Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001004 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001004
Unique NameTCONS_00001004
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length4046

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001004 ID=TCONS_00001004|Name=TCONS_00001004|organism=Clytia hemisphaerica|type=transcript|length=4046bp
CACACGGAGCCATAAGGAGTGATTTTCATACACAAATCACATTGCAAAAC
ATTTTATCATGAACTGAACTGACTGACTGATCATACATccacatacagac
atacatcaCTTTCCCCTAATCTTTTTTACACTTTACCTGATTGTGTACAC
ATACAAAGTAGCTAATATTACAAACGAATATGGTTCGATAAATTTTTAAA
TCAGACATGCAGTTGGCAGTAGAGCAAGAtcaaataaagagaaaaataaa
gacTTTAAACTGACAGACGGAAGAATAATAAAAATATAGAAGCATGTCTA
CGCCGTTAAAGAAAAGAGTGCGTCCCTCCACTGCCTCTGGTCTTATCCAA
AGCTCAAGAATTCCTCACATTTTGGATGATATACGACCTAACACGGCTAT
TGGAGCAAAAGAACCAGTCCTTGGGCTTGAACCTACCTATATTACAGCTG
ATTTACGTATTGGTCATAAACTTTTGAACAGTAAATACACAGGAAAGCAA
GTCCATGGTGGTGTTGATGATAGGAACCTGAAGAGTGAACATGGCAGAAG
AAATACTATTGGGCCTGTTGATTTTATTTCCAATGATAAAACACTACGAC
CCTTCACTGCTCCTATATCTGAAAACTCTGCCAAGATTGAAGAACGGATC
ACTTTGGATCATTTGAACAAAATCAAACAAGCTTTTGATGAAGCTGACGC
AGACAGCAGTGGAACTTTAGATTTGGAAgaattcaaaaatgttttcagaT
ATTTTCTTGGCTTGAAAGGAGCCCGATTGAATCTTTTAGAGTGAACACCA
GATGACAGCACTGTTCATGAAGATTGATTCTTCATCTGATGGTGAAATCA
ACTGGAATGAATTTTGCACCTATATGCAACTAGAGTATGCCGAAAAAGAA
GAATCTTATTTCAGATCTAAAGAAaCAGCATTTTACCTACCAGCAACGAT
CGTGGCATCACCACATAGAGATACCATTCTCTCTATAACGCACACAAGTG
ACAACAACTTCCTCTGTGTTAGTCAGGATGGGTACGTTTCATTTTGGTCA
TCCAGCATGCAGTTCAAGCGTAGTAAACAGATCGAAAGTGGTGGTCGTAA
AAGTAAATGGATCATTGATATGATTCTGATGCCACAGTACAACAAATTCA
TCACTGCTACTGGtgACCGAGAGATTCAGTTTCACGAGTTGTCGACCTTT
GAAGGATATTGTCAAATCAACAGTCTGGAAACCGTCCCTTTAAAACTCGC
TTATTGTTTAACAGGATCCGATGAATGTATATTGGTTTATGGCGATTCCG
AGGGATGTGTTAGTATTCTGATCATCAAGAACGTTGGTGAAACCTTAAGG
TTATGGAAGAAGATGCCCAAAGTGGAGGGGATAGCGAGTATTGGTATTGA
CAGCGTCATCaatgaagaaaatgtcaaatacATCAGatGGAAAGTTCATA
ACGACTGGGTACAAGAGatccGTTATTATCATTCCATACGAAGTGTGATA
TCATGCTCCACTGATGGCAACCACTCCCTTGTTATCGGACAAACGCTTGG
TAGCACTCATGTATCTAACCAGAAAGATATGAAGAAATGTCTACAGAACA
CATCTTCACTCAAAGAATTCGGTACCAAGAGAAGACTGCCTGCAGATGAA
ACTGTTTTTAAGATCTATAAAGGAGTAAAGACGTTCGATTTCAGCAAAAC
GAAAAATGTTCTTGCCACTGGCGGTATGGACAGATTGATTCGTTTGTGGA
ACCCTTATGTTCCAACGAAACCAGTTGGTATACTTCGAGGTCACGTGACA
CCTATCATTCATTTGTTCATGGTGGAAGATGACAACCGCCTGTTCAGCGT
TTCCAATGATATTATGGTCAAGGTTTGGGATATCCATGATCAGACATGTT
TGCTAACAGTTCGTCCAAAGTCACACCTCATCAAAGGAGAACTCTCAGCT
ATTCACTACAATCCCATATCACGTGGTTTGGCGTTCGCCACAGATCATGT
CGCCCTCCTTCGCTTGAAAAACAAGCCATTAGCGATGCAGATGACGACCA
CACACAAAGAAGCGGTCACGTGTTCTTGTTACAATACGTCATTCAACCAT
gtggtgacgtcatcagaaGGTTCGGTCATCAAAGTTTGGGACATCGAGAA
CGGAGATCAAGTGTTCGAGTATTCGGACGTGCACGACCAAACATCGGTCA
CTGATATGTGCTTTGATTCCACTCAACGAAGGCTGGTTACTTGTGGACAA
GATGGGAAGATCAAAATATGGAATTATAACAACGGACATTGTCTCAGTAC
TCTGCACCCAGaAGACGAACTATCGGAAGTCTCCTGTCTGGTTTATTTTA
CCATCAATAAAAATAGatacATCGTAGCTGCAGGGTGGGATCGACGTATC
AACATATATTCTGATAGCAGCCAATCATTGCATCATGTGAAATCTCCTTA
CATCAAATGGCCCGATGATACACcgATTTTGGCACACCAAGAAGACATCT
TAAGCATTGCATATCTTGACCCACATTTTCTCGCAACCTCAAGTTATGAT
GGACAGatCTTAGTATGGAACGTCACTTCAGGTCGAATCTTCACCAAACC
AAAATCTGATCTTCTGAATGACGTCACTGATGCTGAACTCCTATCAGGAG
ATTTATCCATCAGTAAGATCATCTTTTTGCAAACACGCAGTGAGAAAAGA
GAAGCAGCTTCGCTCGTTGCCAACGGACCAAAAGgttttgttcatttttg
gaatttgtacGATTCAAAACTTCCatatgcaaaatttgaaaatAAAAACG
GTCACCAAGTGTCGTTCATGGTTTCCAATGCAGATAACAGTCAATTCATC
ACCACTGATGTCAAAGGGTTTGTGACGGTATGGTGTGTTGAGAAATACTG
CATGAATGGGCCAGAAAAGAAACCACCTCGAGcGTTAAGATCTTGGAGAG
CGCACATACAACCTATCACATGTGCATCTTTAGTAGAAAGTAAAAACtgc
atgatgacgtcatcaacagATGGGACAGTCAGGGTATGGTCATTAGAAGG
ACATTTTGTGGGAACGTTCGGTCAACCTTTGAAATGGAATATTTACGATT
GTTCATCCTTCCAACATCCGATGGCACCATATGACGTGTTGATGGATCCA
GGTAGCATCCCTAACCATCCAGTGTTGATGAAGGATGACGAGGATGATAT
GGACCCCAATGAAATAACATCAAGTATGCAAGAACTCCGTGTTCGAAAgA
TGAATGACGTGGACATCAAACAAATGCTTGACTCACATGTCTGTTCCAAC
AGCTCTGGTAAAAGATTGCGACATGCTCGCCTGCGAGGTGAAATGAAGGA
CGAGACGTTCGGAGAGATTCCCCTTTGGAGTGACCGTTCAGCTTACAAAT
CACTAAGGTGCTATGACTTGGATGAAGTACCTCCACCCTCTAATGATAAT
TGACCCCGTTTTGGAGGGCGAATCCTTTGTAAATAAACCTATTTATTCTC
AGAATTATACAtctatcatcaaaatttgaaattaatggaacataataata
tttttggacacttttttatttgatattagACATCAGACTTTTGTCACATT
TTTTTCACACTCATTGTTTACACTTTTTCTAAATAACCTGACTGGATGCT
TTTGTTTTGGAGTAAAATCTTCAGGTTTTTGAGAGATGTTGGTTCATCCC
TAATTCAAATTAGCTGATCATTGAAAAACTTAACTAAGATCATCGTCAAA
ATGCATTAGCATATTTTTGGGTATTTTGTCGGGATGGGTTTATTTGCTTC
TCACTCTTATTGAAAGAGAGCCTAAAGTCTAATGAAAAGCAATACAGCAA
ATAAGATACTTTTTAAAATCGTGTTTTTGAAAGTGATTTATGTGAGAAAT
TCTTGGGTAATTTTACACTTGATTTTTATCCAGTttatattttttggatt
tttattttgtcaTACAGATGATGGGAGTGATTTTTATacttaaaataatt
tattgttttttacTAGATGTTGACGgtgtaaattttatatgaaaat
Run BLAST on NCBI

transcript from alignment at sc0000007:566480..590941+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001004 ID=TCONS_00001004|Name=TCONS_00001004|organism=Clytia hemisphaerica|type=transcript|length=24462bp|location=Sequence derived from alignment at sc0000007:566480..590941+ (Clytia hemisphaerica)
CACACGGAGCCATAAGGAGTGATTTTCATACACAAATCACATTGCAAAAC ATTTTATCATGAACTGAACTGACTGACTGATCATACATccacatacagac atacatcaCTTTCCCCTAATCTTTTTTACACTTTACCTGATTGTGTACAC ATACAAAGTAGCTAATATTACAAACGAATATGGTTCGATAAATTTTTAAA TCAGACATGCAGTTGGCAGTAGAGCAAGAtcaaataaagagaaaaataaa gacTTTAAACTGACAGACGGAAGAATAATAAAAATATGTAAGTATAGTCT AAGTAGTGTCTCTATTTTTAGTGTTGATGGCTGCTAAATTTTGGTATGGA TAAGCAGCTATTTTCTTTGAGCTAATTCTGAGAGAAGTAGAAGTagatct tctatcctgatttttttactttctcaCAAGTCAAGTGTTTCTAAATGTTT TCTAGTATATAAgtattatttttctgaaatttgcccgtaccaGTGGGTGA AATAGGTCTCCGACCCcagctcgaaccaccaaatgcgcatgcaagcaacc ttggttttcAAACCCAACGCCTAACCGCGTGCGCCAACAACAACAAGTCA CGTTCTGAAGGTGCATCAGAAAGCTTTCATTCACACAAATACTTATACTA GTCTCGCTGCTGAGGTCGATCaatgtttcatttcgtgacacacatcttag aactaacttttttggtggaaactcgcgaattagtatacgtagattccaaa atcaaaaagtttccactaTATTAttgtgcaagtaacgagtaattggcgat tttttgcgtttccaggcaaaattgcaaggcctggaaattcatgatttttc aggggtcttcaaattaaaaaaagacctatatcacatgataaagctcttca aactgagcaaaaaagtgtattacaccaaagtcctgCAACTTCtctaaatc aaaatttattggcctatttgtcataaaaaactgatggaacaggggggggg ggcacgcagttactacaagacagtatgacacttactaccgtggtggtact gtattcagaagttatgaaaacagttactacacagtgtagtaactgctgtt tgggagtggtgccaaacactaaagctagcacttttggtgtagtaagtgct taaattttaattctttttaaagaactttcaaaatttttcacaaaaaatga atttttttgtgaaaaaattctttgctgaaaaaaatatttttgttataaat ggacgaaaaaaaatttgaaatttttctcagacccaactttgaaattatcc tttcccaaattatcattaaaatgttctcaacagctgttaaccaagtaaat taaaagaaaatctagcacaaaaatggctttaggttgaaaaataattgcaa tttagggtaatttcgaggatgtttttgatgatatcactcaaaaacagggg tggtacctggaaatcttttctgaaaacagttactatcaaggtgtagtaac tgcaaagggtggtggtcctgaaaaaaagtgttgaaaaagcacttactaNa ctaccaaggtgtagtaactgcaaagggtggtggtcctgaaaaaaagtgtt gaaaaagcacttactacacatcatgtcttgtagtaactgcgtgccccccc ccctggatggaaaacagggaatttccccacaatctgcattaatttatgca aaatctAACACCTTTTTGAGCACagataggcccataacttttgatctaga gaagttgggactttggtgtaatacacttttttgctcagtttgaagagctc taaaTACAATGCCCGTACCAGTGGGTGAAATAGGTCTCCGACCCcagctc gaaccaccaaatgcgcatgcaagcaaccttggttttcgAACCCAACGCCT AACCGCGTGCACCAACAACAACAAGGTACATCAGAAAGCTTTCATTCACA CAAATACTTATACTAGTCTCGCTGCTGAGGTcgataaatgtttcatttcg tgacacacatcttagaactaacttttttggtggaaactcgcgaattagta tacGTAGATTCCAAAACCAAAAAGTTTCCACTATATTAttgtgcaagtaa cgagtaattggcgattttttgcgtttccaggcaaaattgcaaggcctgga aattcatgatttttcgggggtcttcaaattaaaaaaagacctatatcaca tgatagagctcttcaaactgagcaaaaaagtgtattacaccaaagtcctg CAACTTCTCTAAATCAAAATTCATTGGCCTATTTGtcgtaaaaaactgat ggaaaacagggaatttccccacaatctgcattaatttatgcaaaatcaAA CACCTTTTTGagcacaaataggcccataacttttgatctagagaagttgg gactttggtgtaatacacttttttgctcagtagagctctatcatgtgatg taggtctttttttaatttgaagaccccccaaaaatcatgaatttccaggc cttgcaattttgactggaaacgcaaaaaatcgccaattacttgttacttg cacgataatatcgtggaaactttttgattttagaatcTACATaatatact aattcgcgagtttccaccaaaaaaagttagttctaagatgtgtgtcaaga aaattgttttctagccactttttgttatctcagcagcgggactatacAGC GTGTACAGCTATTGAAAGTACTTCGATTTGTGAAACGTCTTTTCGTcaca tagaaaaaaagaaaatagcaaaagaacaaaaaggaattacccatagccac CATTTTGCAACCATGCGGAATGGCGATtttacggaaatgggaatcctcat atcAAATAAAGCATCTGGCATCTGCTGAAAATTTTGTTCTTCCCcataaa tgcaaaaatgaaaaatgaagaagcttttgttttctgatcgtctttttaat ctgccatgaagtgaTATAAAATTCCTTAAAGAAAGACACGTTCTCCTACG AAGAGGCTTCAAATAGATAATGTTGTTAAAAAGTATGTCATTTTATCTTA ACAATTTCGTAAACCATGGAGctctgacttttagttttatgacttgttct cactcATTTGGTTTcctttataaaaagaaagtcgttattgtgaactttga aaatgcttaaaatcaAGAACATCCCTGTTTAGAAAACCAACTTTTCTTTT ATAGAATataccttacaatctagttttcatatttatagaaactagattgc tgatgtgtggaaaggaatttcggcatgactgatccttttgttttgttaat aacatgtcacaataactttcactaatagcgcgccctttttaaaatTAGCC GCATGGAAATTGATAGTATTATCATATTAGGAACAGGTTTATTTTTGCCA TTATACTATTATAAGTCAAAATGGTAATGTCATTAGCAAAATAAAGATCT ATCAGAGAAAGGTCTATGCATTTTTTAAGCAAGAAGTTTTTTTACTCATT GAATATGGCAGGCTGGCCATGCCAACAATTTTTCCTGCTCAACAAAATTT CGACCACTCATTTCTCGTATACCCAGGACTCCTGAAGCGTTTTCAGAATT ATAAAAAAGTCAATGTCACTGAACTTTACTAGCTAGCATCAATACCTATT GGACATATCAAATACCTATTTCGTAGTTTACCTATTTCCATGTCTGTGAG CTACTTTGGAAGGTATCTAAAAGTtgggttatttaaaaaaaaatggtaCT CCAATTGGTGCACCAATTGGGGTACTTGTTGGGGTACCACTTTCTGTCCT TAATTTTGTTAAATGACACTTAATTTCATTATAATATGGTGCTACAATCT TTCATCGATTATTTAATAAAGTTACAAAACTTTTGTCACAATTGCCGTTT ACCGACACAAAGTGAAAATATACTGCTTTTTAATTAAATCAGCCGCTACC TTGCTTTTCTCCTTTCCTACTtcaaaaatttacagaccagaataagtAAG ACCAGAATAAATTCAGTAACCAAACCAAACAGTATTCCAATCCAGTAACC AACATCATAATATAGCTTAAAATCAGCAGAATTATAAGGTACTGGCTAGT AACATCTTGTtaatatcttttctttttacatgTCAGAATGCTGACAAAAA ATGACACTTTcttgcaaaaatatttaaaaaatattgaaatatgatAATCG TAAGTCCTccaaaaagatttattatactgAAAGTGATGCTCATAGTACAA AAGGATACAAATTGACAGTCATTTTAGCCTTGGAAAATCTGTAGAAATGC TTTTAGAGCAAGAAAAGCagtgacattttcttttgtcatttttatcacTA AATTGACACTTTCTACCagaaattttgatgacatcataaaATACAATAGT TTAAGGTTGCCTTGATTAAGAATTACATATATACTCAATATGATGCAGGA AATACAAttggatatgaattgacagtagGAAGTAGTCTTTGATTCTCTCA AACACTTGTTTTAAAGCAAACGAGCATAAACACATATTATATTATTTGTA TTACATGTTAATAATTATATCACTctacatttatttttaaaagcgtATTT TACTCTTTTTCACACGATTTAATTCTGTTCAGTAAATTAAACGGGTACCC CAATGAGTACCCCAATCGGTGCACAAATTGGTGCACCAATTGGGGTACca tgctttttaaaataaccCCTAAAAGTTACTTAGAAAAGATGAATTGGCTT TAAGCCAATATAAGTATAACCTGGTATAACAGAAGTTATGTTATCTAGAT TGTGTTAAAAATTTATGCCTAATGGACAAAATGCACTGTATTTTGTAAAA GAGGCTGCACTCAAGGGGCACTTTTGTCCCTGTTTGTTCTTCAATATATT GAGAAAAATATCTTACCCAATATAGTACATCAAATACCTTTTtttaaagg gaagaaattttgatggGAACTTTATTTGCTTGGcagatttggtcaaaatt cgccaaattaagttcccgccaaattaaattcccgccaaatttaaattgct ctatttattccccaaacgtgtgctatttcaggcttttaacaggtttttct ttttttaatggcgttttttggaaaaaaatatttttcatccgccaaattaa attctcaccaaatttaatttttcaagttaactgCCAATGAAATTAagttc cctctgaaaaaacttcttcggccatccgccaaattaaattccagccaaaa tttcttcctttaaggtttATAGCGTCACCTGTGCAGAGTGTCTTAGCTGG AACCAGCATTCCTAGCGCCATTCTGCTTTAAAGGCGGGGGTACGGAATCA GATATACACTTTCAAACTTCTTGTTTAACGATTTAGTTTCAATAAATTTG GGGTAGTTAATGTTTGTCTTCCCAGCTGCATCAATGAACTTTTAGATAGA TTgagttaaatttttcaaaagcctttaaacacCTGGCAAAAGTAATCATA ATTGAGATCTTAATTCCTAAACTCaaatctttaaagattttttctttgcc CAGCTGAGGTTAGTTGAGGGGTATATTAACACATATGGTATAACCCTCTC CTATTGAGAAACTTTAAAAGCTTTTCAGTTATATTATTATGGTATTATTC ATGAAACTTAAATTTTATTGCTATCTTTGCATACTTTGGCAATTGAAGAA CAAATACTTTCACATctatactgaagttgagcccagtgctttaGCATGTT ACAGTATACTATCtgaatttcatattttatgTCTGTCACGCTAAAATGGT AGGCCAGCTACGATTTTGAATGGTTTGTCAGGGGGTTGATTTGAGTATGA AAGGGAATTTGTTCTGTCTTCCTACAAAAATCTTGTTATCTTTCGAGAAA GCAGAGCATAATACGTCaacatttttattatttgtttaaattttcaCTAC CTTCCGATAAAACTCCGTCCAAAATGAGGTTTGACGTTCAAATCAAAGAA GCCTCTACAGTGACTTTCTAATGAAAATACTTTAAATCgttgcaaatttt caaatttgaaaaaggcgtGACACTTTCTAGATTCTACAAAATAGCcacca aaacatatttttttagatTCAATACACATGTAAAAAACAGAGGTCTTCTG CGCGAGAAGTTGATATAAACAGTTGTTTTGTAAGTTGTGAGATGTCTAtg attcttttgaaatttaaatatttattatttgtttttctgGCATCCTCAAA ATCTACGCATGTGCTTTTTAAATAAAGTAATAGATGCAAAAATGGTCTTT TGTAAAGGGATTTGGGTGCACAAGCTAAACCAGCGTTTGCAAAGACATGA ACCTTTTAGTTTTCACTATATAAAGATATGTTTTTACTTTACTGTGTTTT AACACAAACACAATCTTCAGCTAATTCAGTGTACAGTAGATATTTCAATA TTCACTTTACAGNTTTTGAATGGTTTGTCAGGGGGTTGATTTGAGTATGA AAGGGAATTTGTTCTGTCTTCCTACAAAAATCTTGTTATCTTTCGAGAAA GCAGAGCATAATACGTCaacatttttattatttgtttaaattttcaCTAC CTTCCGATAAAACTCCGTCCAAAATGAGGTTTGACGTTCAAATCAAAGAA GCCTCTACAGTGACTTTCTAATGAAAATACTTTAAATCgttgcaaatttt caaatttaaaaaggcgTGACACTTTCTACAAAATAGCcaccaaaacatat ttttttagatTCAATACACAGGTAAAAAACAGAGGTCTTCTGCGTGAGAA GTTGATATAAACAGTTGTTCCGTAAGTTGTGATATGTCTAtgattctttt gaaatttaaatatttattatttgtttttctgTCAAACCTCAAAATCTACG CATGTGCTTTTTAAATAAAGTAATAGATGCAAAAATGGTCTTTTGTAAAG GGATTTGGGTGCGCAAGCTAAACCAGCGTTTGCAAAGACATGAACCTTTT AGTTTTAACAATATAAAGATATGTTTTTACTTTACTGTGTTTTCACACAA ACACAATCTTCAGCTAATTCAGTGTACAGTAGATATTTCAATATTCACTT TACATTGACTGAAGATTGTAAAAGCTTGACACATTGTAATAATTGAtgga attttcaataaatactGTTTTTAAACTGTTTAGTCCCTTCAATATACTGT TCAACCTTTTCTTTAAATGTCCAGCTTTCCAAATTTTAGATGAGGTGCGA AAAACTGATGTAATTTAATTGTTAATTATGatttaatattttacttttcT AGAGAAGCATGTCTACGCCGTTAAAGAAAAGAGTGCGTCCCTCCACTGCC TCTGGTCTTATCCAAAGCTCAAGAATTCCTCACATTTTGGATGATATACG ACCTAACACGGCTATTGGAGCAAAAGAACCAGTCCTTGGGCTTGAACCTA CCTATATTACAGCTGATTTACGTATTGGTCATAAACTTTTGAACAGTAAA TACACAGGAAAGCAAGTCCATGGTGGTGTTGATGATAGGAACCTGAAGAG TGAACATGGCAGAAGAAATACTATTGGGCCTGTTGATTTTATTTCCAATG ATAAAACACTACGACCCTTCACTGCTCCTATATCTGAAAACTCTGCCAAG GTTTGTTAATTAGATTTATAGTGTATAAATCTTTCTCCTAGAGAAGATTA ATAAGGCTTCACAGAACTGTTATTCAAAAAGTTCATATCTAAAGATACAT CACAGTCGTACTCTGTGAGCACTGTACACAGTTGATCATTGAAAGTATTT ACTATCACTCTTTAGTTGACAACTCCAAAGCAATAAAACCATTTTACTTT CATGCAAAGCCATGGCTTTTTTCCCTTCAAGATTGAAATATAAACTCACT CAAATTAATATTATTAATCACATTCAGTGTAGcttcattttcaagaaaaa ctacACTAAAAAGATCTTTCTGAAGAGAAGTTTCTTTAAAATTCTTCCGA ATTATGTTTGGCATAAGGGTTAGTTAGAAAATACAGATTTATACGATCTC TATTTTAAGCATTTTGTTAATATATTCCTCATCAATCTTTAATACAAATC TTCCAATGGAGTGGCTACTGATTCCACCACAAAGTAGAAGATAATTTCGT CCAAAATTGTTATTTTATTGTCAAAGAGAGATTTATATAAAGATTATGAA AATCTAGATTATGAAAATCttggaaatgtttttttctcattcCAAGTGAG GTGTTCGAAGAGGGAACATGGCTTCCTCGCGTTCAAGGCTAGATCTTGAT AAACCCTGGCAGTTAAACTACTACGAGTTTTTCTACAGAGTGGCCAAGAA TGTAATCTATTTGTTTTTTCATATCCTAACAAATTCTCACTCTCTAACTT AGGTGTTATTTCTCACATTGTTTTCGTTTCTAATTAATATCTTTTCCCGA AAACaaatttaacctttttcatcattttcttccTTCTAGATTGAAGAACG GATCACTTTGGATCATTTGAACAAAATCAAACAAGCTTTTGATGTATGGA TACAGATggataatttattttttgaatcatTATGAGCCTTTCATAATCTC gctttttttaaacgactttgCTGTGGCGCTAGCCAAAAATTTAACAAGCT TTTATATTTTAGCTGCCAGTTATAGTTCTTGAagtccaataatttttttc ttctttatttcagGAAGCTGACGCAGACAGCAGTGGAACTTTAGATTTGG AAgaattcaaaaatgttttcagaTATTTTCTTGGCTTGAAAGGAGCCGTA AGTTTGAGATTACTGAAGTACaaatttttataacttttaGATATCTTATT AAATAGTTAACCTATCCTGTAAATTTACATTATTTCTTACTTTTTCACCT CAAGTATGATTTCCGTTCCTTGTGCTACGTTATAAGGAATAGCTTCCAGC GATTGAATCTTTTAGAGTGAACACCAGATGACAGCACTGTTCATGAAGAT TGATTCTTCATCTGATGGTGAAATCAACTGGAATGAATTTTGCACCTATA TGCAACTAGAGTATGCCGAAAAAGAAGAATCTTATTTCAGATCTAAAGAA GTAAGAAATTCTTATCACATCATTGTCTACATACCCTATTCTTAACGACT ATCTGAAGGCTTGTTTGAACACCTTTTACTTACTTATGATTCTGCCATTT GCAACTTGTTTCAGAAGTTCTTTGTTTCTCTTCACAAATGCGAAGAGGGA GCTATATTTGTTTCTTCTTTACAACATTTTCTCTCATTCCTTTGTATTCA CAgaaatttttaatcatttttttttctttcaacagaCAGCATTTTACCTA CCAGCAACGATCGTGGCATCACCACATAGAGATACCATTCTCTCTATAAC GCACACAAGTGACAACAACTTCCTCTGTGTTAGTCAGGTGAGTGCTGTAC TAGTAAAACCAATCAGATGTCCTATATTGAGTAGTGTATGAATGAActta ttaaaaaattaaagattaACTTAAAATGAACCTTCTTTACCTCTTCTAGG ATGGGTACGTTTCATTTTGGTCATCCAGCATGCAGTTCAAGCGTAGTAAA CAGGTCTATACTATAATTGAATTGTTTTCATTCAACTATTGTCATcgaaa ttttgagtaaaatcaTAATTGTTTATGTGTAGATAGAACTACTAAGATGC ATAGTTCAGACACCTTCCGAAAAATGAAGGAGGGGGNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACA CCtttagaaaaaatgaagaagggggaatcagaaaattttcctggaaaagg aggggggatagcaaggaaggGGGAATAGTTTAGGAAGGGGGTTACATATA TATTGTTTCATATTATTTTCAAggactgttatgaaatttggtcttcatga aaAGAAGTTTTCTGTTAGGGTAGTctaagtcaaaaagaagaaagaagttt attatttcgctttctctatCTAAAGATATATTTACATATATTTattagct atttttgtccaaaatccttggggataggcatttttaaagtttgggggatg ccaagaaggggggataCCAAGAATGGGGgaatcatttaagaaggggggtc agacccctttccgcactatgagaTGCAAAAAGAATTGCGCTATTTTTTGA CCTAATAGTAATACTGTTGTTTAGCGACTGTAGTGCAGGTAGAGCGTTTG GTtatggtgcgcaaggttgtggttTCAAATCCCGGCCAGTCATACCAAAA ACTTCGTACTTAGTAAAAAAAATGGTAGTTGATGCCTCTCTACTTGACGC TAAGCAATTAAAGAGAAGGATTGAGgataagtggagcaatccagggagaa agagtggagcaatccagggagaaagagtggagCAATCTCCTACCTTAGGG AAGATAGTTATTAAGAAAGGAGCCTTCAGTTCGCCTCTGACTGTGGTCGC ACATtatttctcatattgtttttctccttcttCGGTTCAGATCGAAAGTG GTGGTCGTAAAAGTAAATGGATCATTGATATGATTCTGATGCCACAGTAC AACAAATTCATCACTGCTACTGGGTAAGCCTTCCCAAGACCTTTGAAGTA TTCTTCTGCTATATGGTGCCTATTAAACTGGGGGAGGTATAGTATAAATC AAGCGGttttgagcaaaataagggaattttattttgacaGTTAAAAGTAT TAGCAAAGATTAGGGGTTATTTCAAGGGgttaaaaaatcaacaaactaTG GGCTtttttataaagtgtattcgGGATTGTTTACATACATTTCTGTAatc atattttttctttctttagtgACCGAGAGATTCAGTTTCACGAGTTGTCG ACCTTTGAAGGATATTGTCAAATCAACAGTCTGGAAACCGTCCCTTTAAA ACTCGCTTATTGGTAAGAAGAATATGAAAATacctttgatttgttttttt ccaTCATTTGATTTTCTGTTATTCTTAGTCGTACAGTTGTCGCTCCAAGA AATTTGAACCAAATTCATTCAAATACTTCGAGTGATTGACGGGTCTTTCT GGCTTTTGAGTGGTCTATTTCTATAAACAGCCGAATTGAAAACTCATTTT TACCACGCTACTTTTTCACGTGGTCGTCATCTcatcaaataatattttct caTTTCATTTAGTTTAACAGGATCCGATGAATGTATATTGGTTTATGGCG ATTCCGAGGTATAAAGTCATCGCTTGCTGTTTTTCTCTTAGAAATTTTCC CCTATTTTTGTCATGATTATTATGAAATTTCTTCAATACCTTTATTCCGC TTCAAAATGCCTGATAATGTGACTgattaaaattgaatatctgtTCTTTC TTCAGGGATGTGTTAGTATTCTGATCATCAAGAACGTTGGTGAAACCTTA AGgtaattctttttttctcttgaaaacttTGCTCTCGCCAGCCTGTATGA GAGAAATATAAAAAGGTTGAAGAAATTTATCATCCGAGTGAGGCCAATAT TTAGAAgttctgcgaccgcagtcggaggtgaCCCGAAGCCTCCTCTtaca tcaaattttcaaaagatttataGTAAATCATATCACATTTGAAGCACTTG CGTCTTACCCGTCTACTTTTTTTGAGTAAATAGGACGATTGTAAAACTTC GACTAAGAGCCTTAAAAGCTAATTTTCTTACCGAAAATTTGTATTGAATT CGGGCTAATCTAATGAGACTTTTTtacagtttttaaaaatttattcttaa cCGTTTGTTCATCTTCCTACTTTTGTATATATATCTTGAAGAAATTATTG GTTGTTGCTATAAATTGTTGACTAGTGATATATTAGGCTTAAAAGTTAGG CCAAAAGGACAAACTTAGGCTAGTCTGTAAAATGCACATACCTTACAAAA GCCTCTTGTTTACATGTCAAGTGGTGCGATacaaaatttaaacaaaaaag atCTACAAGTAGCAAAAGATAGAGGAGGTTCTTAGTTTTTGAGGCGTCAA TATTCGATTACTTAATCAGATATGGTCCAAATTTTATCTACAGAAAGTAT CAAAAATCATTGATGAAGGGGGTGATGAGAAAATGGTTAAGATTATAGAT TTAAAAGATCTTTGTAAAAACCTTATTGGTCTAGATTCTTGTGTCTGATG GTCTAATCTTGGAAGGAGAGTCAAAgtcgaataaaaaatatacaaaagca TGATAGATAAAAAAATGATTATGCTAAATATGTTTCTCTCTAAAATAATT ATGAAGGTTGACGTAatacattttacattttttgttttaaccTTGTAGGT TATGGAAGAAGATGCCCAAAGTGGAGGGGATAGCGAGTATTGGTATTGAC AGGTATTTTCAACCCTAATTCTCACATTTTGAGTattgataaaaattgaa gaagcttTCGGTAAAAATACCATACTATACTATTAAAATCGCTTACCTTG TCTGAGGGAAAACTAACGTGTCAAAAATATGTAGCTGTAGGTATTAATCT GTTTCTTTAAGCGATTTACAAGCCTAATTCCTCCCCGTAATTTGTTCACA TTCAAGACAAAGAAATCCATCTTCACCGAACTTGCAATTCAAACATGTCT TTCCGCATTTTTGAAGCCACCAGTCTGATTTGTAGGGGCTTCTTGAGCAG GAGctgtattttcttcaaaaatctttcgaaaGATCACCGAAACCCGATTT GTAACTTCTCCACTTTCGACGAAAGTTAATGGCCCCATCAACACATCTTT GAACAACTGACCATCCACCACAGAGAAGGGACATTCTGCAATGAATTGGT TGTTACTTTGATGGTTCTTCAGGCTCTTCAATCCCATAGATTCCATCCGT TTTCCAACCTTTCTTGTCGATGTCTTTGCAATCTGTTGCATTCTTCATCA AGGAGATAAATTTGACTTTCGTTTCGAAATTAATTTCACATTCTCTTTTC TCGAAGTAACGAGCTTCCGTTGATAGTTTGATTCTATGTTCAATCGACTG ATGCTTTTTAAATGGCATGTGTTTGTCTGCTCAAGAAAACTGCTGATTTG CACTCACAAAGTTCTTTTGACATTTTGTGAAACATTTTGAAGGTGATGGA ACATTGATCGAACGaaataataagcagatattcaataggtaaaagttggt tattgagatttattaacccgaggtgatgtaatattcaacgaggcgaagcc gagttgaatatacNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtcaccgagggtta ataaatccaataaccaacgaaaacctattgaatatatgttttattatata cctaaggcaaaaacaaaacattaattatGTTAATAGTCGAACGTTTCact taaaacactcccataatcgaacgttcgaatgttttccttttttaatgatt ttctcaATTACTTTgaatcataaaatttgttcatgaaattgacaatagat ttattttaatgaatttctttgatacaacaagagcaacaaaaaaaataaaa ctttgaaagcaaaatttgaaaaaaaaattctaccgtggtataatagccat ggtatatcaagaattattcaatggctgtttttgcctacaggtatataata atcaAAGTTAACGAAAGTTTTGTTAGCAGAAGAAAGATTAGCTGAAACTT TTGAATAaacacaattaaaaaaattaggttGTCATGTCGTTATATTTGCC TCATATTTGCCCTTTAGAGTAGAGCGTGATATGCGCAatatggatgatct gttatgagatagCCAAATCCGTGacttgatgtttttattttccacGTTTA TTTTATAGCGTCATCaatgaagaaaatgtcaaatacATCAGGTACATACA ATTTATCTCAACGAtaagtaaatgttttttttttattagaacatcttGAT TTGAGCCGAGCCTGCATTTACGAAAGCTCCTTATAAATTCAGATAGTTTC AAGCAAATTAGGGAAATCTCTCTAATCATCAAAGCCTTGggacgttctta actttttgagttttaaacctaaaaattttcttataatatgttcttatttt cgccattttttgagcatttttgtccatttttctaagaaatcgggtgctTT AGAGCAAAGCGCATTTAAATGTTATTAACGTTATACATCTGATTTATATT GCGTCTACCATGAAACTTTCAAAGTGACGCGTATTTGAAACATATGTTTT TTACATGAAATGgtgtaatctttttttttttctacagatGGAAAGTTCAT AACGACTGGGTACAAGAGGTATGTATTTTATAGTCTTGCTCTCAATTTCA TAACATTACTTTATTTGTTGACTTTTACTGACGGCttcgtcaaaatttca aaaagtttccaaacAAATCGCAAAAATTGCAATTTAATGGGCGGGGAGGA AATATTCGATCAAGCAACATAGCGTATAGCTGTTAGAGAGTGTCAGAGCA GAccaaaaataagcaaaaatggcTAATTTTTCTCGTAAGCAAGAGCTTGT TCCTaattctgtttttatttttattttagatccGTTATTATCATTCCATA CGAAGTGTGATATCATGCTCCACTGATGGCAACCACTCCCTTGTTATCGG TATGTTCTCCATATTTCACTTTCAACTTCAAGGGAAGAATAATTGCAAAC CAAACTCTTGGTCCCTTGAGCATTCGCGTGCTGAAAATACTTTTCTATTT CGAATTTCTCTAAACTGAATCGTTCTCTATTTCTCAGTAAAGGAATTAAG TGGCATATCCTTGGGTCTGTAATAAAATCAAACCTTTTTTATCTTCAACA TTCTCCATCTAGAACAAATTTTTCGGTACGTTGCAATAGAGAGATTTGAG ATAGAGAGATTCTAGCTGGTGGTATTTCTAGTATAGAAACTCCACACTGT TCTATCTTAAGCTTTGGTCTTCCATCTTATCATTTCAGGACAAACGCTTG GTAGCACTCATGTATCTAACCagaaagaaatgaagaaagNCAGATGGAAA GTTCATAACGACTGGGTACAAGAGGTATGTATTTTATAGTCTTGCTCTCA ATTTCATAACATTACTTTATTTGTTGACTTTTGCTGACGGCttcgtcaaa atttcaaaaagtttccaaacAAATCGCAAAAATTGCAATTTAATGGGCGG GGAGGAAATATTCGATCAAGCAACATAGCGTATAGCTGTTAGAGAGTGTC AGAGCAGAccaaaaataagcaaaaatggcTAATTTTTCTCGTAAGCAAGA GCTTGTTCCTaattctgtttttatttttattttagatccGTTATTATCAT TCCATACGAAGTGTGATATCATGCTCCACTGATGGCAACCACTCCCTTGT TATCGGTATGTTCTCCATATTTCACTTTCAACTTCAAGGGAAGAATAATT GCAAACCAAACTCTTGGTCCCTTGAGCATTCGCGTGCTGAAAATACTTTT CTATTTCGAATTTCTCTAAACTGAATCGTTCTCTATTTCTCAGTAAAGGA ATTAAGTGGCATATCCTTGGGTCTGTAATAAAATCAAACCTTTTTTATCT TCAACATTCTCCATCTAGAACAAATTTTTCGGTACGTTGCAATAGAGAGA TTTGAGATAGAGAGATTCTAGCTGGTGGTATTTCTAGTATAGAAACTCCA CACTGTTCTATCTTAAGCTTTGGTCTTCCATCTTATCATTTCAGGACAAA CGCTTGGTAGCACTCATGTATCTAACCAGAAAGATATGAAGAAATGTCTA CAGAACACATCTTCACTCAAAGAATTCGGTACCAAGAGAAGACTGCCTGC AGATGAAACTGTTTTTAAGATCTATAAAGGAGTAAAGACGTTCGATTTCA GCAAAACGAAAAATGTTCTTGCCACTGGCGGTAAGTTATATAGTTACGAA AACTTTAATATTATACATTCTGATACAAAAATTTATGCACCTATTACACt tgattattttcatttcatcattagGTATGGACAGATTGATTCGTTTGTGG AACCCTTATGTTCCAACGTAAGTGACTTAGTATCTTTTTCACAAACCAAT TATTCCTTCCCTTCTTCTTGTATCTTAAGGGggtcaaatatttaaaatcc cAAAATTGGTTAAAACCCGTAGGACATTGAAAGAAATCGGGAAAAAgaga ttcgcgaaattttgtccgtATGAAAATTTTAGATCCTCGATTCGTGAAAA AGATCCACAAAATTAATCTACTTAAAGGTATAATATCTTCTTTCACTACC AGAAACCTTCAAATCAACAGCCATTGTAGATGGAATATTATTCAATTCTT CCTACAATCGACATTTCAGTTTCCTCCTCCAAATAATATTACGTAATATT CCATTTCTTTAGGAAACCAGTTGGTATACTTCGAGGTCACGTGACACCTA TCATTCATTTGTTCATGGTGGAAGATGACAACCGCCTGTTCAGCGTTTCC AATGATATTATGGTCAAGGTAGAACTCTTTTATTCTCATATTTCTTTGCT AATGAAGACTTTCATAGGAGGAGAAGATGAAAGTTTCAGTAGAGAGCACT AACTTTGTGAGGTATTTCCGAAAGTGTCCAAAAAGCATGGTTGTGGTTTA ACCTTATTGTTTAATGTGGGAATATCCATAATTAACTTTTCTTGTTGCCA GGTTTGGGATATCCATGATCAGACATGTTTGCTAACAGTTCGTCCAAAGT CACACCTCATCAAAGGAGAACTCTCAGGTATATTTCCCTTCGTTTTTGCC TGGCTGTCTAGTGGAAGATCTTATAATAAATTAATGTTCCCAGTCACGTT ATTAGAAATTGAATTTAGGTATCTCATTTTTCCAACCGGAACCGTTTctc aatttatttattgataTTCTTCACTGGCCCTATCATATCTAGGAGTTATA AGTCCGTTTTGGATCACTAACGAGTCAAGAGCAAATTAATGTTCCGAATT ACATTCTGATATCATTCATATCCTATCGTTTTCCACAAAAGGGGAAAATT AACTTGAAATCAGAGATATTTCAGAAGTAGAGGAAGATCTTttgcattga gtttcaaaatgACGTTATTGTAATTTTGGTTAGACATAAAAGCACCTTAA AAATTTCTCCATAAAGAAATTTTAGGTTTTCTTGTGTCTCGAATGCCGTA ACAGAAAgagtttgtttttcaattttttcttttattaatcTCCAGCTATT CACTACAATCCCATATCACGTGGTTTGGCGTTCGCCACAGATCATGTCGC CCTCCTTCGCTTGAAAAACAAGTAAGTATCTTGCTATTTTTCgcacacac ccctgtctcagttaACTCACTGACACTTGCTAGCCAGTGGGTATAAAATA AAAAGGTACAAGTGGACCTCCGTATCCCTTCATCTCCTATTTTGTAAGTA GGAACTTTCGCCTTTAAGAACTTGACTACATTGGTCTTCTTCCGTGCGAG AATTGTTTTTGGGTGCGTTCTTCTTCTTGTGAACGATTTCTGCTNAAGTG GACCTTCCGTATCCCTTCATCTCCTATTTTGTAAGTAGGAACTTTCGCCT TTTTTTCACAGGCCATTAGCGATGCAGATGACGACCACACACAAAGAAGC GGTCACGTGTTCTTGTTACAATACGTCATTCAACCATgtggtgacgtcat cagaaGGTTCGGTCATCAAAGTTTGGGACATCGAGAACGGAGATCAAGTG TTCGAGTATTCGGACGTGCACGACCAAACATCGGTCACTGATATGTGCTT TGATTCCACTCAACGAAGGTCAGTAATTGTTTGGAATATGAAAAGATTCT CTTCACTTCTACTGTGCCTCTACATGCAAATACAAAATGCTAATTTTGTG CCTGAGCCTGATTCGTCTGACGTAAGATTCAAAGGagcaaatttgaaaat ctttattttagGAACAACTTCTTTTAATACTCCTTTCGTAAATTTTTAGG CTGGTTACTTGTGGACAAGATGGGAAGATCAAAATATGGAATTATAACAA CGGACATTGTCTCAGTACTCTGCACCCAGGTTTGAGTCCAAACGTTTTTA CTTTCATCAGTGACTGGTGTTACAAACTGGTATTTAGACTGGTATATtaa atgttatttctattttagaAGACGAACTATCGGAAGTCTCCTGTCTGGTT TATTTTACCATCAATAAAAATAGGTAGGGTAAAGTTTTCGTTTGCATTGG TTTTTTGTTACATACCTTTTATGTTATAGTTTGGTTTCTCTTGTTGTTTG GCTACTCTCTCATCATATTCCcatcttatttcttttttagatacATCGTA GCTGCAGGGTGGGATCGACGTATCAACATATATTCTGATAGCAGCCAATC ATTGCATCATGTGAAATCTCCTTACATCAAATGGCCCGATGATACACcgg tatacttttttttggctCACACACCCTCTGTCTATTTCTATCTTGCAAAT GATtgaaacagaaagaaaattttactcgGTTAACGATTTTATTTGACTTT GATACTCAACGGACTTGAGTTGTAGCAATCTCCACATTTTTAACTGCAAT GCGTTATCGAAGAATGGCTATCCTTAGCGATAATTAGCAACAACAATTAC TTTTAACAATTACTTTCACTTTGTTCTATTGTTAGATTTTGGCACACCAA GAAGACATCTTAAGCATTGCATATCTTGACCCACATTTTCTCGCAACCTC AAGTTATGATGGACAGGTATATACtaatttctttttggacctacctggag gtcctataaattaacctttgtccgtccgtccgtccgtccgttcgttcgtc cgtccgtctgttacNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaccggttttttggcatttt ctcgagatttcatcattagttttttcagattttttgcacaaagatgcgta ttagcaatgcccaaaacatggctgagtccgatttttgagaaaaatttttt tccggtcgaaaatgccggaaatatgccggaaatcgccgtttttgcagatt ttcattgtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtgcatt ttcgctaaacgctatattttctgactgatttttttctcctcgcattgcta tctaacttttatcatcaggtaggtccattcagcatctagcttgtttactG TACCTTATTCAAATACCTATCTCGTGCTTCATTACAGAGGCTTACCTAGT AAGTGTGGCACAGTTTGGAAATGACTATTGcatttcttttttatagatCT TAGTATGGAACGTCACTTCAGGTCGAATCTTCACCAAACCAAAATCTGAT CTTCTGAATGACGTCACTGATGCTGAACTCCGTAAGTGTAAAATAGATAT ACAtacagaaaattagaaaaaatacaaGCTCGCATCTATATTGTATACTT ACTGTTGAATTTAAGGCAATTAGAAAAGTTTTCTGTTGttgatatcaaaa aaaaatcgtcGAATAGANtttatgaaattttgcacactgatgcaatatga aaatacctaaaatgtgacggagcctgattttcgaaaaacattttttccgg ccgaaaatgctggaaatatgccggaaaaaacggtttttttacattttctc gaattttcacctttattgttttctgatttttttgcagaaagattcgtatt cgcaatgctcaaattatggctgagttcgatttttttttccggttgaaaat gccggaaatcgctgtttttgcANtgaaattaaattttctgcTGTCATAAC ATCCACCATTGTGATCACTCCATTGCATATTCCTTCTTTTCTTAGTATCA GGAGATTTATCCATCAGTAAGATCATCTTTTTGCAAACACGCAGTGAGAA AAGAGAAGCAGCTTCGCTCGTTGCCAACGGACCAAAAGGTAAGGCTCTAT TTACATCGGTAAACTTTTCCCACGCAGAACTCGACATCGCTGTTGTTACT CATtcacttttcttcatttttctttcaggttttgttcatttttggaattt gtacGATTCAAAACTTCCatatgcaaaatttgaaaatgtgagTATTTTAT TCGTTATGAAATCTTTTGAAAGGGCATATTCCTATAAGGAAGGGGTGTGT CCCTTAACTATGTTATTTTCTAtgattttcttctctttccAGAAAAACGG TCACCAAGTGTCGTTCATGGTTTCCAATGCAGATAACAGTCAATTCATCA CCACTGATGTCAAAGGTATTTCTTGATGATCGAACCCCTAAGATGAAATC CTTAGTATTTTAAAGAAAGTTAAATTGTCGCCAATCGATAATACATTTTC AGTAAAACCAACctaagtaaaaatttttttgcgataACGAccaatacttt tcttttctcCTAATGATTTTAAAGATTAAATCAAGGGTCGAAGAACAGTG TTCGCAAACAATGTGCATTACTTATTCCACATCTATGCAGTGagacattt tttctcttttgcaGGGTTTGTGACGGTATGGTGTGTTGAGAAATACTGCA TGAATGGGCCAGAAAAGAAACCACCTCGAGGTATGTGCACCTCGTTGAAT ACTTAGCCTTCTTCAAGATTTTATTCTGTTGAAATTCCTTTTAGGTTAAG GAGATCGGATTTTTCTAACATTgacttttttcttctctttcagcGTTAAG ATCTTGGAGAGCGCACATACAACCTATCACATGGTATGTCTTACTTGTAA TGTCAAGTTGAGggtttcaaagttttgaaagaaagtGTAATCGCTTAGTG CACTTCCTTGTGTGATTTATGCTTCACTTAAAGTtttcttagctctagtt tagacggccgacctTCTGCCCTGcatattctaattgttagagtaggcaaa aaATGGGCAGAAAGTTGACAATTAAAGTCTTTGCTTGAAATGGATTgaaa gaagtcgttgcattgacgtcaaaataaTGCAATGCATTAACTTTTAGACA GCCAATTTTCTGCTCACTTTTCTTCACAATTGGAATGGGCGTCTAAACTA GAGTACTCCTGTTTCTCAATAGTGCATCTTTAGTAGAAAGTAAAAACtgc atgatgacgtcatcaacagATGGGACAGTCAGGGTATGGTCATTAGAAGG ACATTTTGTGGGAACGTTCGGTCAACCTTTGAAATGGAATATTTACGATT GTTCATCCTTCCAACATCCGATGGCACCATATGACGTGTTGATGGATCCA GGTAGCATCCCTAACCATCCAGTGTTGATGAAGGATGACGAGGATGATAT GGACCCCAATGAAGTGAGTCCTCGCTCTCTCTCTCTTTAGTTTTTGGGGT TCTGTATCTCAATTTGGAGAAACCTGGATCTATCTCTATAAGGGTTGAGA CGTGTACTTGATACGCTAAAGTTCCAAAAAAGAATTCTCACCTTAAAAAA GGTTGTGTTAATTAAATGAATCATGGTGGAGTATATATTGCTTAAAGTTA ATAATTTACTTTTAATGTGCtctaatttttgttttgcattTCGTTTTCAA TCAATATTCttattgtcaaaaattttcaccgTTAAATTCAGATAAATATA TAGTATAAGCAGTTCATTTTCCTATTCTTTCCGCTGCAATAAGAATACCC GAAAAAATCCGAAACATAATTTGTTTTCTTAAATTATTTATAGATAACAT CAAGTATGCAAGAACTCCGTGTTCGAAAGTAAGTATCAGCAGTTCATGTG TGCAATTCACTCCCAGGCTTCtctttctgaaaattcaaaaaaatacacAA GAATGTATGTCAATAAATGTCAATGCCCTTATCCTCCTTTACATATGATT AATTTATCATCCCACCCTGTTTTGGCATCGCTCGAAAGCACAAGTCAACC TAAATGCTCGCTGAtgatctttcttttgttttcttctttaggATGAATGA CGTGGACATCAAACAAATGCTTGACTCACATGTCTGTTCCAACAGCTCTG GTAAAAGGTAGATAGCCATTGTCTATAGTCTTGAATACGTCTGTCGTCAG TTAAAtcagtgaaaatggtcaaatCAGTGATACCTTTTCTGTGTCGTTTT TGTTTGGGGAAGAACTCTTTTATTCAGACCAGGAACGAATTTGTTGTTAC CTGGGTTACCTAAGTAAtgataatagcgagtttatgtatctgtgtttttc tgcgCCGGATacggttagcttctgatttaTCTTGATCCTGAATGACTGAG GACGATAGataatcagcacttttaccttttcaattttgcgggtcaaaact gcgagTTATTCCAAATCGCGGCAGTCATTTCgctgtcctcaaaagtgcaa atacataaacctCTCTAATGAATTTTTTAGATTGCGACATGCTCGCCTGC GAGGTGAAATGAAGGACGAGACGTTCGGAGAGATTCCCCTTTGGAGTGAC CGTTCAGCTTACAAATCACTAAGGTGCTATGACTTGGATGAAGTACCTCC ACCCTCTAATGATAATTGACCCCGTTTTGGAGGGCGAATCCTTTGTAAAT AAACCTATTTATTCTCAGAATTATACAtctatcatcaaaatttgaaatta atggaacataataatatttttggacacttttttatttgatattagACATC AGACTTTTGTCACATTTTTTTCACACTCATTGTTTACACTTTTTCTAAAT AACCTGACTGGATGCTTTTGTTTTGGAGTAAAATCTTCAGGTTTTTGAGA GATGTTGGTTCATCCCTAATTCAAATTAGCTGATCATTGAAAAACTTAAC TAAGATCATCGTCAAAATGCATTAGCATATTTTTGGGTATTTTGTCGGGA TGGGTTTATTTGCTTCTCACTCTTATTGAAAGAGAGCCTAAAGTCTAATG AAAAGCAATACAGCAAATAAGATACTTTTTAAAATCGTGTTTTTGAAAGT GATTTATGTGAGAAATTCTTGGGTAATTTTACACTTGATTTTTATCCAGT ttatattttttggatttttattttgtcaTACAGATGATGGGAGTGATTTT TATacttaaaataatttattgttttttacTAGATGTTGACGgtgtaaatt ttatatgaaaat
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000581XLOC_000581Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001004-exon-sc0000007-1491911889:566480..566766TCONS_00001004-exon-sc0000007-1491911889:566480..566766Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:566480..566766TCONS_00001004-exon-sc0000007-1510915933:566480..566766Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:566480..566766TCONS_00001004-exon-sc0000007-1575043694:566480..566766Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:573782..574129TCONS_00001004-exon-sc0000007-1491911889:573782..574129Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:573782..574129TCONS_00001004-exon-sc0000007-1510915933:573782..574129Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:573782..574129TCONS_00001004-exon-sc0000007-1575043694:573782..574129Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:574969..575022TCONS_00001004-exon-sc0000007-1491911889:574969..575022Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:574969..575022TCONS_00001004-exon-sc0000007-1510915933:574969..575022Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:574969..575022TCONS_00001004-exon-sc0000007-1575043694:574969..575022Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:575193..575276TCONS_00001004-exon-sc0000007-1491911889:575193..575276Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:575193..575276TCONS_00001004-exon-sc0000007-1510915933:575193..575276Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:575193..575276TCONS_00001004-exon-sc0000007-1575043694:575193..575276Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:575429..575579TCONS_00001004-exon-sc0000007-1491911889:575429..575579Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:575429..575579TCONS_00001004-exon-sc0000007-1510915933:575429..575579Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:575429..575579TCONS_00001004-exon-sc0000007-1575043694:575429..575579Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:575815..575916TCONS_00001004-exon-sc0000007-1491911889:575815..575916Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:575815..575916TCONS_00001004-exon-sc0000007-1510915933:575815..575916Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:575815..575916TCONS_00001004-exon-sc0000007-1575043694:575815..575916Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:576029..576082TCONS_00001004-exon-sc0000007-1491911889:576029..576082Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:576029..576082TCONS_00001004-exon-sc0000007-1510915933:576029..576082Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:576029..576082TCONS_00001004-exon-sc0000007-1575043694:576029..576082Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:577420..577502TCONS_00001004-exon-sc0000007-1491911889:577420..577502Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:577420..577502TCONS_00001004-exon-sc0000007-1510915933:577420..577502Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:577420..577502TCONS_00001004-exon-sc0000007-1575043694:577420..577502Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:577749..577841TCONS_00001004-exon-sc0000007-1491911889:577749..577841Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:577749..577841TCONS_00001004-exon-sc0000007-1510915933:577749..577841Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:577749..577841TCONS_00001004-exon-sc0000007-1575043694:577749..577841Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:578092..578137TCONS_00001004-exon-sc0000007-1491911889:578092..578137Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:578092..578137TCONS_00001004-exon-sc0000007-1510915933:578092..578137Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:578092..578137TCONS_00001004-exon-sc0000007-1575043694:578092..578137Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:578285..578331TCONS_00001004-exon-sc0000007-1491911889:578285..578331Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:578285..578331TCONS_00001004-exon-sc0000007-1510915933:578285..578331Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:578285..578331TCONS_00001004-exon-sc0000007-1575043694:578285..578331Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:579228..579281TCONS_00001004-exon-sc0000007-1491911889:579228..579281Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:579228..579281TCONS_00001004-exon-sc0000007-1510915933:579228..579281Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:579228..579281TCONS_00001004-exon-sc0000007-1575043694:579228..579281Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:581188..581220TCONS_00001004-exon-sc0000007-1491911889:581188..581220Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:581188..581220TCONS_00001004-exon-sc0000007-1510915933:581188..581220Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:581188..581220TCONS_00001004-exon-sc0000007-1575043694:581188..581220Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:581617..581647TCONS_00001004-exon-sc0000007-1491911889:581617..581647Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:581617..581647TCONS_00001004-exon-sc0000007-1510915933:581617..581647Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:581617..581647TCONS_00001004-exon-sc0000007-1575043694:581617..581647Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:581909..581978TCONS_00001004-exon-sc0000007-1491911889:581909..581978Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:581909..581978TCONS_00001004-exon-sc0000007-1510915933:581909..581978Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:581909..581978TCONS_00001004-exon-sc0000007-1575043694:581909..581978Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:583074..583259TCONS_00001004-exon-sc0000007-1491911889:583074..583259Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:583074..583259TCONS_00001004-exon-sc0000007-1510915933:583074..583259Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:583074..583259TCONS_00001004-exon-sc0000007-1575043694:583074..583259Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:583354..583396TCONS_00001004-exon-sc0000007-1491911889:583354..583396Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:583354..583396TCONS_00001004-exon-sc0000007-1510915933:583354..583396Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:583354..583396TCONS_00001004-exon-sc0000007-1575043694:583354..583396Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:583742..583847TCONS_00001004-exon-sc0000007-1491911889:583742..583847Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:583742..583847TCONS_00001004-exon-sc0000007-1510915933:583742..583847Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:583742..583847TCONS_00001004-exon-sc0000007-1575043694:583742..583847Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:584031..584106TCONS_00001004-exon-sc0000007-1491911889:584031..584106Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:584031..584106TCONS_00001004-exon-sc0000007-1510915933:584031..584106Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:584031..584106TCONS_00001004-exon-sc0000007-1575043694:584031..584106Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:584575..584650TCONS_00001004-exon-sc0000007-1491911889:584575..584650Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:584575..584650TCONS_00001004-exon-sc0000007-1510915933:584575..584650Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:584575..584650TCONS_00001004-exon-sc0000007-1575043694:584575..584650Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:584941..585147TCONS_00001004-exon-sc0000007-1491911889:584941..585147Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:584941..585147TCONS_00001004-exon-sc0000007-1510915933:584941..585147Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:584941..585147TCONS_00001004-exon-sc0000007-1575043694:584941..585147Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:585329..585408TCONS_00001004-exon-sc0000007-1491911889:585329..585408Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:585329..585408TCONS_00001004-exon-sc0000007-1510915933:585329..585408Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:585329..585408TCONS_00001004-exon-sc0000007-1575043694:585329..585408Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:585498..585552TCONS_00001004-exon-sc0000007-1491911889:585498..585552Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:585498..585552TCONS_00001004-exon-sc0000007-1510915933:585498..585552Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:585498..585552TCONS_00001004-exon-sc0000007-1575043694:585498..585552Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:585670..585778TCONS_00001004-exon-sc0000007-1491911889:585670..585778Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:585670..585778TCONS_00001004-exon-sc0000007-1510915933:585670..585778Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:585670..585778TCONS_00001004-exon-sc0000007-1575043694:585670..585778Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:586015..586095TCONS_00001004-exon-sc0000007-1491911889:586015..586095Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:586015..586095TCONS_00001004-exon-sc0000007-1510915933:586015..586095Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:586015..586095TCONS_00001004-exon-sc0000007-1575043694:586015..586095Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:587126..587210TCONS_00001004-exon-sc0000007-1491911889:587126..587210Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:587126..587210TCONS_00001004-exon-sc0000007-1510915933:587126..587210Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:587126..587210TCONS_00001004-exon-sc0000007-1575043694:587126..587210Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:587675..587767TCONS_00001004-exon-sc0000007-1491911889:587675..587767Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:587675..587767TCONS_00001004-exon-sc0000007-1510915933:587675..587767Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:587675..587767TCONS_00001004-exon-sc0000007-1575043694:587675..587767Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:587858..587916TCONS_00001004-exon-sc0000007-1491911889:587858..587916Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:587858..587916TCONS_00001004-exon-sc0000007-1510915933:587858..587916Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:587858..587916TCONS_00001004-exon-sc0000007-1575043694:587858..587916Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:588022..588094TCONS_00001004-exon-sc0000007-1491911889:588022..588094Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:588022..588094TCONS_00001004-exon-sc0000007-1510915933:588022..588094Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:588022..588094TCONS_00001004-exon-sc0000007-1575043694:588022..588094Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:588344..588409TCONS_00001004-exon-sc0000007-1491911889:588344..588409Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:588344..588409TCONS_00001004-exon-sc0000007-1510915933:588344..588409Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:588344..588409TCONS_00001004-exon-sc0000007-1575043694:588344..588409Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:588523..588562TCONS_00001004-exon-sc0000007-1491911889:588523..588562Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:588523..588562TCONS_00001004-exon-sc0000007-1510915933:588523..588562Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:588523..588562TCONS_00001004-exon-sc0000007-1575043694:588523..588562Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:588902..589142TCONS_00001004-exon-sc0000007-1491911889:588902..589142Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:588902..589142TCONS_00001004-exon-sc0000007-1510915933:588902..589142Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:588902..589142TCONS_00001004-exon-sc0000007-1575043694:588902..589142Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:589523..589557TCONS_00001004-exon-sc0000007-1491911889:589523..589557Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:589523..589557TCONS_00001004-exon-sc0000007-1510915933:589523..589557Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:589523..589557TCONS_00001004-exon-sc0000007-1575043694:589523..589557Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:589771..589836TCONS_00001004-exon-sc0000007-1491911889:589771..589836Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:589771..589836TCONS_00001004-exon-sc0000007-1510915933:589771..589836Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:589771..589836TCONS_00001004-exon-sc0000007-1575043694:589771..589836Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1491911889:590210..590941TCONS_00001004-exon-sc0000007-1491911889:590210..590941Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1510915933:590210..590941TCONS_00001004-exon-sc0000007-1510915933:590210..590941Clytia hemisphaericaexon
TCONS_00001004-exon-sc0000007-1575043694:590210..590941TCONS_00001004-exon-sc0000007-1575043694:590210..590941Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:566480..590941 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.427005 0.501101 0 1.47495e-07 5.80439e-05 9.71027e-11 9.73714e-10 0 0.465469 0 1.56724e-06 0.307229 9.1101e-06 0 0.00125948 0 1.63103e-06 1.23347e-09 0 0.00983846 0 0.000328303 4.77282e-10 0 1.39445 0 5.55557e-08 1.23909e-05 0 0.000202896
Blast
BLAST of TCONS_00001004 vs. Swiss-Prot (Human)
Match: WDR49 (WD repeat-containing protein 49 OS=Homo sapiens GN=WDR49 PE=2 SV=1)

HSP 1 Score: 229.18 bits (583), Expect = 1.252e-62
Identity = 174/654 (26.61%), Postives = 311/654 (47.55%), Query Frame = 1
Query: 1624 TKRRLPADETVFKIYKGVKTFDFSKTKNVLATGGMDRLIRLWNPYVPTKPVGILRGHVTPIIHLFMVEDDNRLFSVSNDIMVKVWDIHDQTCLLTVR---PKSHLIKGELSAIHYNPISRGLAFAT--DHVALLRLKNKPLAMQMTTTHKEAVTCSCYNTSFNHVVTSSEGSVIKVWDIENGDQVFEYSDVHDQTSVTDMCFDSTQRRLVTCGQDGKIKIWNYNNGHCLSTLH-PEDELSEVSCLVYFTINKNRYIVAAGWDRRINIYSDSSQSLHHVKSPYIKWPDDTPILAHQEDILSIAYLDPHFLATSSYDGQILVWN----------------VTSGRIFTKPKSDL---------------LNDVTDAEL-LSGDLSISKIIFLQTRSEKR--EAASLVANGPKGFVHFWNLYDSKLPYAKFENKNGHQVSFMVSNADNSQFITTDVKGFVTVWCVEKYCMNGPEK---KPPRALRSWRAHIQPITCASLVE--SKNCMMTSSTDGTVRVWSLEGHFVGTFGQPLKWNIYDCSSFQHPMAPYDVLMDPGSIPNHPVLMKDDEDDMDP------NEITSSMQELRVRKMNDVDIKQMLDSHVCSNSSGKRLRHARLRGEMKDETFGEIPLWSDRSAYKSLRCYDLDEVP 3432
            +K+RL  + T F I +G+  FD+    N++AT G++  + LWNPYV +KPVG+L GH   +I +    +  +LFS S D ++++WDI  Q  +  +    PKS   +      H++  + G  F +  + +ALL +K++  A +   +H++AVTC  YN+    V++S  GS +  W I+ G ++ +++  H    ++ M  D+ + RL+T   DG +KIW++ NG+C  TL+  +D   ++S ++       + I+  GW+R I ++   + +   ++    +W      + H +DIL  A+L P  L T SYDG+I++WN                +   ++ TKP+  L                  V + E+   G  ++ ++ FL+ R        A+LV+ G  G+V FW++Y  +L  A+F   +G     M ++  N    T D+ G++ +W +E+YC+N  +    K P  +RS++ H   I+   + E   +  +++SS D ++ V  +    V  FGQ   W+I +C      +   D  +    I     L   +E  +DP      N+         VR   D++    LD      S+  +       GE+  ++F         S ++SL    L+E+P
Sbjct:    7 SKKRL--NMTSFNIAQGIHAFDYHSRLNLIATAGINNKVCLWNPYVVSKPVGVLWGHSASVIAVQFFVERKQLFSFSKDKVLRLWDIQHQLSIQRIACSFPKSQDFR---CLFHFDE-AHGRLFISFNNQLALLAMKSE--ASKRVKSHEKAVTCVLYNSILKQVISSDTGSTVSFWMIDTGQKIKQFTGCHGNAEISTMALDANETRLLTGSTDGTVKIWDF-NGYCHHTLNVGQDGAVDISQILIL----KKKILVTGWERAITVFRPQNFNQFFIQPE--EWKGG---IQHHDDILCAAFLPPQTLVTGSYDGEIVLWNNSTENAHHVLHPDYQRLLKSKLDTKPQKLLSAGRSQPSHPMADHSTTGVRNFEIDTEGKNAVMRLCFLKARKNTAVTGGANLVSCGGSGYVRFWDIYKKQL-LAEFLAHSGVGSIIMSTDKMNRYLTTGDLDGWLKIWNIEEYCLNSSKNKITKAPTLIRSFQPHEDRISSLEMCEPGGQLLIISSSADCSICVTGVCNAPVWIFGQAKHWHIENCLF----LPKRDTNLVESEIQKEISLFSKEESCLDPTEHSLLNKKNKDDSTYNVRPSEDIN----LDIKYKERSTCMKETQKPYYGEVIKKSF---------STFRSLNIGALEELP 624          
The following BLAST results are available for this feature:
BLAST of TCONS_00001004 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
WDR491.252e-6226.61WD repeat-containing protein 49 OS=Homo sapiens GN... [more]
back to top