Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001023 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001023
Unique NameTCONS_00001023
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2562

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001023 ID=TCONS_00001023|Name=TCONS_00001023|organism=Clytia hemisphaerica|type=transcript|length=2562bp
GAAGGAAGAATTACAAAAAAGAGTATGAAATTGATGATAGCAAACTGGCT
CAAAATGTGGAAGAGCTGTTTCAGTTGACGTCAGAACAACTTCAAGAAAT
GACAAATATGTACAATACTGGAAACTTCGCCCATCCACCTTCCATCTTGT
TTGAGGAGATCGAGGAGCTAAAGACAAAGCTGGGAACCATCAGCAAGCAA
CGAGATGAATACTCAGATGCAATGAAAAATGGCACCGCCCCTCCACCCGT
ACCGCCCCAACAACAAACTTCCACAAACTCTAATAATTCAGATTCTGACA
GTCAACCATCCTCACCTAACTTAACAAGAAGCACATTAAACTCGTTCAGC
GATGGAAGTTACAACCAAAGCAATGGAAATTCCCCTCATTCTTCGCTAAG
AGCGCACATTCGTGCTTTTCTACCAAATAATCAAAGGACTATGATTAAAT
ATAAGCTTGGACAAACGGTGAGAGAAGCACTTTACAAAGCAATGTCGCGT
CGTTCACTGACCACTGATTCCTATAGAGTTTACAACAAAGCAAATCGAGA
ATTAATCGCTTGGGATTCGGACGTCTCACTTCTAGATGGAGCAGAGGTGA
TTGTCGAGATGATAGACGAGGAAGATCCAAGCACCCAAAATATTTCACAT
AATTTTGTGCGAAAGACATTCTTCCGGTTAGCGTTTTGTGATAAATGCAC
GAAGCTTCTAATCACGGGATTCAGatGCACAACATGCAATTATCGGTTTC
ACCAGAAATGTGCTCAGGGGATACCTCCTCTTTGTGAGCAAGCTGAACAT
TCACAGATTTACAAGAGGCTACTAGCAAAACAGAATCCAAACAGTAACAC
GAATATCCCTTCAACACCTCGACCAATCTCTCAACGCGAACGTTCCATAT
CTGCTCCCAACGTTAATATGATCGGACAACCTGACTCGGGACTCATTGAG
GCGGTTCTtgaaaaacattacaaaaacCGAACCAATCAAGAAACGGCAAC
TATATCAGgtGGTCTCACACGTCAAATGTCAAGTGGACCAAGTAGCGGGC
GTGGACGGATAACCAATACTCTCTTCACGCCCACTAGCGTTAGTGCGCCC
AATAGCGGCGAAAATTACTTCGATTTCAACACTGCTAACAGTTTGCCCGC
ACCAGGAAATTCCAAGGCACAACAAATCTCCGGcattcctgactcgctaa
tacaCCCGGCACGCGACCGTAAAAACCGGATACGATCGTCTTCGGAAGAA
CACAAAAAGCCTCGCCGTCGCGATTCGAACGATGATTGGGAGATTTACGC
AGACGACTTGAAGATCGGAGAGAGGATAGGATCAGGCTCTTATGGAACTG
TCTATAAGGGATACTGGCATGGCACAGTGGCGGTAAAAACGTTGAATGTG
AAAGACCCCAATCCTCAACAACTATTAGCATTTCAAAACGAAGTCGGAGT
TTTGCGAAAGACTCGTCATGTCAACGTTCTACTATTCATGGGTTGTCTCT
CCTCACCTAACCTAGCTATCGTTACTCAATGGTGCGAAGGTTCCAGTCTC
TACAGACATTTACACGTTTTGGAGAAGAAGTTTCCTATGCATAACTTGAT
AGAAATTGCGAGACAAACTGCTCAAGGGATAGACTATCTTCACGCAAAAC
AAATTATACATCGTGACTTGAAGTCAAACAACATCTTTCTACAGCAGGAT
TTAACAGTGAAAATTGGAGATTTTGGGCTTGCTACCGTCAAAACAAGGTG
GAGTGGTGACCATGGCTGTGAACAACCTTCTGGATCCATCTTATGGATGG
CGCCGGAAGTCATCAAGATGCAAGACCCAAACCCATACACTTTCTTCTCA
GATGCTTATGCATTCGGCATTTGTATTTACGAGTTGATCACCGGCTCATT
GCCTTATTGTAACATCGGGAATAAAGATATTCTTATATATAGAATTGGGC
GTGGTTTTATCCGCCCCGATCAAAGCAAGATTCGTTCGGATTGTCCGAAA
GCTTTGAAACGATTATACCTGGATTGTATTAAGTACAACCGAGACGAAAG
GCCGCTTTTCAAACAGATCGTGAATTCTTTGGAAACCATATTGATGGCAC
TACCTAAGATTACGAGGAGTACTTCTGAGCCTATTTTAGGGCGTGCAAAA
CCGAGCACAGATGTTGAAATTGCTTACCCATGCCCCACCCCTCATACGCC
CATCCAAGGGCAAGATGTATTCAGCTTTTTGTCTGGCCAACCGCAACCTG
TGTATTAGAGTGCTTTTGAGTGAATCTAGAATGAATCACGAAAATggaat
gaatgaatggatgaaatgaatgaatgaatgaaaattcaaaGGAAAGTTGA
TTAACGTagcaatcaaccaatcaaagaAATGCCAGTGCCAAATAATCTGG
TTTCAGAATGATCccaaatcttaaaccaatcttTTTTTGTCAATCTTTTT
ATAACTATACTTCATATGGCATAAGTGTAAATTAATTCAggtgaatttat
ttatttatttaaagtaaaaaaaaacactaaaattcctgcataaaattttg
attttgacaaca
Run BLAST on NCBI

transcript from alignment at sc0000007:781407..811964+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001023 ID=TCONS_00001023|Name=TCONS_00001023|organism=Clytia hemisphaerica|type=transcript|length=30558bp|location=Sequence derived from alignment at sc0000007:781407..811964+ (Clytia hemisphaerica)
GAAGGAAGAATTACAAAAAAGAGTATGAAATTGATGATAGCAAACTGGTG AGTACTTTCCCGCCCAATCAAGTCGAGCAAAACCAGGGTGGGGAGGAATA AAATTTGAACTATTGTAGTCAATATCGTATTGTCTTctaccatgaacata taaacgactggacatctatcttttattgtctctttgaagcgagcttcgtt gccgcctgtatttcaaaattgataaatgaaaaatctgacaatattccgtc gtaattttatttctttgaattgtttaggtaaaatgattgatagagcttga acattactcctaatgcacaaaaaaaattttaaaattttttcacgagtttg caatatattttatcaacattttcaactctgaaatgcagaatttcaactgc gtgtatacttttgaatcccttttgtcactccaataattttttttatgact tgaaaaaaataacttgccaaagttgagagcctgtgtcataagaatatcga cttgagaagagtagaacaacaaaAGACTTTagtcgaaattttgacgttgt tagcaaggtattcccaagaggtataccaACAGAATTTATTGTtacatttg atgattttaacgaggcggcaacgaagctaacAGTgctatcttcaaaaata caaaaaagtggatttaaaacaaaatatttacaaagTCTATCAAAAATGTA TCTCTACATAAAAATCAGTCATCGTCATTCCTCCTACGAACATTCCGGTT TCCGAATTTCCGTTTCTTGAAAGCAACTGGTGCATCGGATTCTGTGGCTA GACTAGTTTTCAATTGTCTCTCTTTAAACTTTTTCCCCGCAACAGGTTCT GCAGGCGTTGTTCCGCTATTTTCGGGTGCTTCCGTTGTCTCTGTAGGTTT TTCCGCCCTAGATTTTGAGTAAGTAAACATCAATTCCTTCTTAATCTTGT ACAACATTACTTAATCCTTGACATTTGACTTAACCAAAAGTTCAAAGTTC ACATTCATAAGAACGATTGAAGTCAAAAAGGAACTCAAACCCTTTGAAGC AGAGCAAAACACAGGTTTTACGATCTGCGAGTAGAAAACCATGTAATTGA TGACCGAGGCAATTGGTCTTTTcctaaaaaaactaaacaaatTCTCTCTA GTCAGGGGAAGACTTACGGCTGTTCTTCTTTCACATTTTGTTCTTCGCTC GTCTCTTCTTGAGCGGTGTTATCGTATCGTTTGACGGTCGACCATCCACC TAACAAAGGATGAGAGTCTCGAACTTCTTCAGGAGGTTCTTCTTTCTTGG GTTGTGCACGATAGGGATCTTTTGAAGCAGTGCTTGTACTTGATGAATAT GACTGAAGGGAAAGGAGAGTTCATTTTTGTGtattctcaaaatattttcg taCAAAATAAATCTCTCCGAGGAACTTTTCTCGAACTCTGTCCTTTCTTG TTGCAAGGAATATGTAACATCAATCACTGGGCTTGAATGTAAAACGTTTA TGGATAATGGTCAGTTAGTTTTGGATAAACATATGAATTATGAACACTGA TAATCAAAAAGAGTTTAAAAGTTGACAATGATATCGGGTTGTCTTGGTAA CTCTCTTCTAAAGAGTAAAGAAATCAAGGGAAATTGACAATAAGTGTAGG TTTTAAAAGAGGATCAAAAATAAGAGtcatttcttttcatttctcGTCAT AATGCTACAGACGGAAGctaactcaaaaaaaaattataaggtGAACTTCT CTCAAAACCCTGTCTTTTCTTTATCTGACTTTCTGATAATTAGCTTTTAT AGCGTGTGTTTATTTCGAGAGAAGAGAGGGGAGAGAAAATCAGCTGATTG CTAGAAACTTGATAACAACGAGATGACAGGGTCCAGCATGGATGACGAAG AAAGTATGCGCAAAATCTCCGTAAGTCACactcaattattttcaattatg TTACCTATCCATTTCAAGCATTTTTACAAGGTTTTTGTAAGTTGAAAACC TATCAAAGTTGTTATGGTCAACATATTTTGTACCCATCAATGGTAATTAA ACGTAATTTAGTTGACGACAATATCGTCTTAGTGAAAGTAAATGGACGTC AGATGACGGATTTATAATTCTAGGAAAACATGAATAAAGGGAagcaaatg aaaaatatatagaaaaaaactttgcaaaagcTACCTTCGATGGTTTACTG ACAGTCTTCGTTGAGGTGTCCTCGGCAGTCCTGAAAGAACAATAAATCAA GCACGCTCTTTGTCAATTAGACACTATTATACAACCAGGGGTTGTTCGAG TTTATCGTTAACATGTAgaatatgagcaatctgattggctaaaaacgcgt acataaatgtACCGTGCAAATACAAGAATTCATTCAAAAAAGGGGTCTGG CAAGCGAGATATCATATTTTGTACTTACTTTTGTATCTTATCCCAAAAGT TATTCTCaagaatgtttttattttttctctcaatactcacaaaagttgtc atgtTTTAATACTTTAATGACCATTCGAATCATTTTCGAagatttgaatg ttttgatgttgatttcaccaaaatacagaaagtgaaaaaaaaacaaagaa gagaGAAAACACAAATAATGAAATGGAGAGAGAAAGGTTTgctgatattt ttcaagttgatcCCGTTTTTGTGCTCTGTACCGTGCGGTAACTATTACTT ATTCTTAGAAACAAACGAATTATAGAAATCACATGACACGAACCGTTTCT TTTTCTCTAATTGGTTTTTCACGATTTCTGGCATCACCCAAGTagattct ttgaaggaaaaaatatatcaaaaattgtGTTAAATATCATCCGTAAACCC TTCAAAAAAACGATAATGTTACCCAGAGATTACAAGACCACTAAAGAAAT CTTGGTATATCATTAAGCTGTATACTTTTTAAAAGAGTAATCTTGTACAA ATAAAACCAAGAGATGAGACAAACGATACAAAGGTATACCTCAGAAGGAA CGACTAGTCGTCAACAATACCTCCACTCGTTGCATTGTAGTAATATGTTG TTCCTTGTGGCCCAGCCATCACTTGCCATGGATAAATATCTTTGTTACTA ATATCATCATTTCCCGATTCTTCTGTTTTAGAGTgagctattttttcaaa agaaagtaATTGGTACAATAATGAAACACCTCTTCTGTTATTTCGATTTG AAATTTAAGTTTGATCGTCGATTGCTCATGCTTCTAAAGCCTCCTTATTC TAAGACTTTAAGTTTACAAACTAGgtacttttgtatttttcaattttaca aaacattttaaaattattttgacattATCCTTTCATCTTCTTCCACAGTT TAATGACATAAAATGGTGTGCACCTTTGACAATATTTCTCATGTCAGCTT TACCAATAGACACATCTGAGCTATTCATATCTTTTTGAACGGCAGCCAAC GCAGCCTAAAATAAAGGAAGGAATTTGTGTAGAGATAGATAGATATGTTA TATTTCACTTATTATATGTTTTCTTATGAGTGAAATCAAATGGGTCAAAC AAGGTACAAACTTACAGGAAATcatgaaagataattttgaacattttgtc gGGAATCAAAGTGGGTTACCTTCTCCATCTCTTGGAACATGTGTTgggat ttttcatctttctttcGCTTTTCGATTGAGTTTCTTTTGATCTGAAAAGC ATGAGAATGAGGGAATAAAGAAAATGTAAGATGGTAATTTTGCTAATAAC AATAATTTACCATTTGCATAATAGATGTTTGTTATTATCAAAATGTAGAA AATCGAACACAAAAAAATTACCTCTGCGAGTCTTTTCTTCACATTTGCCT GAtgatttttacctttttcatgaaattgtaTACTCTAAAAAGGAGAATGA AAGCAACAAAACGCAATGTCCTTCTATGTTTGATTTAGTGAAAagtgaaa tatctaaaaatttcttGAGATTTTCAATTAAACTTAAATAGTACTCAAAT GAATACGATAGAATTGTAACTTCAGTACATAATTGGAAATTTCTAGCGGT attctaatggtatttttgtcttgaTCCTTTGTTCAATATATAACTTCAGT ACATATGTGTTTGAGGAAAAGGAGAAATACTCATTCATTGTAGATGTCCA GTTTCGCTAAAAAAATAATCAGACACGTCTGACCCTAATTGTCTAATTGA CTTAATATGGACCAGGctattttactgatttttaaGCCCTGTGTAGAAGA CCCGATATTACCCCAGTCTCAATATTACTTACAGGTTTATTATCTGCCGT CCAGCATTTGCAAAAATCACAATAATGTTTACCAGTTGATTTCCAGTAAT CTGCCCTgaatttgaaaagaagaaagttaAGCGAGACATGCAGAATACTT TTACCTTGTAGACATATTTgacactaaagcaaagaaacaTAAAAACTTCT TTCATAACACTTGGAACAACACTTATAGTAGCCaaactagccgtcacccg gcgtcgcacccgccgcgTAGaatgttgttgaacacatcaattcacagcaa aaatttccacgttttaaacgcacgtggaagaaaatgtcaagtttacgaca aaattgaaagttttccacattttaaacgcacaggGAAGAAaacgtccaaa ttcacaaccaaaagttttccacgttttaaacgcacgtggaagaaaatgtc aagtttattatgtcgcacccgccgaggagtagataagctgaacgcatcat aagccctttggatggtggggaggGTAAAAAGATCTGGTTGGTAAATCCAG ACAACGAAAAATTACTACTTTAAAtggttgaaaactaaaaatattgcaaa tttattgttttgtgacgtcatttggaccctaaaaagtgagtcggtcgatc taaaaagtgagttggtcgttctaaaaagtgagtcggtcggtcgttctaaa aagtgagtcggtcggtctaaaaagtgagtcggtcggtctaaaaagtgagt cggtcggtcggcctagaaagtgagtcggtcggtgtaaaaagtgagtcggt cggtctacaaagtgagtcggtcggtcggtcgggctaaaaagtgagtcggg cggtctaaaaagtgagtcggtcgggcgttctaaaaagtgagtcgggcggt ctaaaaagtgagtcggtcggtcggtcggtctaaaaagtgagtcggtcggt cggtctaaaaagtgagtcggtcggtcggtctaaaaagtgagtcggtcggt ctaaaaagtgagtcggtcggtcttaaaagtgagtcggtcgttctaaaaag tgagtcggtcggtcgttctaaaaagtgagtcggtcggtctaaaaagtgag tcagtcggtcggtctaaaaagtgagtcagtcggtttaaaaagtgagtcgg tcggtctaataaGTGAGTTGGTCGGTTTaataagtgagtcggtcggtcta ataagtgagtcggtcggtctaataagtgagtcggccggtctaataagtga gtcggctgttctaaaaagtgagtcggtcggtctaaaaagtgagtcggtcg gtctaaaaagtgagtcagtcggtctaaaaagtgagtcggtcggtctaaaa agtgagNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNTAAGTGAGTCGGCCGGTCTAATAAGTGA GTCGgccggtctaaaaagtgagtcggttggtctaaaaagtgagtcggtcg gtctaaaaagtgagtcggtcggtctaataaGTGAGTCGGCGGCCGGTCTA ATAAGTGAGTCGgccggtctacaaagtgaggcggtcggtcggtctacaaa gtgaggcggtcggtcggtctacaaagtgaggcggtttaatttttcaaata tacctAGCATGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNAATAGAAGAGAAGAGATTgcatctctca tgccaaaccaaacgaagcATCAAATCCAGGAAAGATTAACAATAAACTTC ATCATCgtccatttcttgtaacaattacacaaaaatcatgatccaattca actcattaaagcataaaacacaaagaaaaagagcaaatgagcagtagcaa ccagttgtttttttgccgccatctttattttgactgttagaaagcagtat ggtccgatcaaaaatacgcttccgaaccgggcgacgNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNccgaaccgggcgacgtttcccgatcggcaaggaaccgtaggcatgttt tccgatgacgtgtctcaaaagaaacgtactccgcctcaaaaaaaaaactc tacTGTTTTCCCcctcggagctcgatttaaaaagaaacttggaaaaaaat ccataatggcccccccacggctcactcacattagacttttagtatataga ctagaaTATGCATTTTCACAACTATTGAataaattaaatatttcataata CAGTAGCTTGGTCTTGTTACTTACCCTAGCTTGACCAGAAAAGTTTAGTA AGGCTGGCTGGGGGACAGCTATGTATGAAGGGAATTCTTAGAAAACTATG TGAAACTTTAGGTAAAACGTCTTAtgccttttttgacattttttaaaatt gacattttaggtttttgaacataacttttgaaccaataaagtaaaatgaa aaagtaatacaccaaattttaagttaggctttcctctgaatgattccgaa acaatctttgaaaaatctttctgcTACTGCCTGCAATATCAAATCGAAGA GTGTAAattttttgtggcacacccggtagaacctttgcaaaaaaaaggca GGAAagatagaaaagttgtatttttactGCTCtgttcacatactgaattt gaaagatcttttatgtggcgtttttttgcaaacttaaaaaaaatgatttt tgtcttgcctttgcgggactttggcttaagtgcagCATAGATaaggtaca aagtccaaacatgcctttaccataaattttatatgaagagttaggtctat actgtcagTATAAAACCTTGTGACTAAAATTTAACAAAAGGGTTAAAAAC TAGGGAAAACTAAGGTATTACACACGCAAGAGGTTGGGAAGTTTCAGACT TCCATAAAGTAACTCAcgttataaagaaaaaatacaagTATTTATTGCAA TTCATATAAACTGTTATTTAAGTGATTGCAAAGAGAATGGGTTGACAATT CAACTATGGTGTAGCAGTCGAGTTCCTGACACGCTAAGGGTGCATGATAC ATTAGGGGACAATCAGCTTGATCATAATGAATAACTGTGACACTGTTTTT ATCATTTCGTCTGGCTGCGTTGTTATTTATGTCATGCTTACGAGGATGGC tgtcagtcagggaaatccctcaattgcggtagttttcattcgtgtttagc ctacaaaggcttataatgactacatatagtgctggtcgacaaagataaac aaacatcgactATAAAAAATCGCattaaaagaatctgatctacagaaaaa atattttgtctgtgtgTTAAAAAGACAgatagggaaaccatccaggatcc tgccattctataagccagcaaaagcTACCTTAAGtctcttaccattttcc atcgaaaacaaccataaacattgctacttcccaaagccggagaccgaaac aaattattttccaagattatggcgcccttttggatctattgttaaggcca tctaaaatggcgGAAAAAGTTGCTGGAAGACAAAGGCGCCcgctgcttcg agggtggtaacgctaataagcccaatatgatcttccaacagaaggtgagt tagttgccgcgcgagttacgtcatgcactccaccccgcagcgcacaacga agcgtgtttcaatgaatatcattaattataagaatatcttatgtgcttac cttcagtaaactttgagtgcttcattgaaaatgaagAAGGTAAGAAGATA AAAAATGCGCGCTGGATAATTTTCattgtaacagtttggtcaaatgtcgc aaaaaaaagtttcagctAATTAAAAACACAGTGTGCTTagacttactatg tttgctacattgtctagactaaaaaaagtgcgaaaagacacgaacgccat tttttaatgagaggaccctgccgacgcaccggactgtccggtgtatttgt ccggtggcaaaaagNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNgatcaattatgtacaaaaattgcctgttttttccttgaatcttgaa ttctgattcttgaatatactgcaattgcggtatatgaaaattgtaaaagt gACGTTTGCAATAATTGCAGTAAAAAtttactaccgcaattgagggattt ccctgactggtTGTTAAAGAGATTTGTCAATGATTTGTTAAGTGCTCTAG AATCAAATCATCCTGCAATAGCCTTGGAGTATGTCAATATGATAAAGTAA AAAGatacttacattttttttggttttaataGAAAATTTCCTAAATTCAC AAAATGTGATCTTGATCTGTCGAAAATTCAATATGGGTCAAATTAGAACA TTTGAATACGGGTGCGGGTAGAtgtagaaaatcaaaacattgcttAGAAA CTGACCGTTTCAGTTGCGTGTTTAAAGTCTGCCTTATTATCATATGCTTA GTTGGTCATTATTTTAAAACTAACATCACGTGACCTGTTCTTGAAGAAGG CTAGTTAACATGGCGGCGACGTCGGAAAACAATTTATCTAACATTGCAAG AATTTCTGGAGGAGATTTGACGAGAGAACATCGTTCTCTGACTATCGACA ACCTTAATTGTGGAGCAGAAGTAGATACAGGGCACTTTCAAAGCAATGGC ATCAGGGCTTCGCAGATACTTAGCGAGGTTAGTTAAACCAAAGGGGAAAC CCCCATATTTTTTATTCTGCATATCTTTACACACAGCTCATTTGCTGTAT GATCATTATTGCATTATTGAGAAATCAGATACCAAAATCTACTGATCAAG AAAAGTATGATAGTTTCATATGTTTGAATTTTTCACTTGTAGGGGCTTGT AAAATGGGGAGAAGTTAGTATACATGGCATAATCTCCGATTGGGGAAAAT AAACTGGAAATTGAAGGTACATTGgggggccattccagaaaacttttttt acccCCCGTCGGACAATgtgcatttttgaattttttctagccttggaaat aatttttcttttccagtggtggtcggaaatacacctttcccgtaattcgt aaaactaatgcgcgcgcattattttgatgctctccaccgtttggtctctg gaggtaaacaaacctgcttttgcctgcgttcccttagggaaagttggttt tttgagattttcttaaGTTTGgtcgaacaaaatcccctcaaattttagta tgttcaatctatttatgatattataccaccctgaaaatattttgccaaaa gaaggtcgctgtcaaaagttagaggctcaaatcccactttccctaacccc tcgcaggcaaaaacgcgttttttacctcccaaacaattttatacacaacg gcggagcgcacattttcccggccatttctgagaaatttgaattacgggaa aggtgtattctgataaaaatccatgtacttttgcaaaatgcatcggaaat aaTTCCACTCTTTTTCCAAAACATGACCCTAACCTGTCCCACACATGTAC TGGCCAGGTTTTCGGAGTTGAAAATCCAAAGTTTTTGTGGCCCGAACTTG GCTAGATCATCAATATGTTCAGCGAACTGAGAGAATGTTCTGATATTTTG GCCTGAAAATATTGGTAGTATATGTCATTTATGCTGCAAAACCTCGCGGC CATTAATTCACCCCTGACCGTTGCACTTTTCTAACGGgcagtctaagctt aaactcctatatcaggattagaaactaggctagacTTACGTGAAATCGGG TAActtacatcagtggaggcaaaaatgcatagccctcaatcaaatgaatg acctgtctggtcattaaaatacacaaagttaaatcaaaacaaaaatgata gagtagatctgcatagttcatttgttttgaaattttgctgctcacattgg tcagtcatttgaaggctatgcatgttacacaagtgttacgcgtgaGCCAA ATCGCATTaagaacaacctctaaattgctgagtacaggagaaaaaaaatc gaaattcaaaatggcggcaaagcccacgctgataactatcaaaaatctct gctcaataaatcaataaaataatttgaaataaaaagtaaacaaaccttga acctttcaggaatccaaataaataaaagtacaATATAAAAGTACAAATAG TAAGTACAAACAGTAAGTacaaatataaaagttttttttttaagaaacta gttttaccaagcagcctcaatgtttcttaagaaatcggccttttgagcct taaatgtttcttacatgtttctaaactttttgacgtaATCAGCCttatgg aaggctggattggaaggttcttaaaaaagcTGAATTAgaattattttctc attctcagtcTCAGCatgtttattagtttttaggcattctgagcctcgtg tttcttaaaagtgtgtttcttaaaaaaaaacaatgtgtgttcatctaaag tgaagattacatttcaaaataaaacgatttccaaaccaacctaaagtcag tgtctgccaactaaaaatttctctgcggggtcactgccaaggagttacga cttcagactttagattccaattcttgtataggctgcaactacacagccaa aatgatctgtattacaaatacttccaaatgggtccataagttaagaaaat gaaattatcatctagcagggggttttgtttttaaaaacaaacttcaaaat aaaattgttaatgaactttttactttaaaaaatatcacttacttacataa tttatttatgatataacatataAATGGTATAAAtggccgcaagaagggag aaaaatttaattcgacCCCCGgttttatctttctttttctatctggttcc cgcgtgttagtgtagacacaactttaatccagggaaatgaagcgttttca ttggtctaaaatcacggatggtcacgtgaccagaatttttatccagggaa atgccgtggccgcaatgttttgctttagttaGATTGagcattttgttgtt ttggatttgagcgggcgaaatttctgtacaaaccaaaatattcattggaa taccggttgaaacacttgtggtTAGCCTCTACTACTGATGCAAGTCACCC TTTATTACGGTACCTCTTATCTTTCcctttaaaacaataaaatgcttaca agttgacacaacacattgacaagtaatcaagtttatatcaaaatcttcaa caaaaacgaaagtggtctcttctactgattgcttcctggCGCTCCTTTGC agttgtttatcaaatttccactaATGAGATTGCCACATTTCACacagccc ttctttttggcacctgtggcctctcagtgccttgcaaaATGAGTGGCTGT AAAATTCCACCCTTCACATATTgctttcaatccgtgatcctaaTGCTTcg gttttttctcattttcgatttactgaagaaagcaagaatttgatgcaaga gttagattgtcaacaaagtgccatacGAAATCATGTaagaaatcattgaa taaaagaagaacttaaatcttaaatactttcattttgaagaattggtgca aaaagtgaaacatggaaaagctTCATCTTTTATTGGTTCAATTGAATTAG GGGATTTAGAAAACTttgtatgtttgtttttttgcccAAACCCCTGTATT TATGGGCTAGCACCCGTTGCTAAGATattggcttgaaattgaaagtgaaa gcactgaaaacgaaagtaaaatcgacCCGCACTCcgaatcccgtaatctt gataaaGGATAGGAGTTTAAAAAGTAAGACTGctgggtgcgccacaaaaa ggtttctttttttgaaaacttgattttctcgagttaTATTAACTAGATAA CTTTCAAGAGAAAGAAATCCTTTTCTGTGCCTGTGTTGCGTTCATTAAAA AAGGAAGGCAAACTTGAATCGCTCAATGAAATTTAGTGCATAGAAACCAC CCCCGCGTGAAGTTAACAGATCTGGAAATACAACGCTagatttttatgga tttttgtAGATATTTGTGTTGCAGAGCGCGCATGTTTCATTGCagaatta ttttcatatttcaattttaaaaagccTACTTGGTGTGAAAGTATAATTgg gtattttttaatacgccattcattaactcaaatcaaacgactttggaggt tcagtgaaatggtggacgaaatgaaaaaaataaatgctcaaaaacattca aaatcataaaatatcaaatttttaaatAGAAACATGATCACATTATATCA GTATTGTTGTTTTAGTCCTAAAGAtaataattagctgtctaactGACCTT TTGTTTTACAAGGGTTCGCTGACAAATCAATTTTTGGGATAGAAAAACAT CAATTGACTCACATCCACCCACCCACACCCTAAAACATCAAACACctgaa aatcaatgaaaaactgCCTTTATcgctgtttcgtcagccatcttgatttt cgCTACAGCTCACATAGTTTATatgtatttgaaaaataacagacataatt tctaaacttgttcacaaaattccTGTAATTCATTATCTCAGCAGTAtata gcaaaagaaaaaaatgccatctgcaaaaattcaagggcTGTGCGAGTCTT CAAGCAAAGAGAAGACCTTTTTGGGCTGTTTGTTTTGGAGTTGTTTTGAG GCGATCAAACAGAAACATGGTGAGAAGTAACATATGGCGTGAAATGAAAA ATCAATGTTTctggatttgaaaaaaaacaacgtcaACAACCTTCAACCCA CCCGCCCACTAACGTCAATTGAtgtttttctaacctaaaatcgatttgtg agtgacccctgaaggaaagttgaatttctactaaaggaagaaaatttgtc agaaaatgccaaaaattctGGTGTTTGTCTGGTGTCAAAATTCATGTAAT GTAACAACGGACTGTTTTATCCGAcataatttaataaaatcttttctgTG CATCGTAAAGGTAGCACTTTTCTGAGAGATGGGCCATTAAGTGTTTTTGA TAACCAAATTGCACGTACGTGATTTGAACCAACATCATATCAAAGAAAGA CCCAAATTTTCTAATGAGGTTGGCAGAATTtagtaaaaacattttttggc tgaaaaaagaCGACAANctttttagcttgaaatagaAACATTGAGCaatc tcgctggggttattttgtctttttatgttgaatattagtacaagacacca tttagaaaccattttgaccctttactgggctttcatagtcttaaaatggg caaaaaatgccatttttactcattctttgctttagtgcgaatcaaagacc cccctggggaatgctggattttttacctaTGAGGTATATAGCCttcagta attagttcttacaaagtaaacaagggatggcgcacattATGAGCatagtt atttttcttataagcatctactttttaagaatcttatcaataactcttga tagacggtgatatagccttcggtaattagttcttacaaagtaaacaaggg atggcgcacaatatgagcatagttatttttcttaccgggtgacccacgaa aaagttcagatgTTTCCcaacgtcttgaggccgaacaaatgtcccaaagt gcttgaagttttgatatttaaaaagtagatatcctaacttaaaatttgag ctatcattgtttaaatttgaccaaattgttctctgcttatgagcttttaa agtcaaaattcactttacggaaagtgtaaaaaacacgtaaaaaaggggta tcaaatttggtatttttagacgtttttgatNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNgaatttaatacctcttttttacgtgtttttt acacttttcgaaaagtgaattttgactttaaaagctcataagtagagaac aagttggtcaaatttaaaaagtgacggctcaaattttaagttaggatatc tactttctaaataccaaaactccaagcactttgggatatttgttcggcct caagacgtcgggaaacgtctgaactttttcgtgggtcacccggtataaga aaaatttttttctttcttatttttcttttctcttgtgagaagggggtgtt taatTTATGACCAAAAACTTTCAATCTTTTCCTTGTAGTAGTAGATCTTG AATTAGCTTTCATCTCAACTACTTGTTTTTCTATGCAGTTTGAAtactag gcgaaattttcgacttaaaGTCGTCTTGTTGCTTTTATTATtaccttttt ttaattctagTTCAAGTGGATAAATgtctttcaaatgttttttggaccta cctaaggtagtcctttaaattaacccttgtccgttcgtccgttcgtccgt tcgtctgttgccagcttttctcgggatcggctcattattcttttttcttt ttttgtacaatgatacaaaatagcaatgcctaaaaagtgacggagcccga ttttgaaaaaaaaatttggggtaaatttgggccaaaaactacctaaaaNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNtagttttttctgattttttgctcaaacatgc gtattaacaatgcccaaaacatggtctagtccgatttctgagaaaaaatt ttttccggccgaaaatgccggaaatatgccggaaatcgccgtttttctgg attttcattggacttttccatataattggttgttttttcattcaaNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtttgaagccgga actttctaaaaatcgccggaacagccgattttcgccggaaaaacggtatt tcttgaatttcttgagctgtacttcatattttttcatgaaactttgcaca ctgatgcaaaatgtcaatacctaaattgtgacggagcccgattttcgaaa taattcatttccggccgaaaatgccagaaatatgccggaaaaactggttt tttggcattttctcgagattttgtcattagttttttctgattttttgctc aaagatgcgtattaacaatgctcaaaacatggccgagtNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAACAA TCAACACaggagaaaaaacaattttccattgagAACTTTATAGCTGATTC AACTTGATTTAACAGAATCGATATTGGAagacaataaatttttttgattt aattaCCCATCCCACACCAGATTTAGAAACCGACGAAAGCTGGCTAGGGT AACTCGAAAACAGGAGTCGACTTTGGttgactatcttttttaaaactgaG ATAGGTTTATGAGGTATTTTTGTATAAAGCCTAGAAAAGTCAAAGATTGA AATTGACATAACTTtagatttttaaagtttttgaattgctGAAACAAGGG GTAACGGTGACTTTGCATTATAAAGATCGATTTgatggtgaaattttgaa aatggttttgTTTCACAGACTGGAGCAGCGATAATAAAACGAAACTTTAT GGgctttttatgcatttttggcAACCAAGAAATATGGGGAATGCACTGAT TCTCTTCTAAACGattaatttgaaattcattCTTCAGTGTACCTAGCTGT CTCTGAATATGGTCATCTTGAGTACTATAATGTTGCTTTTATCTATTATT GGTGTCCTCTTATAGtccaagttttttttaaagtactAATGCGCAAAATA TTTAGCAAACGAAAGCAATAATACCAGTGGGATAACTTTCCCCCTTCAGC CCAAAAATTATCCATCATCATTGTTCTTCCTACACCAGTCCTTACGGAAG AATAAATTCTGGCACAAAACTATTGAATTATCTATTCTGGACGAAATAGG AGGAAGCAAGTTGAAAACAATAACAGGCAATTCAAAAACCTCATCGTCAG ATGGAATAGACTATCACACTCTTGATTGCAATATATGACCAACaattata aataaaactttacaaatattttgAGGATGGTATTTTTAGACCTCTTTTGT TGTTTGCTTAATCAGGGACACAATAATTGTAGGTTAGATAGCTCACACCC AGAGAGCATTAAAGTTGAAATGAGCTTTCAATTTATCTGAATTTTTGCCT ACTTGGTTCTTGCTTAACTCTTACTGTCTTTTCTCTAATTTAATGCGTCC TCTAATAAATGCAGATAACTTATTTAGATAAGTTCTGGTTTTAAtatact ttctttaaagaagtatataaaaaatatatataaagagTGGGGGATTTAGG GAGATCAAAAGGGGATACTCCTTCTATGCTTTGCACATGCAATATGATAA GCAATTGGTAAATTTTTTCATGTAGGATATTTTAATTTGGAATTCAACTG ACGCTGTCTTCATCTTTTAGGCTCAAAATGTGGAAGAGCTGTTTCAGTTG ACGTCAGAACAACTTCAAGAAATGACAAATATGTACAATACTGGAAACTT CGCCCATCCACCTTCCATCTTGTTTGAGGTAAACTTCACTTTTGAAAATT AGTAAGTGAACGTCTTCAGTGCTTAGACGAATATATCTTTGGAATTTTGA CATcttcaattttatcattttagttGAGAATCATATAACTAGAATTTGTA ACTTTCTGCTATCTAACTAGCCCCTTCTTAAAGGTTGTTGATATTCttct atttctattattttgtGAGGGAGTTCCATGTGCCAAATACATAACAATTA AGGGTTCTAGTATTTTCTAAattaagaaaaaagattttccttcTTCAGAC TgtagtttcttgatttttataaTTATCATGGACGGTTTAGATAGACTAAT CACCCACACACggaagtttgttttttattgtttgtgTTATAGCATGAGTG GGATTAGGTGGGATCGTACGTTGGGCTTTCAGAGAtattagatttaaaaa aagattagtTTGTATTTCCAGTGACGGTGAAACTTTCCACAAGTTTGGCA TAATCAGATAGCTCGAGATTTTTGGGCTTTGAATTCCATCTATATTCCTG ATTCAAACTGACATAACACATTGTGAAAATCTATACTATTGTACTCTTGC TAAACGAGAATTGGCTTAGGACCATAGGAGGGGGATTTAAACGATCTCAA ATCCATTTGATTATTACTacatatttttcaagttttgatcGCACATTCTG TGACCATTTCATTTTCTTAGAATTAAAACTCTTTTTGGTGTTATGAATAa aagacctctacaaaaccctcTTTAGGTAGTGTAAAAAGGTTAGAGGTTAT CGGTTAGAGGTTGCTAGCAGCATCGTTTTGGTCGTTTGTTTCGTCTTGTA TTTTCCTTGTATTGTAATCTTTACAATATTCTCTTCATTCATACGATTGA TCACTTGTACATTATACTTATATAAAGAAATTTCCATATAAAGAAGCTTC TCTTGTTTTGTGGGTGCACCAGGAAAATAAGACAACGAGAGACGAATAAC TACAGATTGTGAAATAATTTGGTTTTATACTTTGGTTTTGACCCTTCTTT CAAATGATATTGTCTTTAATCGTGAATCTGTTTCATATAAAGTATTTATA TAGTCGTATGATGAGATGAAAGAGAAGATGAAAACTGATTATCGTCTGTT GTGTTTCGtttctttactttcttttcCACACTccaatattttttgaataa ttccCCTTCATTGTTTGGTACCATTGTATTGTTCTTTACATTATTATCAT GATCGATAGAGTTTTGATAGATGTGCGATTCAACCTTTCAGAGAAGAGGA AGGGAACAAAAGACCTCTTTTTGTTTGCTTCAGAAACACTGAAGAACGAT GTTGTTAAAGAGACTGAAGAGATAGAGAAGAAGTGCAATCATGAATtgat aatatatattttattcttcatttttcactGTTTGTGATCTAACTTAGCTG GAGCAGTTTTTCTTTTGCATTAAGTGGAGATGGAAAGGTTATAAAAAGCA TCAACCTTCAAATGGATTTGATTTGCGCGAGACTCTGTATCATGTAATCC ACTATTAGGTTTGCGATTCCTTGGATGCATAGCTCTTCTGGAGATatctc tctttaaaaatttcatatttatgTTTGGAAAGATTTAAGTTTTTAACCGA ATTAAGAAATACTtggatgaaaaatttgaaattatgcttttttGGAATTG TTTTGAAGCTTTTTGCATAAAGGGCCACTCCTTCCTGCTCCTTCATTCAT TCATATTATTTCTTCAGTGCATAGTATCATTTTGCATTTTACATCTTATT TTTCTTGCAAAAATGTGCGAAGAAGCCTGACTCATACTCTTTCTGCAGGC GAGAAAATATAAAACCCTTTCAAAAAACCCTTCTTTATTTGTTTACGATT ATTAGTACAgcttttgaattattttattcaatatCTATTTTACTCGCAGG TAAATGAAGCCTGTTTTAAAGTGTTTCTTTCATCGAATCTGCACGAAATA GAAGTATTGTAAAAAGAGTTGTTTGGAATAATATTTCTGCTTTTTGtcga acaaaaaaatgaaaaactttctatGGAACATTCTCATATGACCTGCTTAG AGACCTTTGCGAGATATAGAGCTGGAACTTTTGTATTTTGCATAAGATTT TGCAAATTTCATCTTAGtttgattgaaaaataaaaagtcgCAGTTGAAAA AGATTGTTGCAGCTAGATACGAAGAGAACAGTTTGTGTCATAGTCGAAAA CTTTATGACTTCTTGGAGTGAAACCAAGATATCGTCATCATTATGCTAGA gacattttatttcaaaatctcCCATCAACAGGAGATCGAGGAGCTAAAGA CAAAGCTGGGAACCATCAGCAAGCAACGAGATGAATACTCAGATGCAATG AAAAATGGCACCGCCCCTCCACCCGTACCGCCCCAACAACAAACTTCCAC AAACTCTAATAATTCAGATTCTGACAGTCAACCATCCTCACCTAACTTAA CAAGAAGCACATTAAACTCGTTCAGCGATGGAAGTTACAACCAAAGCAAT GGAAATTCCCCTCATTCTTCGCTAAGAGCGCACATTCGTGCTTTTCTACC AAATAATCAAAGGACTATGGTAAGTAGAACATATTAGATAATGTAGATAT CATTAAGAATGCTTGCTTGATCATGGACATACTTTTACATAATTTTTTGA TCCATTTATCTATCTGCTACACTTCTTTTTGCTTAATCTTCCTTCTAAAA CCTTTACAGATTAAATATAAGCTTGGACAAACGGTGAGAGAAGCACTTTA CAAAGCAATGTCGCGTCGTTCACTGACCACTGATTCCTATAGAGTTTACA ACAAAGCAAATCGGTGAGTTTTGGGATTTGGAAATTACCTGCAGGTTGAC CAGACAGTTAATAAAAACATCGACGATTATCGACGCCTTCAAGTTTCAAA TCATATGTTAATGGTGTTCTAACTATTAATAGGTTCTCTTATCCGATTTC TATTTCAGAGAATTAATCGCTTGGGATTCGGACGTCTCACTTCTAGATGG AGCAGAGGTAGGAATCGAATAATGTAAACTCGTCAACTTCAACGACTCAC GTATATGGCTATCCTCCATAGTGGATTATTTTGGTTTTCTTCTTCAGAAA ATGAATTCCTTTTATCTTCTGCCCCGAAAAGAACAATTAAAGAAGCAGAA ACTTCTGGGTTCTTTATATTCACTTTTTACTTTTCTAATCAGGTGATTGT CGAGATGATAGACGAGGAAGATCCAAGCACCCAAAATATTTCACATAATT TTGTAAGTTATTCAGTTTCCTTCCATTGTCATATCCCTGACCTTACTTCA TATGCTGCAACCTCGTTTAGTGTTACCCAATACTACGGGTGCATTGCAAT CCAGATTCCGTACACCTATTTCATCTCTAGCCATTGATGAATGTTGTCTT TGATTATATTTTCTTCACTAGGTGCGAAAGACATTCTTCCGGTTAGCGTT TTGTGATAAATGCACGAAGCTTCTAATCACGGGATTCAGGTGAGCACTGT CATTCCatattttttacccttttttaccctcaacaaaacaaaaaagtcgt AGGTGATAATTGCTTTTAGTTTATTGAAAATGCATtcactttttcgattt ttcagatGCACAACATGCAATTATCGGTTTCACCAGAAATGTGCTCAGGG GATACCTCCTCTTTGTGAGCAAGCTGAACATTCACAGATTTACAAGAGGT AAGAAAGAAGCTTATCGAAGGCTCTTCCGGCTCTTCAGAACAATTCGATT TGAATTGTTCTGAAGTCTTTTAACGAGATTACCCCATCGAAACATATATT CGTTCAATGATTAATTCTTGTTTTTTCCACCATCTTACTAGGCTACTAGC AAAACAGAATCCAAACAGTAACACGAATATCCCTTCAACACCTCGACCAA TCTCTCAACGCGAACGTTCCATATCTGCTCCCAACGTTAATATGATCGGA CAACCTGACTCGGGACTCATTGAGGTATGAACTTCTGTTTCAAAAATCTT GGTACCTTGTATGACGTATTCATTGCCGTTGAAGCCCGAGAAAACGCCTT TATTTATTACAAATACGCACTGATATAAATTATCTTCTCCATCttcaata atttattttttcattccttTCAGGCGGTTCTtgaaaaacattacaaaaac CGAACCAATCAAGAAACGGCAACTATATCAGGTACACATGTACTGTATAT TCGTTTTAATCCGTTTTAAATCGAACTTTAActtgtgaaatttttttaat tattttagagAGTTGGTTTTTTCATAACactttttcccaaaatattAGAT CCGGTCTGAATGGGGAGGCCAGTTTAGCaataatttttctcttttattaa ttttttaggtGGTCTCACACGTCAAATGTCAAGTGGACCAAGTAGCGGGC GTGGACGGATAACCAATACTCTCTTCACGCCCACTAGCGTTAGTGCGCCC AATAGCGGCGAAAATTACTTCGATTTCAACACTGCTAACAGTTTGCCCGC ACCAGGAAATTCCAAGGCACAACAAATCTCCGGcattcctgactcgctaa tacaCCCGGCACGCGACCGTAAAAACCGGATACGATCGTCTTCGGAAGAA CACAAAAAGGTTTCTTATTGATTGAGttattaatgtttttttgttttttt tgatcaatttttacGTGTTTACTGCGAAATGTGTGTTTTTCACGTACAAG TATTTATTGACCAAGACTAAAACTTTGTCAATGATTCATAGATAGATGTT AGACATTTCCGGACCACCAGACAGCTTCATTTCATATACGAAAAATGTCA TTTCTTGTCGTCTTAGATTCAAAACATAGCGTCGAATAGATGTAAATAAA CCTCAGTCTTTATGTTATCgcgaaagtcagaaaaaaaggaaaaccaaagc caaaacaagtttttctttGATAAAATGTCTCCAAAGCTTTCAAATTCGAG TGACAGGAGATTCTTTAGACTATTTACCCCTTCATTCTGAAACTCAACTT TATTTGGCTCACAGTAAAGAGGGAGACGTTGTCACTTCATCAGCttgaaa aaggagaaaaagctGAATGTTAGTTCTTTTCTTGGCTAGTTAACCCCTCC TCCTGAAAGTTATGCAAGGTGTTTTCTGCACTCTTCAAACGTTTCTTCTT GCTTTGCTTTGTAGCCTCGCCGTCGCGATTCGAACGATGATTGGGAGATT TACGCAGACGACTTGAAGATCGGAGAGAGGATAGGATCAGGCTCTTATGG AACTGTCTATAAGGGATACTGGCATGGTAAGTACTGAAGCAATGAGTTTT TTGAATAAGTGAAAACTTaatcaaaatattattaaatttcTTTGTAACTC AAACCTCGATAAGCTTGAATGTTTCAttaacttgaacaagttttTCTGTT AGTAAACTCTTTAAAACCAGTGTCGAAATCTTTATTGCTAGAACAAATTC GCTTTCCCCGTCCTCGTTCGAGCTGAATAAGAGACTTTATAGACGCTATA CCATCGATAAGTTAAAGttgatttattttataagagagtagtgaataaat agtttattttAGATTTCATCATTTCTTATTTTTGTAGGCACAGTGGCGGT AAAAACGTTGAATGTGAAAGACCCCAATCCTCAACAACTATTAGCATTTC AAAACGAAGTCGGAGTTTTGCGAAAGACTCGTCATGTCAACGTTCTACTA TTCATGGGTTGTCTCTCCTCACCTAACCTAGCTATCGTTACTCAATGGTG CGAAGGTTCCAGTCTCTACAGACATTTACACGTTTTGGAGAAGAAGTTTC CTATGCATAACTTGATAGAAATTGCGAGACAAACTGCTCAAGGGATAGAG TgagtcttttttcatttttcgatcaaaactaaaaaatgaaagtttgtacC ACGCTGGCAGGGCTCGAAATATTTCTCATAGAGAAGTCAGTTTTCCGGAT AAAGATATGAAAAATAACTAGTGAAGGAATTCCTTTTTCACACTTTCGTT GCCAGTCAAATCACGTCAATGGCCTTCTGCCTGCTTCTGCCGCCTTTTGC TTTTCCTAGCGAAATTTGGGAACTTTGACCTAGAAACTGCGTTTGCTTAC GTGCTTGTACCCTGTTGGTGTTGGCGTCGCCTAAATTTCTATTATTAGCC ACATGTAAAATTTGCGAAATTTGCGAAATTCTTGCTTTTCTTTCCTGTAC CGAACCATATCACCGAGCGGCagcttttttatttccaaaatagGGTTACA TTTGGCTTGTACGCCATACGCCCGTGTGAATTGACAACTTCAAAAAACTT GATAACTATAATGATCGTAAACAGGCTTAACGAGCCATGGTTTGGTAAAC AAATACATTGCAAAAACAGGAAATGTTTTTGGGATTCCTCATCCGGGCTT GTTAATCCTTAATAGTGATCTTGCAAGTAGATGATATGAACTTTCCTTTG TTTATTTATCTTTAGTATTTTTAGTTCGAATGTTTGTTTTCTATTTGACG TACTTTTTCCATAGTAGTGGTGAAGCCTCAGCAACCAATGGTCATGTGCT GGTTTGGACGCcaataaaatgtttattttctctTTCCTTTTTTACAGCTA TCTTCACGCAAAACAAATTATACATCGTGACTTGAAGTCAAACAGTATCC TTTTCTTATCATTCGTTTGCCAAAAACACAACAATCAAGCCCTTTCATTC ATTATTGGCCAATTATTGGTCAAGATTGGCCAATTTTTGACAGGCCTGCT TTATTTTGAACAACCCACTAAACCACTAGACGTGAGGCTCTAAGTCTACT AATGCCAACAAAATGCCATTGCAAGAGCATCCTCAGACCAATCACATTTC ACGTTTAATTGATAGAAATTTCAATGGGTACATTTCTAagaatatcaaat gataaccTTTTCAGTGGTTCTTCGCTGAATACAGTCTCAGATGAAAAGGG GAGTTAGATTCTTCCTTAATTTTGTATAGGGATCATGCTATAATCAAAAA GGCAACATAGGAAATTTCCTGAGATCCGAAATcctaatatttgaaaaata tgtaaaaGCACTTTTCACTGTCGAATACAAAAACTTCACAATGTTTTTGG AATCGTTGATACAGTGAAGAAATtatttaggcgtacaaactttcgcgagc agaaaatTTCGGCCTTTtccgcgaaagtaaatgtctttatcggatttaag gaatatttttcacttttatccaacgattcgcgaaagtttatgctcgcgaa aaacattttttcctcaaattcgcgaaagtaaatgtcgtaaatttcgctat ttttcgacctcgcgaaagtttctgctcgtgaacgtttgtacgcctaaagt agtatcaagaaaattttgaattaaaattgagCGAACTATTGAGAAATGAG AACTGACTTACAATAAAAGCAACTCTTCGACGTAAAAAACTGCGCGGATC AGCAGCGCCAGGACAGCGCATTGTATGTATGAAAAAAAGTAGATCTACTA TGTCGTAAGGAGAAGGGCCCATTCTTCAATGAGAAGGATTCATAACCATG GTAGTCTCTCGAACTTTGATTTTACGGGTCATAGTATCACTCAGTCAACT GACATTTAGCCCTTTCTCTTGTGAAACACGAATCTTTTTATTTGACGCAA GTGATACAAAAAATGTTATGAAAGAGAGTGCTGGAGGGTTTAAACTTCGT GTAGGAACACCTATTATAGTACCATCAAGATGCACGAAGGTTCTTGGCGA CATTTATGTGTTCACTTAAGTAGCCCAAGATCTCTCTTAAGCTACACGAG AAACCAAAACCTTTTCACTTGCACAACTTTCGAGCGCTCTGTTTATGTAA TGTAGTCCGTGCAAAAATAGCCTTCTTGAACTCTCTCTAGTGTGAACATA TTTCTCTCTCAGCAAACAAAAGGAAGTAAACTTAACCAGAATGTCAAGGG CTTGGTCATTTTTGGCAAACCTTTTTACAACTTATTCATTTACGTGAGCC AAAAATTGCCTAATCCGTTGGAGTGTCGTCTTTGCGTAAGCCGTTCACTT TTCtacttatttttctcttttcctctctatttttctttcaaatcttACGT GTTTAAAGGTTTGCAAACAAGaaggtttttgttttgcttgttaTTTGGTG CCAAACAGAGATTAATCTGGCGCCATACCACTtatcgaaaaatatcaaca ttatgATACAACTCATGATTTAAGTGAATTGGCCTAATTGTCAATCGCGa attttttggataattttctCCATGATGTTGTTGAGCTTAAGTCGTGCTCA CATCACCACATTTTTCGTCATTGGGTGAAAAACAAATCACGTGTTCACAC ACTTTCATTATTCGCATCATTTGACTGTCAAACGCTTTCCAACTTCCTTA TTTCCCAAAACAAtaatttcatttataaaaaatgatcATCATTTTACGAC CGTTTTGTTTCAACCAGCAAAAACATCCCATTGGTCAGTTTAGCGGAAAT CATTTGTTTCTACTAATCTCTTACAGTGGATAATTTTTCACGTTTTGATT GTTAACTGGTACATTAAACCAATTTAACAACACGTTGAAAGCCCAAAGGC CAAATTTCTAGCTAGCCATTGTATCGCTATGCTCACTGCATACCATTAGT ATTTTACTAACTGAAACAATATCTTCCTTAACTTGCCAACACCTTTTCTA GACATCTTTCTACAGCAGGATTTAACAGTGAAAATTGGAGATTTTGGGCT TGCTACCGTCAAAACAAGGTGGAGTGGTGACCATGGCTGTGAACAACCTT CTGGATCCATCTTATGGATGGTACGTAAAAACAAGTTCTCTAAAAACGGA ATTTTCATGATTACTTTATAATTCTGATGCTGATCTTAAGAACAGGAAAT GTTTACTCTTGAATTTTCTGGGAGAAAATCCTCGCTGCCAATTTTGTATC ATCAAAGGTGGCGCTTTAAAGTACCATTGAGTTATTTTCCGTTTTTGGCT ATCTGATGGGAAATCGTAATTCGACTATCAATGTTACAAAATTCCTCATT CgtgataaaatatttctaaatctGAACTTTTACCATTTAGTCAGTGATTA TGCAAAACAGTGAGTAATTTAGAATTGCTAGGGAACTTTTTCTTGATGAT TGGGTAACGGTTCTACATCTGACGCCTCTCCACCATTTTGTGGGTGGTTA CCATGGGTTACCTGCCACAAATCACATTAATAAATATTTTCCGGAGCTAG GTTTAACGTTTTACGATAATTGAATATTACAACATACTCACCGTTATCAT TCTTGAACAATGACTATTTTACTGTAGTCTGTACACACTCTAACACTGTA GACTCTCTCTAACATAGCAACCTGATGAATATTACATAAAAATTCTTGAG ATAAAATTGCTTGGTAACCCATATCCTTCGAGGTGTAGCCTTAAGTAATC AATTCTCAGGGATGAGCTTTTTAACTTGTCAAGTTTTAAATATAAGTGAT CTTTTACTACAAAACCTTGAATATAATCTGTTCCTCTTCTACTTGATCAG GCGCCGGAAGTCATCAAGATGCAAGACCCAAACCCATACACTTTCTTCTC AGATGCTTATGCATTCGGCATTTGTATTTACGAGTTGATCACCGGCTCAT TGCCTTATTGTAACATCGGGAATAAAGATATTGTAAGTACTACAACGAAT TCTATGCTTATTCGACCTAATAATCTCCAACAAACTATACAAATCTTGTT TATTTTCTACAGGTTTTCTTTGCGCGCAGTTTGGTTTAAAAGCAGATTGC AATAATCCTTCAACAGTGCTTTTCAATTCAATACTCCATTTTTCTTTCAG CTTATATATAGAATTGGGCGTGGTTTTATCCGCCCCGATCAAAGCAAGAT TCGTTCGGATTGTCCGAAAGCTTTGAAACGATTATACCTGGATTGTATTA AGTNaaataaatattttctggaGCTAGGTTTAACGTTTTACGATAATTGA ATATTACAACATACTCACCGTTATCATTCTTGAACAATGACTATTTTAAC TGTAGTCTGTACACACTCTAACACTGTAGACTCTCTAACATAGCAACCTG ATGAATATTACATAAAAATTCTTCGAGATGAAATTGCTTGGTAACCCATA TCCTTCGAGGTGTAGCCTTAAGTAATCAATTCTCAGGGATGAGCTTTTTA ACTTGTCAAGTTTTAAATATAAGTGATCTTTTACTACAAAACCTTGAATA TAATCTGTTCCTCTTCTACTTGATCAGGCGCCGGAAGTCATCAAGATGCA AGACCCAAACCCATACACTTTCTTCTCAGATGCTTATGCATTCGGCATTT GTATTTACGAGTTGATCACCGGCTCATTGCCTTATTGTAACATCGGGAAT AAAGATATTGTAAGTACTACAACGAATTCTATGCTTATTCGACCTAATAA TCTCCAACAAACTATACAAATCTTGTTTATTTTCTACAGGTTTTCTTTGC GCGCAGTTTGGTTTAAAAGCAGATTGCAATAATCCTTCAACAGTGCTTTT CAATTCAATACTCCATTTTTCTTTCAGCTTATATATAGAATTGGGCGTGG TTTTATCCGCCCCGATCAAAGCAAGATTCGTTCGGATTGTCCGAAAGCTT TGAAACGATTATACCTGGATTGTATTAAGTACAACCGAGACGAAAGGCCG CTTTTCAAACAGGTATTTTTGTAAATAGCTGATAGTTCCCACTAGTTTTC GTCATACATTCCTTCGGAGAATGAAGAAGAACTCTTGCAAGAATAGTTTC CTTGTTCAAAACAATAATTTCATCTGCCAAATATTTTGATGGTATTTCTA ATAATGGCGAGGGTGATGGCGTTAGTTACGTTATCATTGGAAGGTGCTGT ATTGTTTACGTCCCTGGCTAAAAACTAAGGTGCCTTTCTCATTCTTGTTT GTCAATCAATATTTTTGCTGTATAAGCAATCCATTCATTCTGTCATCATC AATGCTgagaaagttatttttgatgTGACTTTCCTTTGGTAACATGTACA CGCCAAGAATGAGTAACTATCATCACTATCAATCAATTAATATTTGTGTA TAAATGTTATTTAGCAACATTTGACGTCTTTCCCACTGACGTtctttttc tacactatacacCTTCTCCAAATTTTACTGTCACGTCACCTCATTAAATT agtttcatcaatttttgttaCCTTTTAAGTATTTCATTCTTTCGAACtca taaaaataacaattcAGAAAAATCTACTTAGTTTTTATTTGTATACCTTG TTTTCCCTACAGATCGTGAATTCTTTGGAAACCATATTGATGGCACTACC TAAGATTACGAGGAGTACTTCTGAGCCTATTTTAGGGCGTGCAAAACCGA GCACAGATGTTGAAATTGCTTACCCATGCCCCACCCCTCATACGCCCATC CAAGGGCAAGATGTATTCAGCTTTTTGTCTGGCCAACCGCAACCTGTGTA TTAGAGTGCTTTTGAGTGAATCTAGAATGAATCACGAAAATggaatgaat gaatggatgaaatgaatgaatgaatgaaaattcaaaGGAAAGTTGATTAA CGTagcaatcaaccaatcaaagaAATGCCAGTGCCAAATAATCTGGTTTC AGAATGATCccaaatcttaaaccaatcttTTTTTGTCAATCTTTTTATAA CTATACTTCATATGGCATAAGTGTAAATTAATTCAggtgaatttatttat ttatttaaagtaaaaaaaaacactaaaattcctgcataaaattttgattt tgacaaca
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000587XLOC_000587Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001023-exon-sc0000007-1491911889:781407..781453TCONS_00001023-exon-sc0000007-1491911889:781407..781453Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:781407..781453TCONS_00001023-exon-sc0000007-1510915933:781407..781453Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:781407..781453TCONS_00001023-exon-sc0000007-1575043694:781407..781453Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:800027..800134TCONS_00001023-exon-sc0000007-1491911889:800027..800134Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:800027..800134TCONS_00001023-exon-sc0000007-1510915933:800027..800134Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:800027..800134TCONS_00001023-exon-sc0000007-1575043694:800027..800134Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:802438..802725TCONS_00001023-exon-sc0000007-1491911889:802438..802725Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:802438..802725TCONS_00001023-exon-sc0000007-1510915933:802438..802725Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:802438..802725TCONS_00001023-exon-sc0000007-1575043694:802438..802725Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:802866..802969TCONS_00001023-exon-sc0000007-1491911889:802866..802969Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:802866..802969TCONS_00001023-exon-sc0000007-1510915933:802866..802969Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:802866..802969TCONS_00001023-exon-sc0000007-1575043694:802866..802969Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:803115..803163TCONS_00001023-exon-sc0000007-1491911889:803115..803163Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:803115..803163TCONS_00001023-exon-sc0000007-1510915933:803115..803163Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:803115..803163TCONS_00001023-exon-sc0000007-1575043694:803115..803163Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:803349..803408TCONS_00001023-exon-sc0000007-1491911889:803349..803408Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:803349..803408TCONS_00001023-exon-sc0000007-1510915933:803349..803408Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:803349..803408TCONS_00001023-exon-sc0000007-1575043694:803349..803408Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:803578..803645TCONS_00001023-exon-sc0000007-1491911889:803578..803645Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:803578..803645TCONS_00001023-exon-sc0000007-1510915933:803578..803645Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:803578..803645TCONS_00001023-exon-sc0000007-1575043694:803578..803645Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:803762..803854TCONS_00001023-exon-sc0000007-1491911889:803762..803854Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:803762..803854TCONS_00001023-exon-sc0000007-1510915933:803762..803854Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:803762..803854TCONS_00001023-exon-sc0000007-1575043694:803762..803854Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:803998..804130TCONS_00001023-exon-sc0000007-1491911889:803998..804130Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:803998..804130TCONS_00001023-exon-sc0000007-1510915933:803998..804130Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:803998..804130TCONS_00001023-exon-sc0000007-1575043694:803998..804130Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:804280..804337TCONS_00001023-exon-sc0000007-1491911889:804280..804337Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:804280..804337TCONS_00001023-exon-sc0000007-1510915933:804280..804337Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:804280..804337TCONS_00001023-exon-sc0000007-1575043694:804280..804337Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:804515..804765TCONS_00001023-exon-sc0000007-1491911889:804515..804765Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:804515..804765TCONS_00001023-exon-sc0000007-1510915933:804515..804765Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:804515..804765TCONS_00001023-exon-sc0000007-1575043694:804515..804765Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:805321..805432TCONS_00001023-exon-sc0000007-1491911889:805321..805432Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:805321..805432TCONS_00001023-exon-sc0000007-1510915933:805321..805432Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:805321..805432TCONS_00001023-exon-sc0000007-1575043694:805321..805432Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:805744..806005TCONS_00001023-exon-sc0000007-1491911889:805744..806005Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:805744..806005TCONS_00001023-exon-sc0000007-1510915933:805744..806005Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:805744..806005TCONS_00001023-exon-sc0000007-1575043694:805744..806005Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:806754..806800TCONS_00001023-exon-sc0000007-1491911889:806754..806800Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:806754..806800TCONS_00001023-exon-sc0000007-1510915933:806754..806800Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:806754..806800TCONS_00001023-exon-sc0000007-1575043694:806754..806800Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:808858..808976TCONS_00001023-exon-sc0000007-1491911889:808858..808976Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:808858..808976TCONS_00001023-exon-sc0000007-1510915933:808858..808976Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:808858..808976TCONS_00001023-exon-sc0000007-1575043694:808858..808976Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:810434..810565TCONS_00001023-exon-sc0000007-1491911889:810434..810565Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:810434..810565TCONS_00001023-exon-sc0000007-1510915933:810434..810565Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:810434..810565TCONS_00001023-exon-sc0000007-1575043694:810434..810565Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:810734..810868TCONS_00001023-exon-sc0000007-1491911889:810734..810868Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:810734..810868TCONS_00001023-exon-sc0000007-1510915933:810734..810868Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:810734..810868TCONS_00001023-exon-sc0000007-1575043694:810734..810868Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1491911889:811469..811964TCONS_00001023-exon-sc0000007-1491911889:811469..811964Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1510915933:811469..811964TCONS_00001023-exon-sc0000007-1510915933:811469..811964Clytia hemisphaericaexon
TCONS_00001023-exon-sc0000007-1575043694:811469..811964TCONS_00001023-exon-sc0000007-1575043694:811469..811964Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:781407..811964 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
4.14595 3.51724 1.0645 0.0181495 25.5377 13.9491 21.8281 21.7618 13.1289 12.7728 15.215 6.59339 14.7685 15.5882 9.28052 10.166 13.4267 10.254 26.6868 21.2459 10.5262 12.4622 12.1654 15.6137 16.3702 15.0376 15.803 14.9728 9.8333 9.49113
Blast
BLAST of TCONS_00001023 vs. Swiss-Prot (Human)
Match: ARAF (Serine/threonine-protein kinase A-Raf OS=Homo sapiens GN=ARAF PE=1 SV=2)

HSP 1 Score: 520.005 bits (1338), Expect = 8.523e-174
Identity = 288/630 (45.71%), Postives = 385/630 (61.11%), Query Frame = 3
Query:  369 SNGNSPHSSLRAHIRAFLPNNQRTMIKYKLGQTVREALYKAMSRRSLTTDSYRVYN--KANRELIAWDSDVSLLDGAEVIVEMIDEEDPSTQNISHNFVRKTFFRLAFCDKCTKLLITGFRCTTCNYRFHQKCAQGIPPLC-----------------------EQAEHSQIYKRLLAKQXXXXXXXX--------XXXXXXISQRERSISAPNVNMIGQPDSGLIEAVLEKHYKNRTNQETATISGGLTRQMSSGPSSGRGRITNTLFTPTSVSAPNSGENYFDFNTANSLPAPGNSKAQQISGIPDSLIHPARDRKNRIRSSSEEHKKPRR---RDSNDDWEIYADDLKIGERIGSGSYGTVYKGYWHGTVAVKTLNVKDPNPQQLLAFQNEVGVLRKTRHVNVLLFMGCLSSPNLAIVTQWCEGSSLYRHLHVLEKKFPMHNLIEIARQTAQGIDYLHAKQIIHRDLKSNNIFLQQDLTVKIGDFGLATVKTRWSGDHGCEQPSGSILWMAPEVIKMQDPNPYTFFSDAYAFGICIYELITGSLPYCNIGNKDILIYRIGRGFIRPDQSKIRSDCPKALKRLYLDCIKYNRDERPLFKQIVNSLETILMALPKITRSTSEPILGRAK 2150
            +NG  P  ++   ++ +LPN QRT++  + G +V ++L KA+  R L  D   VY   K  + + AWD+ ++ LDG E+IVE++ E+ P T    HNFVRKTFF LAFCD C K L  GFRC TC Y+FHQ C+  +P +C                        +A  ++    LL  Q P+  T          P+      QR RS S PNV+M+         A ++ +    T Q  +T + G     S G S G  R + +   P SVS+     +               S A+Q            R+RK    S +++ KK +    RDS   WE+   ++++ +RIG+GS+GTV++G WHG VAVK L V  P  +Q  AF+NE+ VLRKTRHVN+LLFMG ++ P  AI+TQWCEGSSLY HLHV + +F M  LI++ARQTAQG+DYLHAK IIHRDLKSNNIFL + LTVKIGDFGLATVKTRWSG    EQPSGS+LWMA EVI+MQDPNPY+F SD YA+G+ +YEL+TGSLPY +IG +D +I+ +GRG++ PD SKI S+CPKA++RL  DC+K+ R+ERPLF QI+ ++E +  +LPKI RS SEP L R +
Sbjct:    9 ANGAEPSRAV-GTVKVYLPNKQRTVVTVRDGMSVYDSLDKALKVRGLNQDCCVVYRLIKGRKTVTAWDTAIAPLDGEELIVEVL-EDVPLTM---HNFVRKTFFSLAFCDFCLKFLFHGFRCQTCGYKFHQHCSSKVPTVCVDMSTNRQQFYHSVQDLSGGSRQHEAPSNRPLNELLTPQGPSPRTQHCDPEHFPFPAPANAPLQRIRSTSTPNVHMVS------TTAPMDSNLIQLTGQSFSTDAAG-----SRGGSDGTPRGSPS---PASVSSGRKSPH-------------SKSPAEQ------------RERK----SLADDKKKVKNLGYRDSGYYWEVPPSEVQLLKRIGTGSFGTVFRGRWHGDVAVKVLKVSQPTAEQAQAFKNEMQVLRKTRHVNILLFMGFMTRPGFAIITQWCEGSSLYHHLHVADTRFDMVQLIDVARQTAQGMDYLHAKNIIHRDLKSNNIFLHEGLTVKIGDFGLATVKTRWSGAQPLEQPSGSVLWMAAEVIRMQDPNPYSFQSDVYAYGVVLYELMTGSLPYSHIGCRDQIIFMVGRGYLSPDLSKISSNCPKAMRRLLSDCLKFQREERPLFPQILATIELLQRSLPKIERSASEPSLHRTQ 590          
The following BLAST results are available for this feature:
BLAST of TCONS_00001023 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
ARAF8.523e-17445.71Serine/threonine-protein kinase A-Raf OS=Homo sapi... [more]
back to top