Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000854 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000854
Unique NameTCONS_00000854
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length8256

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000854 ID=TCONS_00000854|Name=TCONS_00000854|organism=Clytia hemisphaerica|type=transcript|length=8256bp
GGCGGACTTGCTTCGGGGACTTGCttggattttagattttatcgATGTTA
ATGGTTCAGGCCTGGTGGACCTTCAGGCCTAGACCAAAAGGCCCATACTT
TATGCAAAGACTGAAAGACTCAATCTCTTATAATCACGTAATGGATTTTT
GAAGTTTATTAAAGTGCTGATCATGATCTTGGATTTGAGCCAAAATGAGT
TTAGCGGAAATAAAGGAGCATCTTAGAAAGAAAGAGCACATTGATTGTGC
TGAATTATATCAGAATGGTGACAATGAAGTGAATAAAGAACAACCATATT
TTGTTGATCGTTTACGTCTTCTCCATGAAGTTGTCGATTCTCCACAACTA
TGCAATGTTCAAAACATTGAGTGTTTATTCAAACTTGGTGCTGACCCAAC
AGAAAAGCAAATCAACGAAGATACTGCACTACACATGGCAGTTCAACAGC
AAAAAGTGGATATTGATATCATTCGAGCTTTGGTGAACAGCCAACATGGC
GAGTCAGCAGAATGCAGAATGAATGGAAAACCTTgcatttgtggtaaaaa
agcATTGCTGGTATCTAATAATCGTCAGAAGACTCCAAGACAGTTAGATT
ACATATCTGATGAAGTACTCAGTTTCTTGAACATGGAAGaatTGATTTTA
GCCATCCATAATGCAAGTATTTCTCTTAACGATAAAGACACAACTGGCTT
CAAAAACGTTCACCAAGTTCTCAAGAAAATCGGACGAACATTACCTGATG
ATTTCAGTCAAGAATTATTGAATCTTTTACTTAAGTTAGAAGGTGATCAC
CATTTTTGGGTTTTACCAATGTTATCTTATTTATTGACTATCAACAATTT
GGATGAAATTGCGTGTATGGCTATCGATAAACCAAAATGGCAGACTTact
atatggcaaaatcattgATCAAAATAAAACGTTGTCACCCTTTAAGTACT
GTAGTCGAAAAGGACAACTTTATTCATACTTGGCACCAAATATTTAAGTT
TAACGAAGAGAAGAAAGAATTGGAATGTCTTGACAACGATCTTAGATATC
CTGAAACAAAAGAGAGAAGAGACAACAAGGAAGAGTACTTgaaattcatt
aaaaatgaGAAGGTCTTGATGTATTTGATATCGGTGGCAGCCAACAATTT
GTTGGAGGATAAAACTGTACTGTACTTGCTGATAACCAAATCACTTCTTC
ACGACTTAAAAGAAATGAAAGAGTATATTCTAAATTGGAAGCATTTAGGG
TTGAGGAATCTAGATTTATCAGGCCAAGAGCTTCAATGTTTTCATGATAA
AACAACGTGGATTGCCTTGAATAATAATTCATTAAAATCTATTCCGAAGA
TGCCAAGGTCAAACCAATGGAAATCTCTAACTTTCATCAACCTGGAAGGa
aataaattggaaaatatTGGGCCAGAAATTTTCACTCTAAAGCCACTACA
AAGAATTAACCtcaataacaatcaaatcaagtttttgccaaatattGATA
AATTTGCGGAAACGTTAACATGTCTTGAGTTGAGCAAGAACTTTCTAACA
AATTTACCGAAGGCATTAGCAAAATCTTCTATCACTTCACTCTATTTGGC
TGAAAACAAATTCGAAAGTTTACCATTATCCATTTGTGAAATGCCACTGA
CCTATCTGGATCTCAGTGGTAACAAAAATATCATCGATTTTCCGATTGAT
CTTGGACGTTTGATAAGGTCAGATTCTCAGTCATCTCCCAACTTGAAGAT
CGATGATATGAACCAGTTATGTTATCCACAAAATATGATCGAAAAACCAA
GACTTTTGCTCGCGTATTTAAGAAGCGAGTTTCTGAAGACCTCAATTAGA
AATCAAGAAATGAATTTAATGTTTGTTGGTCCTTTTTCAAAATGGAATCG
AATATTGTCAGCTAATTTGTTAAACGAAAAGGTTACTCCAATTGATGATG
AAAATAAAGAAATCGAATTTCCAAGCCATGATGGTTATTCTTTGAAGTAC
AAATCAATCAAAATGTCATTACAATCGCTGCAATATCAACTCAAACCCGT
CATATTTCCAGGGCAGCTTGACTGGACACAAGTATTCCTTACAAATAGGT
CACTGTATCTTGTAGTATGGGTGAAGGGTTCACCTTCAGTTTTGAAAGAA
TGGCTAAACTGTTTGGTTTCATATGCTCCAGATAGTCTTATCATGATCGT
CAAAATACACCGATTTCAAACCGACGACTCTACCGAAAACATTGAAAACA
GTATCAATTCTGTTGTTGAAAATAACGACAAACAATCGCTGATCGGTCAA
TTACGAGTGgaaaagacaaaaataaaacGTGAAAAGAAACGGAAACGAGA
TAATTCAAATCGATGTCAAACAGAGCTGATAACATTCTTGGATAAGGAAT
TCAAGCCATCAAGGAATTTACATTTCGGAAAATGGAAAGGCAATAATAAT
TTGTCTTTGAACGAATTTTGGTTTAACTACATTGACATGAATGATGCTAA
AGACATCAAAAAGCTGAGGGAAAATATTTGGGAGGTGGCTTTATCGTTAC
CAGTCAATTTTAAGAACAAGAATGAGGATCGTATCCTTGGCtggaaaata
cccaaattttatTTCGCATTGGATGAGAAAATCAAAGAGAACGCCAAAAG
AAAAGATAAACGAATTGCAACAATTTCGATCCAAGATGTTAAAGATGAGA
TACAAAGATTTGACAGACAACAAGACTGTAACAGCCCGGCTATTCTGGTG
AATTGTTTGCTagatgaagatatttgtgaaaTGCTACAGTTTCTAAAGGA
CACTGGTCATTTGATGTACTTCCATAAagtcaatcaaaaattgaaCGAAG
TTGTGATCTTAAATTTCAAACCACTTCAAAAGCTTCTCAAAACATTGAAA
GATGGCCATAGAACTGATCCCAATATGAAAGAACTTTCACGGGAAGATCT
AAAGCAAATTATGAAAGATGTCACTGTTGATGCGATCAGTAATGATTCAC
ACGACAATGACGAAAACGTATTACTAGCTGTTGACCACGTGATATCTCTT
GTAGAGAATTTCAAGATTGGTTTCAATATCTCTGAAAATCAGATATGTTT
TCATCTTGGTATGGAGTATTATCAGCAATCATACCAAGGTGCGTTgcatt
tgaaagaaaagttcAACAGGGTGTTCACTTTTGAATGTTTACCTTTTGGA
TTTTGGAAGAAGTTGCTGTCTCGTCTTAGTTTATATACCAATGGTATTGT
CAACAATGATGAATCACCATATTCAAACTACATGAACCCAAAGGTAACCA
ACAGCTCACCTGGTGAAGCCTATCGACAAAGTTTCGTTTATTACCAGGAA
GAAGTTGTCTTCATCAAGATTCAAATCTTGGAAAGCAGAGAGAATAACAA
TTCACACCCGTGGATACAAAGGTTCGAAGATATTGATCGTAAAGAAAAAG
TGCTTGTGTTCATTAGAGGATCAGAACGTGCCAAAACATGTCGAATCTTT
ACTGAGCTGATCCACCATATCGAGACGAGTATCGGAGATTATCCAGAAtc
aacattgaaaccttttgaagATGTCAGGCGGTGGACGAGATGCCCAAGCT
GTCAGTATAACCGACAAGGAAAGGTGTTTGGTATGGAAGATTGTTTTAAG
CAGTACCAGGAAAATCtcgaagaaaaaagttttgagtGCCCGCCTTGTCG
CAAAAGATGGCTTATGAAAGATCTCTTTCCTGATATGGTTTTTGCTGATG
TACCAGAGATTCTACTACCATCGTGTCATGTGTCAGCTGACGTTGATTGG
AGTGATGCCATTGAGGGGGGCTTCGGCCTAGTCTGCCGAAGCACACTCAC
ACCATGTAATCGTGATCACAGTGCCCTCAAAGTAGCCTTGAAGAAACAGA
AAGATTGCGTGCCTTTTGATGATGTTAATCCAATGGAAATATTCTTTGCT
TTTCGACACGAATCAGTTCTCAGCTATAAACTAGCTGACCATCCTTACAT
TGTCACATTTCTTGGCATCCAGAGGCAGCAAAGGATAACTGTGACAGAAT
GGGCAGACGAAGGAAGCCTGTCAGATCGGATGAAGGAGGGACAGTCGTCT
TTCAGTCGCTTGTTGCTGTATCGTATTTTCTTCCAAATCTCCGACGCGTT
GAATTTCATGCACAGTCTTCATATCTCCCATCGTGATCTTCATGCAGGAA
ACATCTTCTTCTTCACAGAGGATACCAACATTGATACTAATGTCAAACTC
GCAGATTTTGGTGTATCGGTCTTTGCCAATGGTCGAGTGTTGCAAGAGAT
AATTGGTATGGAGAAATATAGACCACCAGAACTGTTCCTGTTTGATTCTA
CCTATACAGCATCAGCTGTGGATATTTATGCCGTTGGTTTGAACATGTAT
CGAGCATTGACCTTTATGAAATTATTCAATGGATTCCTGACACAAAATCT
TGgcttgaaaaaattgatgaaaaggaAAGGAGATTTTGAAAAGGCTTTTC
AGTTCGACCAAGTTCGGCAGGATGCTATTTGTTTGAAACGAATGATGCGA
GCCTGTATACAATACCATCCAAACGATAGAGTGAACGATATCAAATGTAT
CGTTTATCTGCTCAAACATCCTTGCTTTCAACTCTTAATGAACAGCATTC
CGCTGACCACTTCTCCATCCTATGAAATGATCATGACAAAAAGGTTTGAT
TCCAGCACAAATCTCGTAAAAGATCAAGTTCATTTTGTCTACGCAAAAGA
GAACAGAGATTCTAACGATATAACCATCAGAATCCGAACTGTTGCTGGCA
TGGATCACATTCGTAAAGAAGGACAGAAGAATGTCAATGATTCGAGAGAG
GATTTGTTGACCCTCATTGGTGATTTCACCAAAGAAGAGATGGAATTCCA
AAGCATTCAATATGACGATTTAAACGTGATAGTATGTATCAAACTCAAAG
ATCGATTCAAAATAGTGTTGGTTCCACGAGGTGAAAAGNACGTGATAGTA
TGTATCAAACTCAAAGATCGATTCAAAATAGTGTTGGTTCCACGGGGTGA
AAAGAACAAGTTGAGTCGAGAATATAATACAACAATGGATGATATGATTG
AAGGAAGATTTCGAAAGATGCAATgtcttcaaaatcaactttttgttttg
tatGACGACTGCACTGGGGAGAAAACAAAAACGCTTATCACGCATGGATC
ATTTGAGCCTAACTTACCAGAAGCAGACAACCCAACATCAACCATATTAT
CTTCCGTCTCATTCAATATTGATTTTCCTGAAGTTAAAGCAATCCAACTT
TATGAGCTGAGAGCCAACAAAGCCATCAAGGAACTTGACGTCAAGGACTT
CGTTGCTGATTCAAGATTCCTCGTTCTTACAATAAAACAGGCGACTCAGT
TTTTCATCTTAAGCTTTTATCAAGAAGGAGCATTATTACTGCAGGAGAAA
TATCTCACAGAAGATATAGGGTGTGAGATTAAGCGGATGTTTCTACACAA
CGATAAGCTGATCTTCGTAGCAGCGGGTGAAGGGAAGAaggtgaaaattt
tgatttataataTATCACAAGCAGAAAAAAGTGATGTTTATCAGATCGAC
ATTGATACCAAGAAGGAATGTAATTTCTCTGGGTTATATACCGGCCCGAT
TGATATCACCTCATTTTGCCACGCTAATGGAACGTATTGGTTTGGAACTC
ATACAGGTTACATATTCATCGTCAGCCAAATTGATGGTCAATTATACTCA
ACTCCAATGAAGCCGTATACCAGCCCAGTCACCGATCTTATCTTAGCTGA
AAACAATGTTGTGTTAAGCTATGGAAAAACGCTTGACAAAGATGCATTTA
CATATTCGTATAATGACAGCCCTGGGTTTCCAAGAGAGTCACGTGTTTAC
GAAGTTCTCCTCGAGAAATGGTTCCAGTTGAATCGAGACTTTTTGGAAGC
TCGTAATAAAGAAAAACCTGTTTGTCATGATTTCGCATCTGATTTGCTTT
TGGTTTGGGATGCACCAAACAGTAAAGACTTGGCCAGATATCAAATGAAA
CGAACCAAAGGATCAGCGACCAACGAAAAGCTGAAGAGAGTCAGAGACCA
CAaGAAAGAATGTGGCAACAAAGATCGGTTGCACCCAGAAAACTCAAACG
TGGTACAAGGAGCAAACTCGATCGCAGTACAGGATGCAAGTTCGAACGCG
GTGCAGGGAGCAAACTCGAACGTTGTTCAAGAGACAAACTCGAACGCGGT
GCAAGAGACAAACTCGAACGCGGTGCAAGAGACAAACTCGAACGCGGTGC
AAGAGACAAACTCGAACGCAGTGCAAGAGGCAAACTCGAACGCGGTGCAA
GAGACAAACTCGAATGCAGTACAACAAGTAAACTCAGACGTGATTCAAGA
AAAAAACTCGAACGAAGTGCAAGGAGCAAACTTGACCAGATCGCCTACCA
ACCGAATCCCCAATCCTTGCACCGATCAAAGTGCTTTTACATCCATACTC
CAACAACgtggtttgaaaatttacaaagTTAAAGGTGATGGAAATTGCTT
CTTTCGAGCTATATCACATCAGCTGTACGATGGTGATGATTCACAGTACG
CTCATATCCGAAGTAAAGCTATTACTTATATCCTTAAAAATGTTGATAAT
TTCACTGGTTTTTTAGCTGATGGGGAAAATATTTTACCTTATATTCAGCG
AATGAGTCAAGATGGCGCGTATACAGATAACTTGATTATACAAGCTACTG
CAAATGCATTTCAAATCGCTATAGATGTGATTAATTCAAATCAAGTGCAA
TACCCAGGAACCAGGGAAATTCCTCTTACTGAAGGAATACCCCCGAGAAA
ACGGGTTGTTCTAGGACATTATGATCAAAATCATTTTGACTCGACTGTCC
CAATATAACAATTACAAATTTTGATtaataattatatttttgtcTCAATA
ATATCGCgtattaaattttcaatttattttcaatatcaatGTATttcgga
aatattttttaatatttttaattataaattaaataatttttataatttgt
taTTACTTCTTCAAGAtttaatatatttcaaaaatttatacaATTAAATA
GTTGTTTCAAAAgagtattttattattttattagcGCACAATTTTCACAC
ACAATTTTATACATTTACAAGTTTGTCTTCGCTATTTTTGTATGGATTAC
TTTTTATATggttgaattttattttttgcaaaatagcTAAACCTTCTATT
TAGGGTCTAGGCATACAGTTTTGGAAAGACTTAAATAGTACGTTAAAAGG
TTTTGCATGACTATTTCAACCCTAAAAtattgacaaattttttgacTTCT
CTTTCCTAACGAGTGGTTTCTACAAGAAATAAGATATAACAAAGACTGTT
TACTTTTATTGTGGATAAACTTTGAAAGCTTATCAGGGCTAAggagcggt
cataaagtatctactagagggggTGGAGGACTTTAGGGGGGGAGGAGGTG
CGAAAAATAATTGCCACCCTTAGGGAGAGGggtatgaaatatttttacca
tcTTTGGGGGTGCGAATTTTTCTTTGACATCTCAAGACGATCCAAAATGA
AGTCTTTTTAACCATTTATCAGAGcctcttttgaaaaattaactttgaAG
ATTTACCAATGATAATCTATTATTTTCCCTTGCATGctgcaaaaaaatca
actttcaaGAAATTTAGCTTGAAATTCTGGTCTTTATTTCAAGAATTTCA
CAGGGTCCGCACCAACAGGACAGGAAGGACAGAGGATGGGTAATGTCCCG
TCACTATAGTGTCATTTTTAAATCTgactttttattattattattatata
ttaaCGCCTAAtgtgtgagtatttttgtccattttcataagaaataaggt
gttttagggtctaagaagccttaaatgttctcagcttgttcttaatattt
tggtcgtcgaagccttatgtttttattctagttttttcttataaaactgA
CTTTCCTGAAAATGTAAGTTCTCAATAGCCTATAATAAAAGTCAGTTCAA
AACAGAGTGGTTTTAGCTAAATTTTctccgtcggcgcaaaccatggttgt
gcctcTGTTATAAAAATCACAACAGTAAAATTTCCTGAAAAGAACacaca
aaaatgagaaaatataaataaaattgtGAAGCACAGTAGCAAGGAAacaa
tgtttaaaatccaatatttcacatttCAGCAGCTTTCATCCAACTTTCAT
TCGAGC

transcript from alignment at sc0000005:1123819..1144333-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000854 ID=TCONS_00000854|Name=TCONS_00000854|organism=Clytia hemisphaerica|type=transcript|length=20515bp|location=Sequence derived from alignment at sc0000005:1123819..1144333- (Clytia hemisphaerica)
GGCGGACTTGCTTCGGGGACTTGCTTGGATTTTAGATTTTATCGATGTTA ATGGTTCAGGCCTGGTGGACCTTCAGGCCTAGACCAAAAGGCCCATACTT TATGCAAAGACTGAAAGACTCAATCTCTTATAATCACGTAATGGATTTTT GAAGTTTATTAAAGGTATGTATTTGGTATTAGATTCCCTTTATTTTGATC AAATTTTAGCTATGTTTTTTATGTATAGTAGCAGTAGGTGTACATTGCAT TGCTCTACCGTGCAAGTTACCCGACAACTTGCATCAGTAGAGGGAAACTT GCATAGCCATCAAATGACTGACCAATCAAAGCAGAAAATTTCAAAACAAA TGAACTAACGCAGCTCCGCTTGCAGCTCTTCTCTAACTCTACCATTTTTG TTTTTATTCAACTTTGTATTTTGATGACCAGTCATTTGAGGGCACTGCAT GTTAGCCTACACTGATGCAAGTTTTACCCGATCTCACGGTACCACTTTCA CTTTCAATTTTGACATAATCCAGCAATAATGGGCTATTAAAACCATATAT ACAGGGTGAAGGCTTCTTCGTAAAAGCGAAAGACATGTATCTATTTTTCG GATCCGGCATGCGGGAGTAGTGTCAGGACCTGCAGGCGACCTGGTAGGGT TGGGTATGGGTGTGGTTTGGGTGTGGTTACGTATCAGATTGGCTAGGAAT TTGGTTATTATCAGTTAGGGTTAGGGTTGGAGCTCGAAACAAGCACTCTT TTGTGATTTTCTCTTAATACAGTCTGGTCTGTAGTTTGTACAGTATAAAT TGCCGTCAGAAACGCTCTCTCGGCATGAATCCGTGGCGCAGTGGATAAGG CATTGGGTTTCAAAACATCGGAACTTTGCATTTAGTGNCATTTAGTGGGT TCGAATCCCACCGGTGGCGATCTGTCGGTAAGTCATTCAGTAAGTTAGAA AACATAGAAAATAACTCACATAGAACCAGAAAGTCAGATAAACTACGAAC AAGAGACTGGAAAGTACGAAATAAGTCCAGATCTGTCTTTCGTCTTTATG AAGAAGCNTTCCGTAATTCCGTCTAAATTTTCGCCAAATTCCGCCACTCT GTCCGAAAAAAGGGCCGATTCCGCTCCTCCGCCAACCATGAAACCCCCCC CTAAGATATACAAGATAAGTAAACATAAATTTATCGCCCGCGAGCACGGC TTAGCTAAGCGCACCTCTCTTATTCATTATCTAAGAATTGAAGCCGGCAA AGATTACCGCGCGGCTGATAGCGGACGAAGGTTTTAGATTTTTCTACCCA GCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNAATCCACAAGTAATGAACCTCTTATAGCTTTAT CTGAATAAATCTGGTTGAAAACCTTCTATCAGGTTTCATTCCGTACGTTT TTTATCCATGTGGTGAACCGGTTTCCCCGATTTCCCGATAATCNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCACGACCTA TATACAGGGGTATTGGCAAACTTTTCCAGAGGGGTCTGAGCAGTGTTAAT CATTAATCCAATGGGTCTTTGTTAACTTTTCAGATTTTCCAAGGGCAGTC AGGATTAACTGGATTAACCGCCTAGAGCCAGATATAGGAACAAAATTTTC AATTTCACAAATACTCCTATCTAAGACCGTAAAATCGTCCAATATCGACA CCCCTCCTCTAAAGTCGACACCGCAGCGGCGGATCTGAGGGGGTTCAAAT GGTTCAGCTGAACCATCCCAACCCTTTTAGTAAATAAAAATACAAAGACC CTTTCTTCAAGTGAAATCTAGTTTTCTGATCGGAACTGATTTTTCTTCTT GGTCATATCTCGATATTATTTTACCAGGGGTTGTATGCATGTGGCGTGCG TTTCCGTGGTGCGCGCGACAAACTTAGCTTTTTTCGCGCTAAAAAATCTT TAGGTTTTGTGTGTACGGCGTAGCTAGCTTTCCCGCACTGTAAAAAATCT TTGTTTTGATTTTTTTTTGCGGGATTACATATCTAGCTGCTTCTGTGCTA GGAAATCTTTAATTTTGAACCTGGTTCAGAAAATGCATCCAGTGAAATGG CAAATTTGAGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNCAAAGACTCTGTGTGATGGAATTTTCATCTG CTTTTGTTTGATGTGGTGAAGAGTGACAAAAGAAAAAGAAAAGACGACTT TCATTCTGAGGAAACATATTTGTTTTGGTTTATTTTTAGAGGAGAAGCAT TCATACCAACAAAAACAAAACTTAAATAAATATAACAAAGCTATCAATCA ATCACTAAATTGTACTCTCCCTATATCACGTCACAGATTGTTGATATAAT ATGAGAAATGTGAAGTGTTATTACTTATGTTTGAGAAGAAAACTTTAATG ATGTAGTAATCACTAAAAAACTAATTAGCATGCTATCAACGAAGATGCCC AAATCAAAACAACATTTTGCACGCGAAGAATTTCTTACTAGGCCTTTTTA CCGTGAACCGAAAATAATAAAAAGAACCGTCAAAAGTTCCATTGCCTAAT TTTGATTGAAAGTGAAAGTTTGAGCACGAGAGATGAGCAGAGGCTCGAGT TACAAGCCTCTAAAGATTGTTCTGTATACTGCGGCGCCGCGAGAGAAACG CGGGTAAACCACGCTTTATTTTTCGCATAAACAGTATAGACTTAAACTCG TATATCAAAATTACCGGATTTCGAGTACGGGCCGATTTTACTTTTGTTTT GAGTGGTTTCATTTTCGATTTCAAGCCAACATCTTAGCAATGGGGTGCTC GTCCATAGTTACAGTACAGGGGTTTGTGCAAAAAAATAAACATAGAAAAT TAAACTTTTCTATGTTTCACTTTTTTGAACCTATTCTTCAAAATGAAAAT ATTTAAGATTTTAAGTTCTTCTTTTATTCAATGATTTTTTACGGCATTTT GTTGACAATCTAACTCTTGCGTCAAANNNNNNNNNNNNNACTTTTTTGCA CCTATTCTTCAAAATGAAAATATTTAAGATTTTAAGTTCTTCTTTTATTC AATGATTTTTTACGGCATTTTGTTGACAATCTAACTCTTGCGTCAAATTC CCGCTTTCTTCAGTAAAGTGAAGATGAGAAAAAACCTAAGCCACGGATCA CGGATTGAAACAAATATATGAAGGGTGGGATTTTACAGCCACCCGTCGTG CAAAGCACTGAGAGGCCACGGGTGCCAAAAAGAAGGGCCGTTTGAAATGC GGCAGCCTCATTGGTGGAAATTTGATAAACAGCTNAGTAGTGGAAAACAC GCGAATGTCTGGAACAAAAAAGACCAAATTAATGGCAAAACAATGGAGGG TTTGACGTCACTCGCGTTGCAAGTTACACACTCGTTATTTGTTAATCCCA TCAGGCGATAGGTGGTTAGGCGGCGACGCTCTCTAATTTTCCAATCAGCG TCCGATCATTTTGAATGAAAGCAGAAAAGTTAAAAAGGGCGCGCTATCAG TGAAAGTTATTGTGACATGTTATGACAGAAAGTATGATTGATAAACTTGG TGAGTTATCAAAACAAATTTGTTGTCAAAGAGATTTAACAGTAAATGAAA ATACAGGCTAGATATCAACAGTCCCATGATTCAACCAACCCAAGTTAGAG CAGTCGACGGTAGTGGGACAACTGGATTCAATTAGCTATATTCAGTCTTG CTCAGTTGATATGATTGTACTTCTTACGATGGACAGTTCAGCTTACTGTG CGATTTTGAGCTCGATTTTTTGTAAAAAAATTGCCGTATTGAATACAAAA GAAAATAGTCAATCAAAATCAAAGAAATTTACTGTTAAATTGCGATTTTT GTGGGGATTTTTGTGTAAATGTGAATGGCAGCTTTCATGAGCTAAATCTT GGTACCATTTTCAACTTTCCCCCAACTTGCCTTCCTCAAAAATGAAGAAA GAAAGAAGAAATTCCCATCATTCCAATGGAGTGCATGACGTCAACTGTGC GGCAAATTACACACTCATAATTCGTTCATTATTGAAGCAGTGGGCAGTTT GGCGGTGGATGCTCTCTAATTCTCCAAGCAACGTCAGCCATTTTGAAGGA GAACAAACAAATTCAAAAGTGCACGCTAGCAACAAAAACGAAAATGGTCT CTTCTACTGATTGCTTCCCGGCGCTCCTTCACAACTGTTTATCAAATTTC CACCAATAAAATTGCCGCATTTCACATGACCCTAATTTTTGGCACTTGTG GCCTCTCAGTGCCTTGCACGACGGGCGACTGTAAAATCTCACCCTTCATA TATTATTTGTTTCAATCTGTGATCCTAAGGCTTAGGTTTTTTCTCAACGT CAATTTTCTGAAGAAAGCAGGGATTTGATGCGAGAGTTAGATTGTCAACA AAGTGCCATTTAAAAAATCATTGAATAAAAGAAGAATTTTAAATCTTAAA TAATTTCATTTTGAAGAATTGGTGCAAAAAAGTGAAACATAGAAAAGTTT TATTTTTTATTGGTTCAATCGAAATTTAATAGGGGATTTGGAAAACTTTC TATGTTTAGTTTTTTGCACAAAACCCTGTAACTATGGGCAAGCACCTCGT TGCTAAGATGTTGGCTTGAAATCAAAAGTGAAACCACTGAAAACAAAAGT AAAATCAGCCTGCACTCCAAATCCCGTAATCTTGGTACAGGAGTTTTGGT CTCTATTGTTTATCATCCTCTCTGCTTTATCCCCCAATTGTATGGGACTT GTGCGGCCTTGTGTCTAAAATTCAGGAAAATATGGAGGCCCTATGTGGTC TACTTTAGATTATATTTTCTGTCTTTTTTTAGTGCTGATCATGATCTTGG ATTTGAGCCAAAATGAGTTTAGCGGAAATAAAGGAGCATCTTAGAAAGAA AGAGCACATTGATTGTGCTGAATTATATCAGAATGGTGACAATGAAGTGA ATAAAGAACAACCATATTTTGTTGATCGTTTACGTCTTCTCCATGAAGTT GTCGATTCTCCACAACTATGCAATGTTCAAAACATTGAGTGTTTATTCAA ACTTGGTGCTGACCCAACAGAAAAGCAAATCAACGAAGATACTGCACTAC ACATGGCAGTTCAACAGCAAAAAGTGGATATTGATATCATTCGAGCTTTG GTGAACAGCCAACATGGCGAGTCAGCAGAATGCAGAATGAATGGAAAACC TTGCATTTGTGGTAAAAAAGCATTGCTGGTATCTAATAATCGTCAGAAGA CTCCAAGACAGTTAGATTACATATCTGATGAAGTACTCAGTTTCTTGAAC ATGGAAGGTACTTGTTGTTTGTCAATTTATACTAATCAGTAAGGTCCTCC AATAATAATGATCAGGAAACATTCACGTCCATTTTGATGTATTACTTTTT ACATTTGGACAATCGGTTCAAAAGTTATGATCTTGTAAAGTCAAAAATCA CTTTTCGAAAAGGCTGAAGAAACGATGATTTGTTTTCTTTTTCTTTCTTT TCTTCTGTTTCAATCGAAAGGACATGCATTTTAACGATGCAATTAACTCT TCCATTGAGTGTTAAAAGATACCAGAAGGTAATTGCATGTAAAATCAACA ATTAAAATTATTTTCTGGTAACATCTTATTGAAAAGAGATGTTATTGAAC AGAGCAGTGTCGTAGGAAGTATTTCCATATTTGGGGGGGCGGGCTCAAGT TTAGTGACACCGCGAGGGCCAACAATGGTTTGGCCCGAGGGGGGAATTTT GAAAATTTGGGCTCTAGATTGCTTGAAAATGCACTCAATTGTGACAATTA TAACAAATTAAAAAAGAAAAACTTTGCATTTTGCAAAAAAAACATTTTTG AAAAAATAATTGGGGGGCATAGCCCCCCCCCCTTGCCCCCCCCAGTTGCT ACAGCACTGCAGAGTCATGTCTGTAAAAATCTATATCTCTTCTTTTCTTC AAAATACTTTGTCTTACGACGAACAAGATAGTGTTGGTTGGTCTTGAGTT AATAATTCTTTTCCCAACGAATAAGTTTTTGTTTATAACCCCTTGGGAAT ATTTCTTCATAAAAAAGAAAAACAATTGTGCCAGTATACAATCATTATTT TTTCTCGCTGGAACTTTAAATCTTGAAAAACGGTTAAATAACCCAAATTC TCAATATATTTCAACCATTGATTGATAAACAACATCTTTAACCAACCCTA TTAGCCCCAGGGGGGGGGGGTAGAATCTACCACGCTGGAGTTCTTTTGTT TATATCTCAAAGAAAAATTTTTTAAACGACTTGAAACTTTTTTGACTTTT AATAAAATTTCATTAAGAGTACTTGTGCAAAATTTTAGGGTCATAGGTTG TCCAGATCAGGTTTTATGACTTTATTGTGAAACATGACATAAAACCCAGC TAAAATCACTTAAAACTCAAAATTTTAAAGTGCTGATAACTTCTAAACTA TTTATTCAATCATTTTCAAATTTTGACATGTGATAGGCATTGATAATACA AACTTGAAAAATTTAATGAAAATTTTTGAAAATGATGACGTCATCATTTA TGACGTCATCAAATTTTGAAAATTTTACTCATCTTCAGCATAGATTTTAA GAAAAACTCTTAATGGAAATTTCAAAACCGGCAATTATGTTAAAGAACAG TCTTTTCCCTTTCAGAATCTTCAAACAGAATTGAAATATCTTTATTGGTT CAACTGTAATAGACATTTTTGTAAACCATATATTTGGGCTTTTTTCCGAA AGGTCGAAATTTTGTGATGACGTCATCAGTTTTTGCATGACGTCATAAAT TTTTTTTTTCTTCCTAGAAAATTGTATCATGATGGAGAACATCTGTACCA AATTTCATGGCCATAGCTCTTCTAGATCGAAAATAATCGTGGGTGGTAGA TTCTACCCCCCCCCCCTGGGGATACAAAAGTCAAAAAAGCTTGGGGCTAA TAGGGTTAACCAATGAACCAAATTAAGACTTTTTAGCTTTTAAAAAAATT GTCTTTAATTATTCTAAAGGATCATAATTTCATATTTTTAAAACTTGAAA CTACCTGAAAAAAGAAGTGTCGATGTTTTCTTTTGTTTTTTTTCCAGAAT TGATTTTAGCCATCCATAATGCAAGTATTTCTCTTAACGATAAAGACACA ACTGGCTTCAAAAACGTTCACCAAGTTCTCAAGAAAATCGGACGAACATT ACCTGATGATTTCAGTCAAGAATTATTGAATCTTTTACTTAAGTTAGAAG GTGATCACCATTTTTGGGTTTTACCAATGTTATCTTATTTATTGACTATC AACAATTTGGATGAAATTGCGTGTATGGCTATCGATAAACCAAAATGGCA GACTTACTATATGGCAAAATCATTGATCAAAATAAAACGTTGTCACCCTT TAAGTACTGTAGTCGAAAAGGACAACTTTATTCATACTTGGCACCAAATA TTTAAGTTTAACGAAGAGAAGAAAGAATTGGAATGTCTTGACAACGATCT TAGATATCCTGAAACAAAAGAGAGAAGAGACAACAAGGAAGAGTACTTGT GAGTTCATTTTAATTTTACTATCGCAGATGCCTAATGTAACCTCTAGAGA ATTCTTTTGTTGCTCTGAATTGAATAAATTCATCCTTTATTTTATCCACC CCCCCCCTGATTTACAATTTCCAACTCCATTTCAATAAAATCTTAAAATC CACTTTTTCTCCCACATTTATCAAAAAAAACCCTGCTTTTATTAGTTATC TTATCATCTTATATTGTCAAGCTTATAGCGGTGTTTATGATTTATTAGTC GCGTTGAAAATAACAAAACACTTTTGCGAGTTATTTTTAATAATTGTGAC TTTGTTCTTTTTAGGAAATTCATTAAAAATGAGAAGGTCTTGATGTATTT GATATCGGTGGCAGCCAACAATTTGTTGGAGGATAAAACTGTACTGTACT TGCTGATAACCAAATCACTTCTTCACGACTTAAAAGAAATGAAAGAGTAT ATTCTAAATTGGAAGCATTTAGGGTTGAGGAATCTAGATTTATCAGGCCA AGAGCTTCAATGTTTTCATGATAAAACAACGTGGATTGCCTTGAATAATA ATTCATTAAAATCTATTCCGAAGATGCCAAGGTCAAACCAATGGAAATCT CTAACTTTCATCAACCTGGAAGGAAATAAATTGGAAAATATTGGGCCAGA AATTTTCACTCTAAAGCCACTACAAAGAATTAACCTCAATAACAATCAAA TCAAGTTTTTGCCAAATATTGATAAATTTGCGGAAACGTTAACATGTCTT GAGTTGAGCAAGAACTTTCTAACAAATTTACCGAAGGCATTAGCAAAATC TTCTATCACTTCACTCTATTTGGCTGAAAACAAATTCGAAAGTTTACCAT TATCCATTTGTGAAATGCCACTGACCTATCTGGATCTCAGTGGTAACAAA AATATCATCGATTTTCCGATTGATCTTGGACGTTTGATAAGGTCAGATTC TCAGTCATCTCCCAACTTGAAGATCGATGATATGAACCAGGTGCGAAAAT TATAAACATATACGGAATTGATCAAATTACAAAGAATCAACTTTTTCCAA ACAAGAAATTTAGTTTTTCTCTCTCTAGAATTTCAGCCCGCTTCATCAAC CTCCATCCGAGTTTTCCATGTTTTACTTAAATCTTCAGCAATAAATAATT TAATTATTTTAAATAGTTCTTTGACTATAGATCTCTTTATTTTCAGTTAT GTTATCCACAAAATATGATCGAAAAACCAAGACTTTTGCTCGCGTATTTA AGAAGCGAGTTTCTGAAGACCTCAATTAGAAATCAAGAAATGAATTTAAT GTTTGTTGGTCCTTTTTCAAAATGGAATCGAATATTGTCAGCTAATTTGT TAAACGAAAAGGTTACTCCAATTGATGATGAAAATAAAGGTATGGTTTTT AGTTATACTTTAATGTCAGAAATTTTCGGGGCCAGACCAGTAAAAAATTT TGATGAAAAAAGTTTAACTTTAGATTTCATAACTAGCAAATTTGAAATAC TTTTCATTTTTTTGTGCGGGAATTTAATTTCGCGAATCAGCTATGTGAAA AAACTTAATTTTTGGTAATTTTTGGTAATTTTTGGAGGTACTTTGAAGTA GTTTGAGTAATTTTGTATGGTTATTTTCTTCCACAAAGTTTTTGCGTCGA AGGTTACAGCCTCTAGAAGGTAGCTCGTTGGATTAAAATAGAACTGTTTT CTGGGATTTTTTTCGCTCAAACGGTACACTTTCTAAAGCCTAACTTTTTA TACAATGATTCTATGCGAGAAATAATCTTATATATAAAATCAAGAGGCTT CATGGTACCTCTGTAAACAAAAAGTTCCTTTTCTAATTTTTATTGAATTA ATTTTTTATACAAATACTGTAAGCACCATCCAAAATCATCAGAAAGCTAA TTTCAGCAAGAAGTTACACTTTAGTCTAGGTGGTGCAATTTAAATGATGT ATAATCTTGCTATACATACTTTAAAAATCTTTAATCTCCCAATTCATTTT TCAATCTAGAAATCGAATTTCCAAGCCATGATGGTTATTCTTTGAAGTAC AAATCAATCAAAATGTCATTACAATCGCTGCAATATCAACTCAAACCCGT CATATTTCCAGGGCAGCTTGACTGGACACAAGTATTCCTTACAAATAGGT CACTGTATCTTGTAGTATGGGTGAAGGGTTCACCTTCAGTTTTGAAAGAA TGGCTAAACTGTTTGGTTTCATATGCTCCAGATAGTCTTATCATGATCGT CAAAATACACCGATTTCAAACCGACGACTCTACCGAAAACATTGAAAACA GTATCAATTCTGTTGTTGAAAATAACGACAAACAATCGCTGATCGGTCAA TTACGAGTGGAAAAGACAAAAATAAAACGTGAAAAGAAACGGAAACGAGA TAATTCAAATCGATGTCAAACAGAGCTGATAACATTCTTGGATAAGGAAT TCAAGCCATCAAGGAATTTACATTTCGGAAAATGGAAAGGCAATAATAAT TTGTCTTTGAACGAATTTTGGTTTAACTACATTGACATGAATGATGCTAA AGGTGGGAAGTTCGTTTNTTAAAAATCTTTAATCTCCCAATTCATTTTTC AATCTAGAAATCGAATTTCCAAGCCATGATGGTTATTCTTTGAAGTACAA ATCAATCAAAATGTCATTACAATCGCTGCAATATCAACTCAAACCCGTCA TATTTCCAGGGCAGCTTGACTGGACACAAGTATTCCTTACAAATAGGTCA CTGTATCTTGTAGTATGGGTGGAGGGTTCACCTTCAGTTTTGAAAGAATG GCTAAACTGTTTGATTTCATATGCTCCAGATAGTCTTATCATGATCGTCA AAATACACCGATTTCAAACCGACGACTCTACCGAAAACAGTATCAATTCT GTTGTTGAAAATAACGACAAACAATCGCTGATTGGTCGATTGCAAGTGGA AAAGACAAAAATAAAACGTGAAAAGAAAAGGAAACGAGATAATTCAAAAG GATGTCAAACAGAGCTGATAACCTTCTTGGATAAGGAATTCAAGCCATCA AGGAATTTACACTTTGGAAAATGGAAAGGCAATAATAATTCGTCTTTGAA CGAATTTTGGTTTAACTACATTGACATGAATGATGCTAAAGGTGGGAATT TCGTTGCTCTTTGATTCTTCTAATTTCCCACAAATTTTTTTCGTTTATCG TTGGCTATTCTTTTTTGAAAATCCTAGGTTTGGACGACCATTCTTTAAAA AGTAACAGAAAAGACTCGAATTCGACCCTGTTGGATAGAGTTTTCAAAGA CCTTAGGGAACTTGTGGTCCTTTCATATATCGCTGGGTGTTATGAGTGAC ACCCGCTGTGTGTTGAAGTCTTACAGAAAATGATCAAACCCTTCAATTTG TGTTTGTTGTTGGGGTTGGTCTTTTTTGTGATTAGAATTTTTTAAATTAT TTTTTTTACTTATCATTTTCAATATAACTTTCTTTAGACATCAAAAAGCT GAGGGAAAATATTTGGGAGGTGGCTTTATCGTTACCAGTCAATTTTAAGA ACAAGAATGAGGATCGTATCCTTGGCTGGAAAATACCCAAATTTTATTTC GCATTGGATGAGAAAATCAAAGAGAACGCCAAAAGAAAAGATAAACGAAT TGCAACAATTTCGATCCAAGATGTTAAAGATGAGATACAAAGATTTGACA GACAACAAGACTGTAACAGCCCGGCTATTCTGGTGAATTGTTTGCTAGAT GAAGATATTTGTGAAATGCTACAGTTTCTAAAGGACACTGGTAATTCATT AAACTTTTTAGGAAAGAAATAGCACGCCCCTGTGTCACAGACCCTGAAAG ACTCCTGCTCCACTGAACAATCTGACCAAAATTCCGTCCCTGGTAGGAAG AATACTTTATAATTTCAGCCCTACCGTGAAATTGACTTTGATTCCATCTC CATTTAAGATTCAATGGAAGAAATTGTGCTTCAAACCATCCTCACTAGAT TTAATAAGGTGGCAACGAAAGAGTTTCTATCCCAATTTTGTTTTGAATGA AATTTTCATCCCACGTGTAAAAAAGAGTTGAACAGATGTTTTACTGTACT AAAATTCAATAAGTATATACCAAATTCTAAAAAAAAAATTTCTGGGGGAG TTGAGGTTTTTAGGAAAAAAACGATGGGGTTGGGTTGCGGATAACCCTGT GGGGGTGATTTCTTTCAGGTGGAGGTTTGAGGGGTGCTGCTGCCCACTAT GTTCATAGTGTGCACCACCTGCCCCCAGAATAGTGGGGGGGGGGTTGGTG TTTTGGGTCGAAAATTTCCAGGTGGGATTGGGAGATTTTCAAGTTTTAGG TGGGAGAAACAAATTAAGGTGGGGATTAATTTCTTTAGGTGGGACTTTTG GTGTTTTTCTTTTAAACGCCCCCTTGAATAAATGCACCTCCCTAAAGGAA AAATATTCAACAAATGCCCCCTTTGAATAAACGCCTCCCCTTTAGGAGGG GCGTTTATTTGAAATAAGTAGCTGTAAGGGAGAATTTTATAAAGGTAATC TTAAATATGAGTTATTAATTGTATTATTTCAGTACTCAAACTCATTTTTA CCTTTTAGCAAAACGAGCTTCTCATTCACTTTATTAAAGTGATCTTTATT AAAGATTATTCCTTAAACGCGCCTCCTCGAATTAACGCCACTCCTAAAAT CATAAAAATTTAATAAACGCCCGTTGCGTTTATTCGATGTAACACGGCAT TAATATATCATATGTAATATATTAGCATCTTCCTATTATGGTAAAGAATT ATTTTTTCGTCCCTGGGGATAATATTTTTAGCTGGCATTTAGGAGTCTGG ATTGAAGGTGGGAATTTTAGGGTTAGGTGGGACCTGAATTTTTAAGTGGG ATCTGGAACCCCCATGCACACTATGAATTGTTTTTCCTCTTGATAATTTT TCAACGGAAAATCAATATCTGTTTTTAGTATCATTAGCAATAATTTACCT CTTTCTTTTTCCAGGTCATTTGATGTACTTCCATAAAGTCAATCAAAAAT TGAACGAAGTTGTGATCTTAAATTTCAAACCACTTCAAAAGCTTCTCAAA ACATTGAAAGATGGCCATAGAACTGATCCCAATATGAAAGAACTTTCACG GGAAGATCTAAAGCAAATTATGAAAGATGTCACTGTTGATGCGATCAGTA ATGATTCACACGACAATGACGAAAACGTATTACTAGCTGTTGACCACGTG ATATCTCTTGTAGAGAATTTCAAGATTGGTTTCAATATCTCTGAAAATCA GATATGTTTTCATCTTGGTATGGAGTATTATCAGCAATCATACCAAGGTG CGTTGCATTTGAAAGAAAAGTTCAACAGGGTGTTCACTTTTGAATGTTTA CCTTTTGGATTTTGGAAGAAGTTGCTGTCTCGTCTTAGTTTATATACCAA TGGTATTGTCAACAATGATGAATCACCATATTCAAACTACATGAACCCAA AGGTAACCAACAGCTCACCTGGTGAAGCCTATCGACAAAGTTTCGTTTAT TACCAGGAAGAAGTTGTCTTCATCAAGATTCAAATCTTGGAAAGCAGAGA GAATAACAATTCACACCCGTGGATACAAAGGTTCGAAGATATTGATCGTA AAGAAAAAGTGCTTGTGTTCATTAGAGGATCAGAACGTGCCAAAACATGT CGAATCTTTACTGAGCTGATCCACCATATCGAGACGAGTATCGGAGATTA TCCAGAATCAACATTGAAACCTTTTGAAGATGTCAGGCGGTGGACGAGAT GCCCAAGCTGTCAGTATAACCGACAAGGAAAGGTGTTTGGTATGGAAGAT TGTTTTAAGCAGTACCAGGAAAATCTCGAAGAAAAAAGTTTTGAGTGCCC GCCTTGTCGCAAAAGATGGCTTATGAAAGATCTCTTTCCTGATATGGTTT TTGCTGATGTACCAGAGATTCTACTACCATCGTGTCATGTGTCAGCTGAC GTTGATTGGAGTGATGCCATTGAGGGGGGCTTCGGCCTAGTCTGCCGAAG CACACTCACACCATGTAATCGTGATCACAGTGCCCTCAAAGTAGCCTTGA AGAAACAGAAAGATTGCGTGCCTTTTGATGATGTTAATCCAATGGAAATA TTCTTTGCTTTTCGACACGAATCAGTTCTCAGCTATAAACTAGCTGACCA TCCTTACATTGTCACATTTCTTGGCATCCAGAGGCAGCAAAGGATAACTG TGACAGAATGGGCAGACGAAGGAAGCCTGTCAGATCGGATGAAGGAGGGA CAGTCGTCTTTCAGTCGCTTGTTGCTGTATCGTATTTTCTTCCAAATCTC CGACGCGTTGAATTTCATGCACAGTCTTCATATCTCCCATCGTGATCTTC ATGCAGGAAACATCTTCTTCTTCACAGAGGATACCAACATTGATACTAAT GTCAAACTCGCAGATTTTGGTGTATCGGTCTTTGCCAATGGTCGAGTGTT GCAAGAGATAATTGGTATGGAGAAATATAGACCACCAGAACTGTTCCTGT TTGATTCTACCTATACAGCATCAGCTGTGGATATTTATGCCGTTGGTTTG AACATGTATCGAGCATTGACCTTTATGAAATTATTCAATGGATTCCTGAC ACAAAATCTTGGCTTGAAAAAATTGATGAAAAGGAAAGGAGATTTTGAAA AGGCTTTTCAGTTCGACCAAGTTCGGCAGGATGCTATTTGTTTGAAACGA ATGATGCGAGCCTGTATACAATACCATCCAAACGATAGAGTGAACGATAT CAAATGTATCGTTTATCTGCTCAAACATCCTTGCTTTCAACTCTTAATGA ACAGCATTCCGCTGACCACTTCTCCATCCTATGAAATGATCATGACAAAA AGGTTTGATTCCAGCACAAATCTCGTAAAAGATCAAGTTCATTTTGTCTA CGCAAAAGAGAACAGAGATTCTAACGATATAACCATCAGAATCCGAACTG TTGCTGGCATGGATCACATTCGTAAAGAAGGACAGAAGAATGTCAATGAT TCGAGAGAGGATTTGTTGACCCTCATTGGTGATTTCACCAAAGAAGAGAT GGAATTCCAAAGCATTCAATATGACGATTTAAACGTGATAGTATGTATCA AACTCAAAGATCGATTCAAAATAGTGTTGGTTCCACGAGGTGAAAAGNAC GTGATAGTATGTATCAAACTCAAAGATCGATTCAAAATAGTGTTGGTTCC ACGGGGTGAAAAGAACAAGTTGAGTCGAGAATATAATACAACAATGGATG ATATGATTGAAGGAAGATTTCGAAAGATGCAATGTCTTCAAAATCAACTT TTTGTTTTGTATGACGACTGCACTGGGGAGAAAACAAAAACGCTTATCAC GCATGGATCATTTGAGCCTAACTTACCAGAAGCAGACAACCCAACATCAA CCATATTATCTTCCGTCTCATTCAATATTGATTTTCCTGAAGTTAAAGCA ATCCAACTTTATGAGCTGAGAGCCAACAAAGCCATCAAGGAACTTGACGT CAAGGACTTCGTTGCTGATTCAAGATTCCTCGTTCTTACAATAAAACAGG CGACTCAGTTTTTCATCTTAAGCTTTTATCAAGAAGGAGCATTATTACTG CAGGAGAAATATCTCACAGAAGATATAGGGTGTGAGATTAAGCGGATGTT TCTACACAACGATAAGCTGATCTTCGTAGCAGCGGGTGAAGGGAAGAAGG TGAAAATTTTGATTTATAATATATCACAAGCAGAAAAAAGTGATGTTTAT CAGATCGACATTGATACCAAGAAGGAATGTAATTTCTCTGGGTTATATAC CGGCCCGATTGATATCACCTCATTTTGCCACGCTAATGGAACGTATTGGT TTGGAACTCATACAGGTTACATATTCATCGTCAGCCAAATTGATGGTCAA TTATACTCAACTCCAATGAAGCCGTATACCAGCCCAGTCACCGATCTTAT CTTAGCTGAAAACAATGTTGTGTTAAGCTATGGAAAAACGCTTGACAAAG ATGCATTTACATATTCGTATAATGACAGCCCTGGGTTTCCAAGAGAGTCA CGTGTTTACGAAGTTCTCCTCGAGAAATGGTTCCAGTTGAATCGAGACTT TTTGGAAGCTCGTAATAAAGAAAAACCTGTTTGTCATGATTTCGCATCTG ATTTGCTTTTGGTTTGGGATGCACCAAACAGTAAAGACTTGGCCAGATAT CAAATGAAACGAACCAAAGGATCAGCGACCAACGAAAAGCTGAAGAGAGT CAGAGACCACAGTAAGCCTAGGTTTTTTCTAATGCTGTTCAACATCTAAG GGCCGTTCCAAGAGATTTTCCAACTACAATTGGAGTCCATGATTAAACTG TCTTTATATGTGATATTAAATGGTCAAGCTATCAAACGTCGTTTGGTTAG AAATTCCCGCTTGTTAATCAAGTTTTGTTCATTAGTAGTTGATACATTAG TATTCAGGGCTTACTTCATACTGTGTACACAAAATTTATCTTAAAATTTC TATTTCAATGATCTTAAGTTTTTTTTATTTTTCCGGCGGCCAGATGAGAG CTTTTTTACTTCACCCGCATTCCGGAAAAACAACATTTTTTTATGTCCGC CTGATTGAAATAATTTTTCTTGATGGTTGATACCATCATCTGTACTTAAA CATCACCCAACACAATTAGATTAAAATGTCTCTGGGATCTGGATGCTATC ACTTTTCAGTTCCTTCGTCTAAATTAATGGATTCGGATTTTCAAAATCTT TTCCCTATACTTATACTTTGTTCTTTTTTATGTTTTAGAGAAAGAATGTG GCAACAAAGATCGGGTATGATTGTTTTTCTTCATGACAGCTTATTAGATT TCATGTTTTTCCTTTTTTTTAACCAGTATTTGTCCTAGACTGAAAGAATC CTCTATCTCTTTTTACTGTACATTGAAAAAGTTATATTTCCATTTTCCAT TTGGAAATTTTCCAATCAAAATTCATTTAACCTTTAAAGTTAGAAATTTA AAAGAGGCTCGAATATATGATCAATTTTTATCATATTTGAACACAGAAAA AGAATACCACAATCAAGGTCATAATATTTGAGAAAAAAGGGAAATACACC GGGAAGTTTTTGAATCACAATCGATTTGTAAGTGCTCTAAAGTAGGTTAG AAGGGTAGAGTTTTAACTCTGAGTTTTAACATGAGACTTAAGACTTAGGA CCTTAGGATTTTAGCATTCAAAAGTTGAAAAATAGTCCAATAAGGCTCAG AATATAGCCTGGAAGTCTGCCAACCCCTCCCGAATTGAAATATTCGATGA AATTAAAGAGATAGCCCAAAATCGACTTTCTCGCCGGAACTTTAAATCTT GAAAAACGTTAAAATAACCAAAATTATCAAAATATTATGACCTTGATTGC AGTTAATAACCAAAAAGCATATTTTATTCTTGTAAAGTTGCACCCAGAAA ACTCAAACGTGGTACAAGGAGCAAACTCGATCGCAGTACAGGATGCAAGT TCGAACGCGGTGCAGGGAGCAAACTCGAACGTTGTTCAAGAGACAAACTC GAACGCGGTGCAAGAGACAAACTCGAACGCGGTGCAAGAGACAAACTCGA ACGCGGTGCAAGAGACAAACTCGAACGCAGTGCAAGAGGCAAACTCGAAC GCGGTGCAAGAGACAAACTCGAATGCAGTACAACAAGTAAACTCAGACGT GATTCAAGAAAAAAACTCGAACGAAGTGCAAGGAGCAAACTTGACCAGAT CGCCTACCAACCGAATCCCCAATCCTTGCACCGATCAAAGTGCTTTTACA TCCATACTCCAACAACGTGGTTTGAAAATTTACAAAGTTAAAGGTGATGG AAATTGCTTCTTTCGAGCTATATCACATCAGCTGTACGATGGTGATGATT CACAGTACGCTCATATCCGAAGTAAAGCTATTACTTATATCCTTAAAAAT GTTGATAATTTCACTGGTTTTTTAGCTGATGGGGAAAATATTTTACCTTA TATTCAGCGAATGAGTCAAGATGGCGCGTATACAGATAACTTGATTATAC AAGCTACTGCAAATGCATTTCAAATCGCTATAGATGTGATTAATTCAAAT CAAGTGCAATACCCAGGAACCAGGGAAATTCCTCTTACTGAAGGAATACC CCCGAGAAAACGGGTTGTTCTAGGACATTATGATCAAAATCATTTTGACT CGACTGTCCCAATATAACAATTACAAATTTTGATTAATAATTATATTTTT GTCTCAATAATATCGCGTATTAAATTTTCAATTTATTTTCAATATCAATG TATTTCGGAAATATTTTTTAATATTTTTAATTATAAATTAAATAATTTTT ATAATTTGTTATTACTTCTTCAAGATTTAATATATTTCAAAAATTTATAC AATTAAATAGTTGTTTCAAAAGAGTATTTTATTATTTTATTAGCGCACAA TTTTCACACACAATTTTATACATTTACAAGTTTGTCTTCGCTATTTTTGT ATGGATTACTTTTTATATGGTTGAATTTTATTTTTTGCAAAATAGCTAAA CCTTCTATTTAGGGTCTAGGCATACAGTTTTGGAAAGACTTAAATAGTAC GTTAAAAGGTTTTGCATGACTATTTCAACCCTAAAATATTGACAAATTTT TTGACTTCTCTTTCCTAACGAGTGGTTTCTACAAGAAATAAGATATAACA AAGACTGTTTACTTTTATTGTGGATAAACTTTGAAAGCTTATCAGGGCTA AGGAGCGGTCATAAAGTATCTACTAGAGGGGGTGGAGGACTTTAGGGGGG GAGGAGGTGCGAAAAATAATTGCCACCCTTAGGGAGAGGGGTATGAAATA TTTTTACCATCTTTGGGGGTGCGAATTTTTCTTTGACATCTCAAGACGAT CCAAAATGAAGTCTTTTTAACCATTTATCAGAGCCTCTTTTGAAAAATTA ACTTTGAAGATTTACCAATGATAATCTATTATTTTCCCTTGCATGCTGCA AAAAAATCAACTTTCAAGAAATTTAGCTTGAAATTCTGGTCTTTATTTCA AGAATTTCACAGGGTCCGCACCAACAGGACAGGAAGGACAGAGGATGGGT AATGTCCCGTCACTATAGTGTCATTTTTAAATCTGACTTTTTATTATTAT TATTATATATTAACGCCTAATGTGTGAGTATTTTTGTCCATTTTCATAAG AAATAAGGTGTTTTAGGGTCTAAGAAGCCTTAAATGTTCTCAGCTTGTTC TTAATATTTTGGTCGTCGAAGCCTTATGTTTTTATTCTAGTTTTTTCTTA TAAAACTGACTTTCCTGAAAATGTAAGTTCTCAATAGCCTATAATAAAAG TCAGTTCAAAACAGAGTGGTTTTAGCTAAATTTTCTCCGTCGGCGCAAAC CATGGTTGTGCCTCTGTTATAAAAATCACAACAGTAAAATTTCCTGAAAA GAACACACAAAAATGAGAAAATATAAATAAAATTGTGAAGCACAGTAGCA AGGAAACAATGTTTAAAATCCAATATTTCACATTTCAGCAGCTTTCATCC AACTTTCATTCGAGC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000514XLOC_000514Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000854-exon-sc0000005-1575043694:1144170..1144333TCONS_00000854-exon-sc0000005-1575043694:1144170..1144333Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1137677..1138151TCONS_00000854-exon-sc0000005-1575043694:1137677..1138151Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1135436..1135886TCONS_00000854-exon-sc0000005-1575043694:1135436..1135886Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1134444..1135119TCONS_00000854-exon-sc0000005-1575043694:1134444..1135119Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1134045..1134237TCONS_00000854-exon-sc0000005-1575043694:1134045..1134237Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1132882..1133424TCONS_00000854-exon-sc0000005-1575043694:1132882..1133424Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1131644..1131946TCONS_00000854-exon-sc0000005-1575043694:1131644..1131946Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1127123..1130419TCONS_00000854-exon-sc0000005-1575043694:1127123..1130419Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1126570..1126595TCONS_00000854-exon-sc0000005-1575043694:1126570..1126595Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1575043694:1123819..1125946TCONS_00000854-exon-sc0000005-1575043694:1123819..1125946Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1144170..1144333TCONS_00000854-exon-sc0000005-1510915933:1144170..1144333Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1137677..1138151TCONS_00000854-exon-sc0000005-1510915933:1137677..1138151Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1135436..1135886TCONS_00000854-exon-sc0000005-1510915933:1135436..1135886Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1134444..1135119TCONS_00000854-exon-sc0000005-1510915933:1134444..1135119Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1134045..1134237TCONS_00000854-exon-sc0000005-1510915933:1134045..1134237Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1132882..1133424TCONS_00000854-exon-sc0000005-1510915933:1132882..1133424Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1131644..1131946TCONS_00000854-exon-sc0000005-1510915933:1131644..1131946Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1127123..1130419TCONS_00000854-exon-sc0000005-1510915933:1127123..1130419Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1126570..1126595TCONS_00000854-exon-sc0000005-1510915933:1126570..1126595Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1510915933:1123819..1125946TCONS_00000854-exon-sc0000005-1510915933:1123819..1125946Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1144170..1144333TCONS_00000854-exon-sc0000005-1491911889:1144170..1144333Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1137677..1138151TCONS_00000854-exon-sc0000005-1491911889:1137677..1138151Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1135436..1135886TCONS_00000854-exon-sc0000005-1491911889:1135436..1135886Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1134444..1135119TCONS_00000854-exon-sc0000005-1491911889:1134444..1135119Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1134045..1134237TCONS_00000854-exon-sc0000005-1491911889:1134045..1134237Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1132882..1133424TCONS_00000854-exon-sc0000005-1491911889:1132882..1133424Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1131644..1131946TCONS_00000854-exon-sc0000005-1491911889:1131644..1131946Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1127123..1130419TCONS_00000854-exon-sc0000005-1491911889:1127123..1130419Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1126570..1126595TCONS_00000854-exon-sc0000005-1491911889:1126570..1126595Clytia hemisphaericaexon
TCONS_00000854-exon-sc0000005-1491911889:1123819..1125946TCONS_00000854-exon-sc0000005-1491911889:1123819..1125946Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000005supercontigsc0000005:1123819..1144333 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
4.80777e-06 0.00124559 2.08856e-09 0.116751 1.55321 0.506735 1.4324 0.313872 0.000987216 1.72715 0.600462 0.413836 0.90068 0.163757 3.66326e-11 3.0735e-08 0.00100463 6.21827e-08 2.20672e-08 0 0.00016952 9.22732e-08 0.0086437 7.31436e-10 2.53426 3.30563 0 0.0351447 0.00767936 0.00914131
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00000854 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top