Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001025 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001025
Unique NameTCONS_00001025
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length401

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001025 ID=TCONS_00001025|Name=TCONS_00001025|organism=Clytia hemisphaerica|type=transcript|length=401bp
GTCAATATCGTATTGTCTTctaccaaaaaagtggatttaaaacaaaatat
ttacaaagTCTATCAAAAATGTATCTCTACATAAAAATCAGTCATCGTCA
TTCCTCCTACGAACATTCCGGTTTCCGAATTTCCGTTTCTTGAAAGCAAC
TGGTGCATCGGATTCTGTGGCTAGACTAGTTTTCAATTGTCTCTCTTTAA
ACTTTTTCCCCGCAACAGGTTCTGCAGGCGTTGTTCCGCTATTTTCGGGT
GCTTCCGTTGTCTCTGTAGGTTTTTCCGCCCTAGATTTTGAGTAAGTAAA
CATCAATTCCTTCTTAATCTTGTACAACATTACTTAATCCTTGACATTTG
ACTTAACCAAAAGTTCAAAGTTCACATTCATAAGAACGATTGAAGTCAAA
A
Run BLAST on NCBI

transcript from alignment at sc0000007:781524..782434+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001025 ID=TCONS_00001025|Name=TCONS_00001025|organism=Clytia hemisphaerica|type=transcript|length=911bp|location=Sequence derived from alignment at sc0000007:781524..782434+ (Clytia hemisphaerica)
GTCAATATCGTATTGTCTTctaccatgaacatataaacgactggacatct atcttttattgtctctttgaagcgagcttcgttgccgcctgtatttcaaa attgataaatgaaaaatctgacaatattccgtcgtaattttatttctttg aattgtttaggtaaaatgattgatagagcttgaacattactcctaatgca caaaaaaaattttaaaattttttcacgagtttgcaatatattttatcaac attttcaactctgaaatgcagaatttcaactgcgtgtatacttttgaatc ccttttgtcactccaataattttttttatgacttgaaaaaaataacttgc caaagttgagagcctgtgtcataagaatatcgacttgagaagagtagaac aacaaaAGACTTTagtcgaaattttgacgttgttagcaaggtattcccaa gaggtataccaACAGAATTTATTGTtacatttgatgattttaacgaggcg gcaacgaagctaacAGTgctatcttcaaaaatacaaaaaagtggatttaa aacaaaatatttacaaagTCTATCAAAAATGTATCTCTACATAAAAATCA GTCATCGTCATTCCTCCTACGAACATTCCGGTTTCCGAATTTCCGTTTCT TGAAAGCAACTGGTGCATCGGATTCTGTGGCTAGACTAGTTTTCAATTGT CTCTCTTTAAACTTTTTCCCCGCAACAGGTTCTGCAGGCGTTGTTCCGCT ATTTTCGGGTGCTTCCGTTGTCTCTGTAGGTTTTTCCGCCCTAGATTTTG AGTAAGTAAACATCAATTCCTTCTTAATCTTGTACAACATTACTTAATCC TTGACATTTGACTTAACCAAAAGTTCAAAGTTCACATTCATAAGAACGAT TGAAGTCAAAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000588XLOC_000588Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001025-exon-sc0000007-1491911889:781524..781547TCONS_00001025-exon-sc0000007-1491911889:781524..781547Clytia hemisphaericaexon
TCONS_00001025-exon-sc0000007-1510915933:781524..781547TCONS_00001025-exon-sc0000007-1510915933:781524..781547Clytia hemisphaericaexon
TCONS_00001025-exon-sc0000007-1575043694:781524..781547TCONS_00001025-exon-sc0000007-1575043694:781524..781547Clytia hemisphaericaexon
TCONS_00001025-exon-sc0000007-1491911889:782058..782434TCONS_00001025-exon-sc0000007-1491911889:782058..782434Clytia hemisphaericaexon
TCONS_00001025-exon-sc0000007-1510915933:782058..782434TCONS_00001025-exon-sc0000007-1510915933:782058..782434Clytia hemisphaericaexon
TCONS_00001025-exon-sc0000007-1575043694:782058..782434TCONS_00001025-exon-sc0000007-1575043694:782058..782434Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:781524..782434 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
6.29973 5.38808 0.0477797 0.645371 10.8154 11.7306 16.6172 8.89779 2.30679 5.5265 0 1.69511 2.58022 4.99093 1.66235 1.54542 2.96126 0.0529679 2.67827 3.03669 2.96557 0 7.17983 3.25007 6.24074 5.25521 3.21351 2.38241 2.56367 2.75941
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001025 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top