTAAGACTTTAAGTTT ACAAACTAGgtacttttgtatttttcaattttacaaaacattttaaaatt attttgacattATCCTTTCATCTTCTTCCACAGTTTAATGACATAAAATG GTGTGCACCTTTGACAATATTTCTCATGTCAGCTTTACCAATAGACACAT CTGAGCTATTCATATCTTTTTGAACGGCAGCCAACGCAGCCTAAAATAAA GGAAGGAATTTGTGTAGAGATAGATAGATATGTTATATTTCACTTATTAT ATGTTTTCTTATGAGTGAAATCAAATGGGTCAAACAAGGTACAAACTTAC AGGAAATcatgaaagataattttgaacattttgtcgGGAATCAAAGTGGG TTACCTTCTCCATCTCTTGGAACATGTGTTgggatttttcatctttcttt cGCTTTTCGATTGAGTTTCTTTTGATCTGAAAAGCATGAGAATGAGGGAA TAAAGAAAATGTAAGATGGTAATTTTGCTAATAACAATAATTTACCATTT GCATAATAGATGTTTGTTATTATCAAAATGTAGAAAATCGAACACAAAAA AATTACCTCTGCGAGTCTTTTCTTCACATTTGCCTGAtgatttttacctt tttcatgaaattgtaTACTCTAAAAAGGAGAATGAAAGCAACAAAACGCA ATGTCCTTCTATGTTTGATTTAGTGAAAagtgaaatatctaaaaatttct tGAGATTTTCAATTAAACTTAAATAGTACTCAAATGAATACGATAGAATT GTAACTTCAGTACATAATTGGAAATTTCTAGCGGTattctaatggtattt ttgtcttgaTCCTTTGTTCAATATATAACTTCAGTACATATGTGTTTGAG GAAAAGGAGAAATACTCATTCATTGTAGATGTCCAGTTTCGCTAAAAAAA TAATCAGACACGTCTGACCCTAATTGTCTAATTGACTTAATATGGACCAG GctattttactgatttttaaGCCCTGTGTAGAAGACCCGATATTACCCCA GTCTCAATATTACTTACAGGTTTATTATCTGCCGTCCAGCATTTGCAAAA ATCACAATAATGTTTACCAGTTGATTTCCAGTAATCTGCCCTgaatttga aaagaagaaagttaAGCGAGACATGCAGAATACTTTTACCTTGTAGACAT ATTTgacactaaagcaaagaaacaTAAAAACTTCTTTCATAACACTTGGA ACAACACTTATAGTAGCCaaactagccgtcacccggcgtcgcacccgccg cgTAGaatgttgttgaacacatcaattcacagcaaaaatttccacgtttt aaacgcacgtggaagaaaatgtcaagtttacgacaaaattgaaagttttc cacattttaaacgcacaggGAAGAAaacgtccaaattcacaaccaaaagt tttccacgttttaaacgcacgtggaagaaaatgtcaagtttattatgtcg cacccgccgaggagtagataagctgaacgcatcataagccctttggatgg tggggaggGTAAAAAGATCTGGTTGGTAAATCCAGACAACGAAAAATTAC TACTTTAAAtggttgaaaactaaaaatattgcaaatttattgttttgtga cgtcatttggaccctaaaaagtgagtcggtcgatctaaaaagtgagttgg tcgttctaaaaagtgagtcggtcggtcgttctaaaaagtgagtcggtcgg tctaaaaagtgagtcggtcggtctaaaaagtgagtcggtcggtcggccta gaaagtgagtcggtcggtgtaaaaagtgagtcggtcggtctacaaagtga gtcggtcggtcggtcgggctaaaaagtgagtcgggcggtctaaaaagtga gtcggtcgggcgttctaaaaagtgagtcgggcggtctaaaaagtgagtcg gtcggtcggtcggtctaaaaagtgagtcggtcggtcggtctaaaaagtga gtcggtcggtcggtctaaaaagtgagtcggtcggtctaaaaagtgagtcg gtcggtcttaaaagtgagtcggtcgttctaaaaagtgagtcggtcggtcg ttctaaaaagtgagtcggtcggtctaaaaagtgagtcagtcggtcggtct aaaaagtgagtcagtcggtttaaaaagtgagtcggtcggtctaataaGTG AGTTGGTCGGTTTaataagtgagtcggtcggtctaataagtgagtcggtc ggtctaataagtgagtcggccggtctaataagtgagtcggctgttctaaa aagtgagtcggtcggtctaaaaagtgagtcggtcggtctaaaaagtgagt cagtcggtctaaaaagtgagtcggtcggtctaaaaagtgagNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNTAAGTGAGTCGGCCGGTCTAATAAGTGAGTCGgccggtctaaa aagtgagtcggttggtctaaaaagtgagtcggtcggtctaaaaagtgagt cggtcggtctaataaGTGAGTCGGCGGCCGGTCTAATAAGTGAGTCGgcc ggtctacaaagtgaggcggtcggtcggtctacaaagtgaggcggtcggtc ggtctacaaagtgaggcggtttaatttttcaaatatacctAGCATGATCN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNAATAGAAGAGAAGAGATTgcatctctcatgccaaaccaaacga agcATCAAATCCAGGAAAGATTAACAATAAACTTCATCATCgtccatttc ttgtaacaattacacaaaaatcatgatccaattcaactcattaaagcata aaacacaaagaaaaagagcaaatgagcagtagcaaccagttgtttttttg ccgccatctttattttgactgttagaaagcagtatggtccgatcaaaaat acgcttccgaaccgggcgacgNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNccgaaccgggcga cgtttcccgatcggcaaggaaccgtaggcatgttttccgatgacgtgtct caaaagaaacgtactccgcctcaaaaaaaaaactctacTGTTTTCCCcct cggagctcgatttaaaaagaaacttggaaaaaaatccataatggcccccc cacggctcactcacattagacttttagtatatagactagaaTATGCATTT TCACAACTATTGAataaattaaatatttcataataCAGTAGCTTGGTCTT GTTACTTACCCTAGCTTGACCAGAAAAGTTTAGTAAGGCTGGCTGGGGGA CAGCTATGTATGAAGGGAATTCTTAGAAAACTATGTGAAACTTTAGGTAA AACGTCTTAtgccttttttgacattttttaaaattgacattttaggtttt tgaacataacttttgaaccaataaagtaaaatgaaaaagtaatacaccaa attttaagttaggctttcctctgaatgattccgaaacaatctttgaaaaa tctttctgcTACTGCCTGCAATATCAAATCGAAGAGTGTAAattttttgt ggcacacccggtagaacctttgcaaaaaaaaggcaGGAAagatagaaaag ttgtatttttactGCTCtgttcacatactgaatttgaaagatcttttatg tggcgtttttttgcaaacttaaaaaaaatgatttttgtcttgcctttgcg ggactttggcttaagtgcagCATAGATaaggtacaaagtccaaacatgcc tttaccataaattttatatgaagagttaggtctatactgtcagTATAAAA CCTTGTGACTAAAATTTAACAAAAGGGTTAAAAACTAGGGAAAACTAAGG TATTACACACGCAAGAGGTTGGGAAGTTTCAGACTTCCATAAAGTAACTC AcgttataaagaaaaaatacaagTATTTATTGCAATTCATATAAACTGTT ATTTAAGTGATTGCAAAGAGAATGGGTTGACAATTCAACTATGGTGTAGC AGTCGAGTTCCTGACACGCTAAGGGTGCATGATACATTAGGGGACAATCA GCTTGATCATAATGAATAACTGTGACACTGTTTTTATCATTTCGTCTGGC TGCGTTGTTATTTATGTCATGCTTACGAGGATGGCtgtcagtcagggaaa tccctcaattgcggtagttttcattcgtgtttagcctacaaaggcttata atgactacatatagtgctggtcgacaaagataaacaaacatcgactATAA AAAATCGCattaaaagaatctgatctacagaaaaaatattttgtctgtgt gTTAAAAAGACAgatagggaaaccatccaggatcctgccattctataagc cagcaaaagcTACCTTAAGtctcttaccattttccatcgaaaacaaccat aaacattgctacttcccaaagccggagaccgaaacaaattattttccaag attatggcgcccttttggatctattgttaaggccatctaaaatggcgGAA AAAGTTGCTGGAAGACAAAGGCGCCcgctgcttcgagggtggtaacgcta ataagcccaatatgatcttccaacagaaggtgagttagttgccgcgcgag ttacgtcatgcactccaccccgcagcgcacaacgaagcgtgtttcaatga atatcattaattataagaatatcttatgtgcttaccttcagtaaactttg agtgcttcattgaaaatgaagAAGGTAAGAAGATAAAAAATGCGCGCTGG ATAATTTTCattgtaacagtttggtcaaatgtcgcaaaaaaaagtttcag ctAATTAAAAACACAGTGTGCTTagacttactatgtttgctacattgtct agactaaaaaaagtgcgaaaagacacgaacgccattttttaatgagagga ccctgccgacgcaccggactgtccggtgtatttgtccggtggcaaaaagN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgatcaattatg tacaaaaattgcctgttttttccttgaatcttgaattctgattcttgaat atactgcaattgcggtatatgaaaattgtaaaagtgACGTTTGCAATAAT TGCAGTAAAAAtttactaccgcaattgagggatttccctgactggtTGTT AAAGAGATTTGTCAATGATTTGTTAAGTGCTCTAGAATCAAATCATCCTG CAATAGCCTTGGAGTATGTCAATATGATAAAGTAAAAAGatacttacatt ttttttggttttaataGAAAATTTCCTAAATTCACAAAATGTGATCTTGA TCTGTCGAAAATTCAATATGGGTCAAATTAGAACATTTGAATACGGGTGC GGGTAGAtgtagaaaatcaaaacattgcttAGAAACTGACCGTTTCAGTT GCGTGTTTAAAGTCTGCCTTATTATCATATGCTTAGTTGGTCATTATTTT AAAACTAACATCACGTGACCTGTTCTTGAAGAAGGCTAGTTAACATGGCG GCGACGTCGGAAAACAATTTATCTAACATTGCAAGAATTTCTGGAGGAGA TTTGACGAGAGAACATCGTTCTCTGACTATCGACAACCTTAATTGTGGAG CAGAAGTAGATACAGGGCACTTTCAAAGCAATGGCATCAGGGCTTCGCAG ATACTTAGCGAGGTTAGTTAAACCAAAGGGGAAACCCCCATATTTTTTAT TCTGCATATCTTTACACACAGCTCATTTGCTGTATGATCATTATTGCATT ATTGAGAAATCAGATACCAAAATCTACTGATCAAGAAAAGTATGATAGTT TCATATGTTTGAATTTTTCACTTGTAGGGGCTTGTAAAATGGGGAGAAGT TAGTATACATGGCATAATCTCCGATTGGGGAAAATAAACTGGAAATTGAA GGTACATTGgggggccattccagaaaactttttttacccCCCGTCGGACA ATgtgcatttttgaattttttctagccttggaaataatttttcttttcca gtggtggtcggaaatacacctttcccgtaattcgtaaaactaatgcgcgc gcattattttgatgctctccaccgtttggtctctggaggtaaacaaacct gcttttgcctgcgttcccttagggaaagttggttttttgagattttctta aGTTTGgtcgaacaaaatcccctcaaattttagtatgttcaatctattta tgatattataccaccctgaaaatattttgccaaaagaaggtcgctgtcaa aagttagaggctcaaatcccactttccctaacccctcgcaggcaaaaacg cgttttttacctcccaaacaattttatacacaacggcggagcgcacattt tcccggccatttctgagaaatttgaattacgggaaaggtgtattctgata aaaatccatgtacttttgcaaaatgcatcggaaataaTTCCACTCTTTTT CCAAAACATGACCCTAACCTGTCCCACACATGTACTGGCCAGGTTTTCGG AGTTGAAAATCCAAAGTTTTTGTGGCCCGAACTTGGCTAGATCATCAATA TGTTCAGCGAACTGAGAGAATGTTCTGATATTTTGGCCTGAAAATATTGG TAGTATATGTCATTTATGCTGCAAAACCTCGCGGCCATTAATTCACCCCT GACCGTTGCACTTTTCTAACGGgcagtctaagcttaaactcctatatcag gattagaaactaggctagacTTACGTGAAATCGGGTAActtacatcagtg gaggcaaaaatgcatagccctcaatcaaatgaatgacctgtctggtcatt aaaatacacaaagttaaatcaaaacaaaaatgatagagtagatctgcata gttcatttgttttgaaattttgctgctcacattggtcagtcatttgaagg ctatgcatgttacacaagtgttacgcgtgaGCCAAATCGCATTaagaaca acctctaaattgctgagtacaggagaaaaaaaatcgaaattcaaaatggc ggcaaagcccacgctgataactatcaaaaatctctgctcaataaatcaat aaaataatttgaaataaaaagtaaacaaaccttgaacctttcaggaatcc aaataaataaaagtacaATATAAAAGTACAAATAGTAAGTACAAACAGTA AGTacaaatataaaagttttttttttaagaaactagttttaccaagcagc ctcaatgtttcttaagaaatcggccttttgagccttaaatgtttcttaca tgtttctaaactttttgacgtaATCAGCCttatggaaggctggattggaa ggttcttaaaaaagcTGAATTAgaattattttctcattctcagtcTCAGC atgtttattagtttttaggcattctgagcctcgtgtttcttaaaagtgtg tttcttaaaaaaaaacaatgtgtgttcatctaaagtgaagattacatttc aaaataaaacgatttccaaaccaacctaaagtcagtgtctgccaactaaa aatttctctgcggggtcactgccaaggagttacgacttcagactttagat tccaattcttgtataggctgcaactacacagccaaaatgatctgtattac aaatacttccaaatgggtccataagttaagaaaatgaaattatcatctag cagggggttttgtttttaaaaacaaacttcaaaataaaattgttaatgaa ctttttactttaaaaaatatcacttacttacataatttatttatgatata acatataAATGGTATAAAtggccgcaagaagggagaaaaatttaattcga cCCCCGgttttatctttctttttctatctggttcccgcgtgttagtgtag acacaactttaatccagggaaatgaagcgttttcattggtctaaaatcac ggatggtcacgtgaccagaatttttatccagggaaatgccgtggccgcaa tgttttgctttagttaGATTGagcattttgttgttttggatttgagcggg cgaaatttctgtacaaaccaaaatattcattggaataccggttgaaacac ttgtggtTAGCCTCTACTACTGATGCAAGTCACCCTTTATTACGGTACCT CTTATCTTTCcctttaaaacaataaaatgcttacaagttgacacaacaca ttgacaagtaatcaagtttatatcaaaatcttcaacaaaaacgaaagtgg tctcttctactgattgcttcctggCGCTCCTTTGCagttgtttatcaaat ttccactaATGAGATTGCCACATTTCACacagcccttctttttggcacct gtggcctctcagtgccttgcaaaATGAGTGGCTGTAAAATTCCACCCTTC ACATATTgctttcaatccgtgatcctaaTGCTTcggttttttctcatttt cgatttactgaagaaagcaagaatttgatgcaagagttagattgtcaaca aagtgccatacGAAATCATGTaagaaatcattgaataaaagaagaactta aatcttaaatactttcattttgaagaattggtgcaaaaagtgaaacatgg aaaagctTCATCTTTTATTGGTTCAATTGAATTAGGGGATTTAGAAAACT ttgtatgtttgtttttttgcccAAACCCCTGTATTTATGGGCTAGCACCC GTTGCTAAGATattggcttgaaattgaaagtgaaagcactgaaaacgaaa gtaaaatcgacCCGCACTCcgaatcccgtaatcttgataaaGGATAGGAG TTTAAAAAGTAAGACTGctgggtgcgccacaaaaaggtttctttttttga aaacttgattttctcgagttaTATTAACTAGATAACTTTCAAGAGAAAGA AATCCTTTTCTGTGCCTGTGTTGCGTTCATTAAAAAAGGAAGGCAAACTT GAATCGCTCAATGAAATTTAGTGCATAGAAACCACCCCCGCGTGAAGTTA ACAGATCTGGAAATACAACGCTagatttttatggatttttgtAGATATTT GTGTTGCAGAGCGCGCATGTTTCATTGCagaattattttcatatttcaat tttaaaaagccTACTTGGTGTGAAAGTATAATTgggtattttttaatacg ccattcattaactcaaatcaaacgactttggaggttcagtgaaatggtgg acgaaatgaaaaaaataaatgctcaaaaacattcaaaatcataaaatatc aaatttttaaatAGAAACATGATCACATTATATCAGTATTGTTGTTTTAG TCCTAAAGAtaataattagctgtctaactGACCTTTTGTTTTACAAGGGT TCGCTGACAAATCAATTTTTGGGATAGAAAAACATCAATTGACTCACATC CACCCACCCACACCCTAAAACATCAAACACctgaaaatcaatgaaaaact gCCTTTATcgctgtttcgtcagccatcttgattttcgCTACAGCTCACAT AGTTTATatgtatttgaaaaataacagacataatttctaaacttgttcac aaaattccTGTAATTCATTATCTCAGCAGTAtatagcaaaagaaaaaaat gccatctgcaaaaattcaagggcTGTGCGAGTCTTCAAGCAAAGAGAAGA CCTTTTTGGGCTGTTTGTTTTGGAGTTGTTTTGAGGCGATCAAACAGAAA CATGGTGAGAAGTAACATATGGCGTGAAATGAAAAATCAATGTTTctgga tttgaaaaaaaacaacgtcaACAACCTTCAACCCACCCGCCCACTAACGT CAATTGAtgtttttctaacctaaaatcgatttgtgagtgacccctgaagg aaagttgaatttctactaaaggaagaaaatttgtcagaaaatgccaaaaa ttctGGTGTTTGTCTGGTGTCAAAATTCATGTAATGTAACAACGGACTGT TTTATCCGAcataatttaataaaatcttttctgTGCATCGTAAAGGTAGC ACTTTTCTGAGAGATGGGCCATTAAGTGTTTTTGATAACCAAATTGCACG TACGTGATTTGAACCAACATCATATCAAAGAAAGACCCAAATTTTCTAAT GAGGTTGGCAGAATTtagtaaaaacattttttggctgaaaaaagaCGACA ANctttttagcttgaaatagaAACATTGAGCaatctcgctggggttattt tgtctttttatgttgaatattagtacaagacaccatttagaaaccatttt gaccctttactgggctttcatagtcttaaaatgggcaaaaaatgccattt ttactcattctttgctttagtgcgaatcaaagacccccctggggaatgct ggattttttacctaTGAGGTATATAGCCttcagtaattagttcttacaaa gtaaacaagggatggcgcacattATGAGCatagttatttttcttataagc atctactttttaagaatcttatcaataactcttgatagacggtgatatag ccttcggtaattagttcttacaaagtaaacaagggatggcgcacaatatg agcatagttatttttcttaccgggtgacccacgaaaaagttcagatgTTT CCcaacgtcttgaggccgaacaaatgtcccaaagtgcttgaagttttgat atttaaaaagtagatatcctaacttaaaatttgagctatcattgtttaaa tttgaccaaattgttctctgcttatgagcttttaaagtcaaaattcactt tacggaaagtgtaaaaaacacgtaaaaaaggggtatcaaatttggtattt ttagacgtttttgatNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNgaatttaatacctcttttttacgtgttttttacacttttcgaaaag tgaattttgactttaaaagctcataagtagagaacaagttggtcaaattt aaaaagtgacggctcaaattttaagttaggatatctactttctaaatacc aaaactccaagcactttgggatatttgttcggcctcaagacgtcgggaaa cgtctgaactttttcgtgggtcacccggtataagaaaaatttttttcttt cttatttttcttttctcttgtgagaagggggtgtttaatTTATGACCAAA AACTTTCAATCTTTTCCTTGTAGTAGTAGATCTTGAATTAGCTTTCATCT CAACTACTTGTTTTTCTATGCAGTTTGAAtactaggcgaaattttcgact taaaGTCGTCTTGTTGCTTTTATTATtacctttttttaattctagTTCAA GTGGATAAATgtctttcaaatgttttttggacctacctaaggtagtcctt taaattaacccttgtccgttcgtccgttcgtccgttcgtctgttgccagc ttttctcgggatcggctcattattcttttttctttttttgtacaatgata caaaatagcaatgcctaaaaagtgacggagcccgattttgaaaaaaaaat ttggggtaaatttgggccaaaaactacctaaaaNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNtagttttttctgattttttgctcaaacatgcgtattaacaatgccc aaaacatggtctagtccgatttctgagaaaaaattttttccggccgaaaa tgccggaaatatgccggaaatcgccgtttttctggattttcattggactt ttccatataattggttgttttttcattcaaNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNtttgaagccggaactttctaaaaatcg ccggaacagccgattttcgccggaaaaacggtatttcttgaatttcttga gctgtacttcatattttttcatgaaactttgcacactgatgcaaaatgtc aatacctaaattgtgacggagcccgattttcgaaataattcatttccggc cgaaaatgccagaaatatgccggaaaaactggttttttggcattttctcg agattttgtcattagttttttctgattttttgctcaaagatgcgtattaa caatgctcaaaacatggccgagtNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNACAACAATCAACACaggagaaa aaacaattttccattgagAACTTTATAGCTGATTCAACTTGATTTAACAG AATCGATATTGGAagacaataaatttttttgatttaattaCCCATCCCAC ACCAGATTTAGAAACCGACGAAAGCTGGCTAGGGTAACTCGAAAACAGGA GTCGACTTTGGttgactatcttttttaaaactgaGATAGGTTTATGAGGT ATTTTTGTATAAAGCCTAGAAAAGTCAAAGATTGAAATTGACATAACTTt agatttttaaagtttttgaattgctGAAACAAGGGGTAACGGTGACTTTG CATTATAAAGATCGATTTgatggtgaaattttgaaaatggttttgTTTCA CAGACTGGAGCAGCGATAATAAAACGAAACTTTATGGgctttttatgcat ttttggcAACCAAGAAATATGGGGAATGCACTGATTCTCTTCTAAACGat taatttgaaattcattCTTCAGTGTACCTAGCTGTCTCTGAATATGGTCA TCTTGAGTACTATAATGTTGCTTTTATCTATTATTGGTGTCCTCTTATAG tccaagttttttttaaagtactAATGCGCAAAATATTTAGCAAACGAAAG CAATAATACCAGTGGGATAACTTTCCCCCTTCAGCCCAAAAATTATCCAT CATCATTGTTCTTCCTACACCAGTCCTTACGGAAGAATAAATTCTGGCAC AAAACTATTGAATTATCTATTCTGGACGAAATAGGAGGAAGCAAGTTGAA AACAATAACAGGCAATTCAAAAACCTCATCGTCAGATGGAATAGACTATC ACACTCTTGATTGCAATATATGACCAACaattataaataaaactttacaa atattttgAGGATGGTATTTTTAGACCTCTTTTGTTGTTTGCTTAATCAG GGACACAATAATTGTAGGTTAGATAGCTCACACCCAGAGAGCATTAAAGT TGAAATGAGCTTTCAATTTATCTGAATTTTTGCCTACTTGGTTCTTGCTT AACTCTTACTGTCTTTTCTCTAATTTAATGCGTCCTCTAATAAATGCAGA TAACTTATTTAGATAAGTTCTGGTTTTAAtatactttctttaaagaagta tataaaaaatatatataaagagTGGGGGATTTAGGGAGATCAAAAGGGGA TACTCCTTCTATGCTTTGCACATGCAATATGATAAGCAATTGGTAAATTT TTTCATGTAGGATATTTTAATTTGGAATTCAACTGACGCTGTCTTCATCT TTTAGGCTCAAAATGTGGAAGAGCTGTTTCAGTTGACGTCAGAACAACTT CAAGAAATGACAAATATGTACAATACTGGAAACTTCGCCCATCCACCTTC CATCTTGTTTGAGGTAAACTTCACTTTTGAAAATTAGTAAGTGAACGTCT TCAGTGCTTAGACGAATATATCTTTGGAATTTTGACATcttcaattttat cattttagttGAGAATCATATAACTAGAATTTGTAACTTTCTGCTATCTA ACTAGCCCCTTCTTAAAGGTTGTTGATATTCttctatttctattattttg tGAGGGAGTTCCATGTGCCAAATACATAACAATTAAGGGTTCTAGTATTT TCTAAattaagaaaaaagattttccttcTTCAGACTgtagtttcttgatt tttataaTTATCATGGACGGTTTAGATAGACTAATCACCCACACACggaa gtttgttttttattgtttgtgTTATAGCATGAGTGGGATTAGGTGGGATC GTACGTTGGGCTTTCAGAGAtattagatttaaaaaaagattagtTTGTAT TTCCAGTGACGGTGAAACTTTCCACAAGTTTGGCATAATCAGATAGCTCG AGATTTTTGGGCTTTGAATTCCATCTATATTCCTGATTCAAACTGACATA ACACATTGTGAAAATCTATACTATTGTACTCTTGCTAAACGAGAATTGGC TTAGGACCATAGGAGGGGGATTTAAACGATCTCAAATCCATTTGATTATT ACTacatatttttcaagttttgatcGCACATTCTGTGACCATTTCATTTT CTTAGAATTAAAACTCTTTTTGGTGTTATGAATAaaagacctctacaaaa ccctcTTTAGGTAGTGTAAAAAGGTTAGAGGTTATCGGTTAGAGGTTGCT AGCAGCATCGTTTTGGTCGTTTGTTTCGTCTTGTATTTTCCTTGTATTGT AATCTTTACAATATTCTCTTCATTCATACGATTGATCACTTGTACATTAT ACTTATATAAAGAAATTTCCATATAAAGAAGCTTCTCTTGTTTTGTGGGT GCACCAGGAAAATAAGACAACGAGAGACGAATAACTACAGATTGTGAAAT AATTTGGTTTTATACTTTGGTTTTGACCCTTCTTTCAAATGATATTGTCT TTAATCGTGAATCTGTTTCATATAAAGTATTTATATAGTCGTATGATGAG ATGAAAGAGAAGATGAAAACTGATTATCGTCTGTTGTGTTTCGtttcttt actttcttttcCACACTccaatattttttgaataattccCCTTCATTGTT TGGTACCATTGTATTGTTCTTTACATTATTATCATGATCGATAGAGTTTT GATAGATGTGCGATTCAACCTTTCAGAGAAGAGGAAGGGAACAAAAGACC TCTTTTTGTTTGCTTCAGAAACACTGAAGAACGATGTTGTTAAAGAGACT GAAGAGATAGAGAAGAAGTGCAATCATGAATtgataatatatattttatt cttcatttttcactGTTTGTGATCTAACTTAGCTGGAGCAGTTTTTCTTT TGCATTAAGTGGAGATGGAAAGGTTATAAAAAGCATCAACCTTCAAATGG ATTTGATTTGCGCGAGACTCTGTATCATGTAATCCACTATTAGGTTTGCG ATTCCTTGGATGCATAGCTCTTCTGGAGATatctctctttaaaaatttca tatttatgTTTGGAAAGATTTAAGTTTTTAACCGAATTAAGAAATACTtg gatgaaaaatttgaaattatgcttttttGGAATTGTTTTGAAGCTTTTTG CATAAAGGGCCACTCCTTCCTGCTCCTTCATTCATTCATATTATTTCTTC AGTGCATAGTATCATTTTGCATTTTACATCTTATTTTTCTTGCAAAAATG TGCGAAGAAGCCTGACTCATACTCTTTCTGCAGGCGAGAAAATATAAAAC CCTTTCAAAAAACCCTTCTTTATTTGTTTACGATTATTAGTACAgctttt gaattattttattcaatatCTATTTTACTCGCAGGTAAATGAAGCCTGTT TTAAAGTGTTTCTTTCATCGAATCTGCACGAAATAGAAGTATTGTAAAAA GAGTTGTTTGGAATAATATTTCTGCTTTTTGtcgaacaaaaaaatgaaaa actttctatGGAACATTCTCATATGACCTGCTTAGAGACCTTTGCGAGAT ATAGAGCTGGAACTTTTGTATTTTGCATAAGATTTTGCAAATTTCATCTT AGtttgattgaaaaataaaaagtcgCAGTTGAAAAAGATTGTTGCAGCTA GATACGAAGAGAACAGTTTGTGTCATAGTCGAAAACTTTATGACTTCTTG GAGTGAAACCAAGATATCGTCATCATTATGCTAGAgacattttatttcaa aatctcCCATCAACAGGAGATCGAGGAGCTAAAGACAAAGCTGGGAACCA TCAGCAAGCAACGAGATGAATACTCAGATGCAATGAAAAATGGCACCGCC CCTCCACCCGTACCGCCCCAACAACAAACTTCCACAAACTCTAATAATTC AGATTCTGACAGTCAACCATCCTCACCTAACTTAACAAGAAGCACATTAA ACTCGTTCAGCGATGGAAGTTACAACCAAAGCAATGGAAATTCCCCTCAT TCTTCGCTAAGAGCGCACATTCGTGCTTTTCTACCAAATAATCAAAGGAC TATGGTAAGTAGAACATATTAGATAATGTAGATATCATTAAGAATGCTTG CTTGATCATGGACATACTTTTACATAATTTTTTGATCCATTTATCTATCT GCTACACTTCTTTTTGCTTAATCTTCCTTCTAAAACCTTTACAGATTAAA TATAAGCTTGGACAAACGGTGAGAGAAGCACTTTACAAAGCAATGTCGCG TCGTTCACTGACCACTGATTCCTATAGAGTTTACAACAAAGCAAATCGGT GAGTTTTGGGATTTGGAAATTACCTGCAGGTTGACCAGACAGTTAATAAA AACATCGACGATTATCGACGCCTTCAAGTTTCAAATCATATGTTAATGGT GTTCTAACTATTAATAGGTTCTCTTATCCGATTTCTATTTCAGAGAATTA ATCGCTTGGGATTCGGACGTCTCACTTCTAGATGGAGCAGAGGTAGGAAT CGAATAATGTAAACTCGTCAACTTCAACGACTCACGTATATGGCTATCCT CCATAGTGGATTATTTTGGTTTTCTTCTTCAGAAAATGAATTCCTTTTAT CTTCTGCCCCGAAAAGAACAATTAAAGAAGCAGAAACTTCTGGGTTCTTT ATATTCACTTTTTACTTTTCTAATCAGGTGATTGTCGAGATGATAGACGA GGAAGATCCAAGCACCCAAAATATTTCACATAATTTTGTAAGTTATTCAG TTTCCTTCCATTGTCATATCCCTGACCTTACTTCATATGCTGCAACCTCG TTTAGTGTTACCCAATACTACGGGTGCATTGCAATCCAGATTCCGTACAC CTATTTCATCTCTAGCCATTGATGAATGTTGTCTTTGATTATATTTTCTT CACTAGGTGCGAAAGACATTCTTCCGGTTAGCGTTTTGTGATAAATGCAC GAAGCTTCTAATCACGGGATTCAGGTGAGCACTGTCATTCCatatttttt acccttttttaccctcaacaaaacaaaaaagtcgtAGGTGATAATTGCTT TTAGTTTATTGAAAATGCATtcactttttcgatttttcagatGCACAACA TGCAATTATCGGTTTCACCAGAAATGTGCTCAGGGGATACCTCCTCTTTG TGAGCAAGCTGAACATTCACAGATTTACAAGAGGTAAGAAAGAAGCTTAT CGAAGGCTCTTCCGGCTCTTCAGAACAATTCGATTTGAATTGTTCTGAAG TCTTTTAACGAGATTACCCCATCGAAACATATATTCGTTCAATGATTAAT TCTTGTTTTTTCCACCATCTTACTAGGCTACTAGCAAAACAGAATCCAAA CAGTAACACGAATATCCCTTCAACACCTCGACCAATCTCTCAACGCGAAC GTTCCATATCTGCTCCCAACGTTAATATGATCGGACAACCTGACTCGGGA CTCATTGAGGTATGAACTTCTGTTTCAAAAATCTTGGTACCTTGTATGAC GTATTCATTGCCGTTGAAGCCCGAGAAAACGCCTTTATTTATTACAAATA CGCACTGATATAAATTATCTTCTCCATCttcaataatttattttttcatt ccttTCAGGCGGTTCTtgaaaaacattacaaaaacCGAACCAATCAAGAA ACGGCAACTATATCAGGTACACATGTACTGTATATTCGTTTTAATCCGTT TTAAATCGAACTTTAActtgtgaaatttttttaattattttagagAGTTG GTTTTTTCATAACactttttcccaaaatattAGATCCGGTCTGAATGGGG AGGCCAGTTTAGCaataatttttctcttttattaattttttaggtGGTCT CACACGTCAAATGTCAAGTGGACCAAGTAGCGGGCGTGGACGGATAACCA ATACTCTCTTCACGCCCACTAGCGTTAGTGCGCCCAATAGCGGCGAAAAT TACTTCGATTTCAACACTGCTAACAGTTTGCCCGCACCAGGAAATTCCAA GGCACAACAAATCTCCGGcattcctgactcgctaatacaCCCGGCACGCG ACCGTAAAAACCGGATACGATCGTCTTCGGAAGAACACAAAAAGGTTTCT TATTGATTGAGttattaatgtttttttgttttttttgatcaatttttacG TGTTTACTGCGAAATGTGTGTTTTTCACGTACAAGTATTTATTGACCAAG ACTAAAACTTTGTCAATGATTCATAGATAGATGTTAGACATTTCCGGACC ACCAGACAGCTTCATTTCATATACGAAAAATGTCATTTCTTGTCGTCTTA GATTCAAAACATAGCGTCGAATAGATGTAAATAAACCTCAGTCTTTATGT TATCgcgaaagtcagaaaaaaaggaaaaccaaagccaaaacaagtttttc tttGATAAAATGTCTCCAAAGCTTTCAAATTCGAGTGACAGGAGATTCTT TAGACTATTTACCCCTTCATTCTGAAACTCAACTTTATTTGGCTCACAGT AAAGAGGGAGACGTTGTCACTTCATCAGCttgaaaaaggagaaaaagctG AATGTTAGTTCTTTTCTTGGCTAGTTAACCCCTCCTCCTGAAAGTTATGC AAGGTGTTTTCTGCACTCTTCAAACGTTTCTTCTTGCTTTGCTTTGTAGC CTCGCCGTCGCGATTCGAACGATGATTGGGAGATTTACGCAGACGACTTG AAGATCGGAGAGAGGATAGGATCAGGCTCTTATGGAACTGTCTATAAGGG ATACTGGCATGGTAAGTACTGAAGCAATGAGTTTTTTGAATAAGTGAAAA CTTaatcaaaatattattaaatttcTTTGTAACTCAAACCTCGATAAGCT TGAATGTTTCAttaacttgaacaagttttTCTGTTAGTAAACTCTTTAAA ACCAGTGTCGAAATCTTTATTGCTAGAACAAATTCGCTTTCCCCGTCCTC GTTCGAGCTGAATAAGAGACTTTATAGACGCTATACCATCGATAAGTTAA AGttgatttattttataagagagtagtgaataaatagtttattttAGATT TCATCATTTCTTATTTTTGTAGGCACAGTGGCGGTAAAAACGTTGAATGT GAAAGACCCCAATCCTCAACAACTATTAGCATTTCAAAACGAAGTCGGAG TTTTGCGAAAGACTCGTCATGTCAACGTTCTACTATTCATGGGTTGTCTC TCCTCACCTAACCTAGCTATCGTTACTCAATGGTGCGAAGGTTCCAGTCT CTACAGACATTTACACGTTTTGGAGAAGAAGTTTCCTATGCATAACTTGA TAGAAATTGCGAGACAAACTGCTCAAGGGATAGAGTgagtcttttttcat ttttcgatcaaaactaaaaaatgaaagtttgtacCACGCTGGCAGGGCTC GAAATATTTCTCATAGAGAAGTCAGTTTTCCGGATAAAGATATGAAAAAT AACTAGTGAAGGAATTCCTTTTTCACACTTTCGTTGCCAGTCAAATCACG TCAATGGCCTTCTGCCTGCTTCTGCCGCCTTTTGCTTTTCCTAGCGAAAT TTGGGAACTTTGACCTAGAAACTGCGTTTGCTTACGTGCTTGTACCCTGT TGGTGTTGGCGTCGCCTAAATTTCTATTATTAGCCACATGTAAAATTTGC GAAATTTGCGAAATTCTTGCTTTTCTTTCCTGTACCGAACCATATCACCG AGCGGCagcttttttatttccaaaatagGGTTACATTTGGCTTGTACGCC ATACGCCCGTGTGAATTGACAACTTCAAAAAACTTGATAACTATAATGAT CGTAAACAGGCTTAACGAGCCATGGTTTGGTAAACAAATACATTGCAAAA ACAGGAAATGTTTTTGGGATTCCTCATCCGGGCTTGTTAATCCTTAATAG TGATCTTGCAAGTAGATGATATGAACTTTCCTTTGTTTATTTATCTTTAG TATTTTTAGTTCGAATGTTTGTTTTCTATTTGACGTACTTTTTCCATAGT AGTGGTGAAGCCTCAGCAACCAATGGTCATGTGCTGGTTTGGACGCcaat aaaatgtttattttctctTTCCTTTTTTACAGCTATCTTCACGCAAAACA AATTATACATCGTGACTTGAAGTCAAACAGTATCCTTTTCTTATCATTCG TTTGCCAAAAACACAACAATCAAGCCCTTTCATTCATTATTGGCCAATTA TTGGTCAAGATTGGCCAATTTTTGACAGGCCTGCTTTATTTTGAACAACC CACTAAACCACTAGACGTGAGGCTCTAAGTCTACTAATGCCAACAAAATG CCATTGCAAGAGCATCCTCAGACCAATCACATTTCACGTTTAATTGATAG AAATTTCAATGGGTACATTTCTAagaatatcaaatgataaccTTTTCAGT GGTTCTTCGCTGAATACAGTCTCAGATGAAAAGGGGAGTTAGATTCTTCC TTAATTTTGTATAGGGATCATGCTATAATCAAAAAGGCAACATAGGAAAT TTCCTGAGATCCGAAATcctaatatttgaaaaatatgtaaaaGCACTTTT CACTGTCGAATACAAAAACTTCACAATGTTTTTGGAATCGTTGATACAGT GAAGAAATtatttaggcgtacaaactttcgcgagcagaaaatTTCGGCCT TTtccgcgaaagtaaatgtctttatcggatttaaggaatatttttcactt ttatccaacgattcgcgaaagtttatgctcgcgaaaaacattttttcctc aaattcgcgaaagtaaatgtcgtaaatttcgctatttttcgacctcgcga aagtttctgctcgtgaacgtttgtacgcctaaagtagtatcaagaaaatt ttgaattaaaattgagCGAACTATTGAGAAATGAGAACTGACTTACAATA AAAGCAACTCTTCGACGTAAAAAACTGCGCGGATCAGCAGCGCCAGGACA GCGCATTGTATGTATGAAAAAAAGTAGATCTACTATGTCGTAAGGAGAAG GGCCCATTCTTCAATGAGAAGGATTCATAACCATGGTAGTCTCTCGAACT TTGATTTTACGGGTCATAGTATCACTCAGTCAACTGACATTTAGCCCTTT CTCTTGTGAAACACGAATCTTTTTATTTGACGCAAGTGATACAAAAAATG TTATGAAAGAGAGTGCTGGAGGGTTTAAACTTCGTGTAGGAACACCTATT ATAGTACCATCAAGATGCACGAAGGTTCTTGGCGACATTTATGTGTTCAC TTAAGTAGCCCAAGATCTCTCTTAAGCTACACGAGAAACCAAAACCTTTT CACTTGCACAACTTTCGAGCGCTCTGTTTATGTAATGTAGTCCGTGCAAA AATAGCCTTCTTGAACTCTCTCTAGTGTGAACATATTTCTCTCTCAGCAA ACAAAAGGAAGTAAACTTAACCAGAATGTCAAGGGCTTGGTCATTTTTGG CAAACCTTTTTACAACTTATTCATTTACGTGAGCCAAAAATTGCCTAATC CGTTGGAGTGTCGTCTTTGCGTAAGCCGTTCACTTTTCtacttatttttc tcttttcctctctatttttctttcaaatcttACGTGTTTAAAGGTTTGCA AACAAGaaggtttttgttttgcttgttaTTTGGTGCCAAACAGAGATTAA TCTGGCGCCATACCACTtatcgaaaaatatcaacattatgATACAACTCA TGATTTAAGTGAATTGGCCTAATTGTCAATCGCGaattttttggataatt ttctCCATGATGTTGTTGAGCTTAAGTCGTGCTCACATCACCACATTTTT CGTCATTGGGTGAAAAACAAATCACGTGTTCACACACTTTCATTATTCGC ATCATTTGACTGTCAAACGCTTTCCAACTTCCTTATTTCCCAAAACAAta atttcatttataaaaaatgatcATCATTTTACGACCGTTTTGTTTCAACC AGCAAAAACATCCCATTGGTCAGTTTAGCGGAAATCATTTGTTTCTACTA ATCTCTTACAGTGGATAATTTTTCACGTTTTGATTGTTAACTGGTACATT AAACCAATTTAACAACACGTTGAAAGCCCAAAGGCCAAATTTCTAGCTAG CCATTGTATCGCTATGCTCACTGCATACCATTAGTATTTTACTAACTGAA ACAATATCTTCCTTAACTTGCCAACACCTTTTCTAGACATCTTTCTACAG CAGGATTTAACAGTGAAAATTGGAGATTTTGGGCTTGCTACCGTCAAAAC AAGGTGGAGTGGTGACCATGGCTGTGAACAACCTTCTGGATCCATCTTAT GGATGGTACGTAAAAACAAGTTCTCTAAAAACGGAATTTTCATGATTACT TTATAATTCTGATGCTGATCTTAAGAACAGGAAATGTTTACTCTTGAATT TTCTGGGAGAAAATCCTCGCTGCCAATTTTGTATCATCAAAGGTGGCGCT TTAAAGTACCATTGAGTTATTTTCCGTTTTTGGCTATCTGATGGGAAATC GTAATTCGACTATCAATGTTACAAAATTCCTCATTCgtgataaaatattt ctaaatctGAACTTTTACCATTTAGTCAGTGATTATGCAAAACAGTGAGT AATTTAGAATTGCTAGGGAACTTTTTCTTGATGATTGGGTAACGGTTCTA CATCTGACGCCTCTCCACCATTTTGTGGGTGGTTACCATGGGTTACCTGC CACAAATCACATTAATAAATATTTTCCGGAGCTAGGTTTAACGTTTTACG ATAATTGAATATTACAACATACTCACCGTTATCATTCTTGAACAATGACT ATTTTACTGTAGTCTGTACACACTCTAACACTGTAGACTCTCTCTAACAT AGCAACCTGATGAATATTACATAAAAATTCTTGAGATAAAATTGCTTGGT AACCCATATCCTTCGAGGTGTAGCCTTAAGTAATCAATTCTCAGGGATGA GCTTTTTAACTTGTCAAGTTTTAAATATAAGTGATCTTTTACTACAAAAC CTTGAATATAATCTGTTCCTCTTCTACTTGATCAGGCGCCGGAAGTCATC AAGATGCAAGACCCAAACCCATACACTTTCTTCTCAGATGCTTATGCATT CGGCATTTGTATTTACGAGTTGATCACCGGCTCATTGCCTTATTGTAACA TCGGGAATAAAGATATTGTAAGTACTACAACGAATTCTATGCTTATTCGA CCTAATAATCTCCAACAAACTATACAAATCTTGTTTATTTTCTACAGGTT TTCTTTGCGCGCAGTTTGGTTTAAAAGCAGATTGCAATAATCCTTCAACA GTGCTTTTCAATTCAATACTCCATTTTTCTTTCAGCTTATATATAGAATT GGGCGTGGTTTTATCCGCCCCGATCAAAGCAAGATTCGTTCGGATTGTCC GAAAGCTTTGAAACGATTATACCTGGATTGTATTAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000587XLOC_000587Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001026-exon-sc0000007-1491911889:783172..783326TCONS_00001026-exon-sc0000007-1491911889:783172..783326Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:783172..783326TCONS_00001026-exon-sc0000007-1510915933:783172..783326Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:783172..783326TCONS_00001026-exon-sc0000007-1575043694:783172..783326Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:800027..800134TCONS_00001026-exon-sc0000007-1491911889:800027..800134Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:800027..800134TCONS_00001026-exon-sc0000007-1510915933:800027..800134Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:800027..800134TCONS_00001026-exon-sc0000007-1575043694:800027..800134Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:802438..802725TCONS_00001026-exon-sc0000007-1491911889:802438..802725Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:802438..802725TCONS_00001026-exon-sc0000007-1510915933:802438..802725Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:802438..802725TCONS_00001026-exon-sc0000007-1575043694:802438..802725Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:802866..802969TCONS_00001026-exon-sc0000007-1491911889:802866..802969Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:802866..802969TCONS_00001026-exon-sc0000007-1510915933:802866..802969Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:802866..802969TCONS_00001026-exon-sc0000007-1575043694:802866..802969Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:803115..803163TCONS_00001026-exon-sc0000007-1491911889:803115..803163Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:803115..803163TCONS_00001026-exon-sc0000007-1510915933:803115..803163Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:803115..803163TCONS_00001026-exon-sc0000007-1575043694:803115..803163Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:803349..803408TCONS_00001026-exon-sc0000007-1491911889:803349..803408Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:803349..803408TCONS_00001026-exon-sc0000007-1510915933:803349..803408Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:803349..803408TCONS_00001026-exon-sc0000007-1575043694:803349..803408Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:803578..803645TCONS_00001026-exon-sc0000007-1491911889:803578..803645Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:803578..803645TCONS_00001026-exon-sc0000007-1510915933:803578..803645Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:803578..803645TCONS_00001026-exon-sc0000007-1575043694:803578..803645Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:803762..803854TCONS_00001026-exon-sc0000007-1491911889:803762..803854Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:803762..803854TCONS_00001026-exon-sc0000007-1510915933:803762..803854Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:803762..803854TCONS_00001026-exon-sc0000007-1575043694:803762..803854Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:803998..804130TCONS_00001026-exon-sc0000007-1491911889:803998..804130Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:803998..804130TCONS_00001026-exon-sc0000007-1510915933:803998..804130Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:803998..804130TCONS_00001026-exon-sc0000007-1575043694:803998..804130Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:804280..804337TCONS_00001026-exon-sc0000007-1491911889:804280..804337Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:804280..804337TCONS_00001026-exon-sc0000007-1510915933:804280..804337Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:804280..804337TCONS_00001026-exon-sc0000007-1575043694:804280..804337Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:804515..804765TCONS_00001026-exon-sc0000007-1491911889:804515..804765Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:804515..804765TCONS_00001026-exon-sc0000007-1510915933:804515..804765Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:804515..804765TCONS_00001026-exon-sc0000007-1575043694:804515..804765Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:805321..805432TCONS_00001026-exon-sc0000007-1491911889:805321..805432Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:805321..805432TCONS_00001026-exon-sc0000007-1510915933:805321..805432Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:805321..805432TCONS_00001026-exon-sc0000007-1575043694:805321..805432Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:805744..806005TCONS_00001026-exon-sc0000007-1491911889:805744..806005Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:805744..806005TCONS_00001026-exon-sc0000007-1510915933:805744..806005Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:805744..806005TCONS_00001026-exon-sc0000007-1575043694:805744..806005Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:806754..806800TCONS_00001026-exon-sc0000007-1491911889:806754..806800Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:806754..806800TCONS_00001026-exon-sc0000007-1510915933:806754..806800Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:806754..806800TCONS_00001026-exon-sc0000007-1575043694:806754..806800Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:808858..808976TCONS_00001026-exon-sc0000007-1491911889:808858..808976Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:808858..808976TCONS_00001026-exon-sc0000007-1510915933:808858..808976Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:808858..808976TCONS_00001026-exon-sc0000007-1575043694:808858..808976Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:809707..809838TCONS_00001026-exon-sc0000007-1491911889:809707..809838Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:809707..809838TCONS_00001026-exon-sc0000007-1510915933:809707..809838Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:809707..809838TCONS_00001026-exon-sc0000007-1575043694:809707..809838Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1491911889:810007..810107TCONS_00001026-exon-sc0000007-1491911889:810007..810107Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1510915933:810007..810107TCONS_00001026-exon-sc0000007-1510915933:810007..810107Clytia hemisphaericaexon
TCONS_00001026-exon-sc0000007-1575043694:810007..810107TCONS_00001026-exon-sc0000007-1575043694:810007..810107Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:783172..810107 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 1.61318e-09 0 0.519657 2.49723 5.63054 1.16028 1.76713 0.519068 1.84515e-08 2.87808e-08 0.264408 1.3662 4.9718 0.421941 1.04139 0.630658 4.24145 8.99835 7.42309 2.38738 0.405149 0 5.97587e-07 5.97714 4.61399 0.434362 0.390351 0 0
Blast
BLAST of TCONS_00001026 vs. Swiss-Prot (Human)
Match: ARAF (Serine/threonine-protein kinase A-Raf OS=Homo sapiens GN=ARAF PE=1 SV=2)

HSP 1 Score: 477.633 bits (1228), Expect = 3.224e-159
Identity = 267/590 (45.25%), Postives = 356/590 (60.34%), Query Frame = 3
Query:  477 SNGNSPHSSLRAHIRAFLPNNQRTMIKYKLGQTVREALYKAMSRRSLTTDSYRVYN--KANRELIAWDSDVSLLDGAEVIVEMIDEEDPSTQNISHNFVRKTFFRLAFCDKCTKLLITGFRCTTCNYRFHQKCAQGIPPLC-----------------------EQAEHSQIYKRLLAKQXXXXXXXX--------XXXXXXISQRERSISAPNVNMIGQPDSGLIEAVLEKHYKNRTNQETATISGGLTRQMSSGPSSGRGRITNTLFTPTSVSAPNSGENYFDFNTANSLPAPGNSKAQQISGIPDSLIHPARDRKNRIRSSSEEHKKPRR---RDSNDDWEIYADDLKIGERIGSGSYGTVYKGYWHGTVAVKTLNVKDPNPQQLLAFQNEVGVLRKTRHVNVLLFMGCLSSPNLAIVTQWCEGSSLYRHLHVLEKKFPMHNLIEIARQTAQGIDYLHAKQIIHRDLKSNNIFLQQDLTVKIGDFGLATVKTRWSGDHGCEQPSGSILWMAPEVIKMQDPNPYTFFSDAYAFGICIYELITGSLPYCNIGNKDILIYRIGRGFIRPDQSKIRSDCPKALKRLYLDCI 2138
            +NG  P  ++   ++ +LPN QRT++  + G +V ++L KA+  R L  D   VY   K  + + AWD+ ++ LDG E+IVE++ E+ P T    HNFVRKTFF LAFCD C K L  GFRC TC Y+FHQ C+  +P +C                        +A  ++    LL  Q P+  T          P+      QR RS S PNV+M+         A ++ +    T Q  +T + G     S G S G  R + +   P SVS+     +               S A+Q            R+RK    S +++ KK +    RDS   WE+   ++++ +RIG+GS+GTV++G WHG VAVK L V  P  +Q  AF+NE+ VLRKTRHVN+LLFMG ++ P  AI+TQWCEGSSLY HLHV + +F M  LI++ARQTAQG+DYLHAK IIHRDLKSNNIFL + LTVKIGDFGLATVKTRWSG    EQPSGS+LWMA EVI+MQDPNPY+F SD YA+G+ +YEL+TGSLPY +IG +D +I+ +GRG++ PD SKI S+CPKA++RL  DC+
Sbjct:    9 ANGAEPSRAV-GTVKVYLPNKQRTVVTVRDGMSVYDSLDKALKVRGLNQDCCVVYRLIKGRKTVTAWDTAIAPLDGEELIVEVL-EDVPLTM---HNFVRKTFFSLAFCDFCLKFLFHGFRCQTCGYKFHQHCSSKVPTVCVDMSTNRQQFYHSVQDLSGGSRQHEAPSNRPLNELLTPQGPSPRTQHCDPEHFPFPAPANAPLQRIRSTSTPNVHMVS------TTAPMDSNLIQLTGQSFSTDAAG-----SRGGSDGTPRGSPS---PASVSSGRKSPH-------------SKSPAEQ------------RERK----SLADDKKKVKNLGYRDSGYYWEVPPSEVQLLKRIGTGSFGTVFRGRWHGDVAVKVLKVSQPTAEQAQAFKNEMQVLRKTRHVNILLFMGFMTRPGFAIITQWCEGSSLYHHLHVADTRFDMVQLIDVARQTAQGMDYLHAKNIIHRDLKSNNIFLHEGLTVKIGDFGLATVKTRWSGAQPLEQPSGSVLWMAAEVIRMQDPNPYSFQSDVYAYGVVLYELMTGSLPYSHIGCRDQIIFMVGRGYLSPDLSKISSNCPKAMRRLLSDCL 550          
The following BLAST results are available for this feature:
BLAST of TCONS_00001026 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
ARAF3.224e-15945.25Serine/threonine-protein kinase A-Raf OS=Homo sapi... [more]
back to top