Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000596 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000596
Unique NameTCONS_00000596
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1407

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000596 ID=TCONS_00000596|Name=TCONS_00000596|organism=Clytia hemisphaerica|type=transcript|length=1407bp
TCTGCTTCTTCACTATACCGTAACAGGCAGATAAGCCGATATTTGGCGAG
GTTGGAAAGTTGAAAATCTTCAAGTGAAAACCAGatgcatttttttcttt
aggAGGTGCTGTATTTCTGTTGAAATTATCGATAATTAGTAATACTACAC
AATAAGAAGATGGAGGCTATTAAAGATACATttacaaaatccaaaaagaa
aaaggtgAAAGCCGTTCACCAAAAGGTTAAAGTTTTTAGAGTCCATGATC
CAAAGATGGCTGTTTTAATGTGGGGTGTGACACATTCGGTGTCGCAATTG
TCTCATGTCCCACAACAAGTTATGTTGCTCAAAGACGACTTCAAAGCATA
CAGCAAAATCAAGATAGATAACCATTTTTATAACAAAGAACACATGCCTG
GTcacttcaaattcaaagaatATATGCCGTTAGTTTTCCGGAACCTAAGG
GAACGATTTGCAATCGATGAAAAGTTATATGCAGCTTCATTTTTAATCCA
ACCGCAACTCAGTAAAGCACAAGGGAATAGCGGTGCAAAATTTCTACTGA
CCACCGACAAGAGATTCTATATCAAAACATTGCAGAGCGTTGAAGTGGAA
ATGATGCATCATATAATGCCTAGTTACCACAGatataTCGTCGAATCACA
CTCGGACACACTGTTACCACAATACCTTGGTATGTATCGGACGACGTTGG
ACAACAAAGAATATTACTACCTCGTTGTACGAAGTGTTTTCAGCTGCAAG
AAGAAAGTACAAAAGAAATACGATTTGAAGGGCTCGCGAATCGATCGAGA
AGCCAAAGACTCTGAGAAGGATAAGGAAAGTGTCACTTTCAAAGATAATG
ACTTCACCAAAGAAAATGCCAGGATATTCATTGGTgctgaacaaaaagaa
aaattcaaagataGGCTAACTAAAGACGTCAACttTCTGTCTGGTCTGAA
CATAATGGATTACAGTTTATTGGTTGGTATTCACGACACCGAACACGTCG
ACTCTTCCGAACCGGAAGACGAACAAGACGGTGAAGGACCTGACGGTGGC
ACTACCGGTGACGAATCTGGCGACGGCCTCGAAGAGCCGGCATCTCCTAC
TACTGACGGAGAAACATCTGCCGCTACCCCTGAGACGCTTGCAGCACGTC
GCCAACGTTACTCGCGAACGGAAAGTGTATCCAGTAGCGATGGTTACGAA
TCGGAGTACTTTGCGCTCCCGTCCTCTGACGaatCACTTCATTCCGTATA
TTACATGGGTATCATCGACGTCTTAACGTATTACGGCGCCACCAAAAAAG
CGGCACACGCGGCAAAGACAGTGAAACACGGGGTGTTAAACATAAAACGG
CGTTCGACAAGCGAACCCAATATGCCCAACATGAAACTCAGCATGGAGTT
TAATAAG
Run BLAST on NCBI

transcript from alignment at sc0000002:1322434..1335950-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000596 ID=TCONS_00000596|Name=TCONS_00000596|organism=Clytia hemisphaerica|type=transcript|length=13517bp|location=Sequence derived from alignment at sc0000002:1322434..1335950- (Clytia hemisphaerica)
TCTGCTTCTTCACTATACCGTAACAGGCAGATAAGCCGATATTTGGCGAG GTTGGAAAGTTGAAAATCTTCAAGTGAAAACCAGATGCATTTTTTTCTTT AGGAGGTGCTGTATTTCTGTTGAAATTATCGATAATTAGTAATACTACAC AATAAGAAGATGGAGGCTATTAAAGATACATTTACAAAATCCAAAAAGAA AAAGGTGAAAGCCGTTCACCAAAAGGTTAAAGTTTTTAGAGTCCATGATC CAAAGATGGCTGTTTTAATGTGGGGTGTGACACATTCGGTGAGATTTTCT TTTATTACCAGAAACTTTAGAGGAGAACTACAAATACAAATATAAAACCG TCACAACTGAACTTGNTTTTATTACCGGAAACTTTAGAGGAGAACTACAA ATACAAATATAAAACCGTCACAACTGAACTTGAGACATTTAAAGAATTTA GCTAGCCAAAGCTAGCTGCCAAGCTCAGTTTTTCAAATCCTATTGGTTCA GGACCCGCCCTGCCGACGCACCGGACTGTCTCGGTATTTGTCCGGTGGTA AAAAGTATCCTTTCGCTACACCGGAGGCAATAAGTCCGGTGTCAGTCCGG TGTTGCATACAGGTAATTTTGGACGCCGGACATTTATGAAACAAAAAATT AAGAAACACCGGACGCACAGGACTGGTGTTTTGATTGTCCGGTGGAAACA AATATCCTTCTCCGACACCTGACATCCGACTTCTTTAAGTCCGGTGTAGA GATTGTCCGGTGGTAAAAAAATTTCTCATTTTACACCGGACTTTCGCGTG TCCGGTGTTCCTTAGGTCCGGTGCATCGGCAGGGTCCTATTGGTCCTTGT CTTTTTATTTCAACTCACAAAAATTTTAGGGACCTGTCAAATACTGTAAG TTCATAGTCATAGTGGACATCCCAGCCTCATCTTATTCTGACACCCTTCT TTACTTTTATAAGAGTTGGAAATAAAAGGAGGTCAGATCATATAGATTGA TTTGGTGTTTGCTTTAATAGCGTGGTTAGAGAGGAAAAAATTCAGTCAGT CACACTAGCGTCCCGCCAAAATGCGTAGCAAAGATTAATGATGATGCGAA AGTGCTATAATCTTTAACTTGACTTGCAAGCAAAATAATGTGCCGTAAAA CTTCTAAAGGGATTCATGAAAAAATAACCTGGCGCTTTTTAATGAAATTA ACATTTACAAAAACAATGAGAAATTGCCAATTGCCATTTGAGCCATAGAT GAAAAAATTTGAGCCAAGCCAACCTTAAAAACTAGTTTGAAGATCAACTT CCCAAGAAAAAGATCTATGGGGGAGAGAAAACCCACCTAGATCCGCGCAC CGCAGAATAAGCTATTTCCTGGAAATTTTGCCAGACCTCAAACAATGGCC CATTTACATGTGCAGAATTATTTTTGCTTTAACGATAATCAAGGCCTAAC AAATTGAAGCGCTGTCTCAGGAATTGAATTACAAAATTTGGTTGGCTGAT TGGCTGCTGCACGTTTAGTAATCGGTCATTTTGTTCATAGTGTCCTCCCC CCCCCCTTTATAAAGGGGGGGGAAACCAATTTTCCAATTTTGAATGGGTG AGGGGGGAAAATGAAAATTTGAATAGTAAAGGGGGGGAAAAAAAGAGGGG GGAAAACATCGATAGTTGGCAAATTTGGTGGGGGGAAGTATGAAATCACT TCAACTTTATCTCAGCAACCAAGGTAAGTCCACATGATATCATGTGATTA GATCATGATTGAAAAATTAACCAAATTTTGTTCTATTTTGTCCAGTTTTG TCTAGTATTCCTTTTGCAGCAAAATTTTACGTTTGTGTCAGGTTGATATT TGAGAAATTTATACGGGTATATGGGGGCAACTGATATTTTCAGAATTTTC TGGGGGGAAAGCAAAAAAGAGGGGGGAAACTAAAAAACCAAAAAGTCATA GGGGGAAAAAAAAGAGGGGGGAGATTTAAAAAATTCAAGAATTTGGTGGG GGAACAAACCCTGGAGGACACTATGATTTGTTTCATTTGAACAAGTCTTA ATTAATTGTCTTGGGATCTTGAACTTGATTCAGGTAACTCTCATCATTGT TGTTGCAAATACATCCTGTAAATGACTGATGTGGTTTTTTCTAAAAGCTT GAAAAAATTTGGGGTATTTACGGGACACTTTTACAATAATTTTTAGGAAC ATCTACTAAATTTCATGGAAAAGTAATAAATGTTGTATAAAGGTCATACT TTGACAAATAAAATATCAAAATATCAGATCTCTAGGATCAATACTTTCAG AGTAATGCTCAAACAAGTCAAAATTGTTCCGTAATTACCCCAGATGACTA TATTCCTATCCCTTTGATAAAAGATTTTTCTAGTCACATACAGTCACCTT TAAAATAACACTATCACACACTGTCGTAATCTTAGTATACTAAGACATAA AAGCATCATTATAACATATTTTAACATTCAATAATTCATGTATATAACCT TGCAGGGTAACAATGAGAAATGCCCCTAAATTTGTATAGGGATTGCAGCG TAAAGAACGAGTCTACCAGAACAAGCTACTATCTGCTCTTGATCTACCTG TTGATTGAAATATTTCTATCCCAAATATCTTAGACTGCAGTAAAATCAGG ACCTGTACAATTGATTGGAGGTAATATACTAAGACAGGTTAAAAAAATTT CCTCCAACAGAGTCTTCTTCGCTGATCAAATCATCATGCTCTTTNAAGGT TATAAAAATTTACTCCAACAGAGTCTTCTTCGCTGATCAAATCATCATGC TCTTTTAGCATTCTAAGACATCAATCTCTTTTCAGCATACTATGACATCT TATCTTAGTATACTGCAACCTAATACAAGTCAAATATTTCTTAGTATATT AAGAGGTTGCAGTACACTCTGTGGTCTTAGTATGCTACAGTTAAACTTGA CTGCATACTATGTTGAATAAAACTCCAGCATCAAAAAAATGATAAATAAA AAATTAATATACACACTTATAATTACTATACATTAATGTGTTATTGTTTT AATGCTAGAGTTTTTGATTATTCAACACAACATTCTGACTAGCAAAAGGT CTAATAAACCAGCCGAGGCTGGAAGGTCAGCCAATAGAGCTTAGCTAGAT AGCTTTAATAAGTGGGTTAACAGATGTAAGAGATGTACTGAAACAGAGTA GACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNAATTAGGGATGTGGACATTAGACCAACTTATG GTACAAATCATGACATAATATTCTCTGAATGTTCAAAGTTCAGTACAAGG TGTTGCAGAGAACTGAGGACTGAGAACTGTTTCAAAGGTTTCAGCTTTTT CATGTGCATGCACATGCGCATGCATGGGCAAACAGGGGAAGTTTTTTAGG GTATAATATCACTTACTTTCTATGATAAATTTTAAGTAAGATCCTAGGAT TTAAAAATTCTTAAAAGCGATATGAAACAAACATGGTATTTTTTTAAAAA TGATAGACTACAGTAGTAAAGGTTGCAATTTCATGTGTACTTTCCATTCA GATCAATCTTGATAAACGGGTGATTAAACATACCTTTAAAAAATTCTACG ATTTTGAAAGCCTTTATTACGTTTTAAAAAACTCAGAAATCCAGTTTTCA CTAAGAGGATTTTTCAGACTGACATCTATCACTGTCTTGAAGCTGATATA ATATCTAGCTTTGAGCTACTCTTATCACCTTTCCAATATCGTGTATATAA TTACATTCACTCTTGATAAATGGGATATATTGCATGAAATTGTTACTGCA CTTTTATATCACATAAGTTAAGCTTGTATTATGAAGATTTCCCAGACTGG CAACAATCTTAAGCTTGACATCCATATGAAAATGAAGATTTCTATCTACT CCACCTAAAATTTATATTTTCGGAAACTTTGAACCTGGCTGATTTCAAAT CATTGCATGAAACTAAGAGAGATATTGTCAATTTTTTTTGGAAATACAGT CTATTCAGAATTTTGTCAATTTTCAATGTTCAAAGCCAAATTTTGGTCTA AAAATAATGGAACCAAAAATTTGAAGAAAGAAAGCCATATGTGAAAATAT TTTTTGAAGTTATGCTGAACTTTGCCTTGATCAGGTAACAATATTACTTT CATGTAACATCATGTTGCCTTTTTTCCAACTTGATTTTGTAGGTACAAAT TCTTTTTTCCTTTATTAAAAATGAAAGAAATTAAAACTGATTAAAAATAA AAATGCCATTTTTTTAGCGGCTGGTCATTTAGGAGCAGAGGGAGGGGGTT CATACTAAATCTCAGTCGTCATGTTGTTTAGTCTGGGGAGGCACTCAAGG TAAGTGACCTACCGTTGTGCAACCAGTGCGTTTTCAGGCCTCCAAGTGCA CTGTAAGGGTCGAAATGAGTAAAGATGAGAGATGCGCTTTATAAAGGGTT AATAAATAGCCTTGGCAAAGTTTTTTGGGCAAAATTTCAGATATGATCTA ACATTTTTTGCCTAAAAAAAATGGACAAAAATTTTCCAGAAAATGCACTG TAGTAAGGGTCGTTTTTTGCCTAGATTTACTCAAATTTGGCTAAATTTTC TGTGCTGTAAGGGTCCGATTTACGGCCAAATCTTGGGTTGCACACAGTTC ACTTTTTGATGTCTATTTAAAGATGTACAAAAAATCAAGATTATATCCTA TGTTCTCAGAAAATGTACATATTTTTTCAGGTGTCGCAATTGTCTCATGT CCCACAACAAGTTATGTTGCTCAAAGACGACTTCAAAGCATACAGCAAAA TCAAGATAGATAACCATTTTTATAACAAGTAAGTTCGAATTTGTAAGTTT TTATATTCATACGAATACCTGCCCTTTTAATTATTGTAGACTTTCTGAAA CTTAAAGGTTTTATTTTTAAATAAGAGTGATATCGTTTGCTTACTCTTCA ATTTTAATTTACAAGCTTTTTGATATTGAATTGACACGGATTTTGAGCAA GATTGGTCAGAAAGAGGAAAAGAAAAACATTTTTTTGCTCATATCAGAAT AATAGGCAGACTCTGACCTGGTATGAAACATGTGCCTGATATGAAACGGG AATGCTTATGTAAAAATAAAACCTTTGAATCAAATCGCAATTTAGGAATT TGCTATAATAGCCTGTACCAGAACATTTTCAAATTTGTGACAGAATAGCT TGGCACTGTTTTAGATCAGCGTGTGGTGCTTTTTATCCAACCTTCTAGCG AATGGTCCGTGGTTTGACTCGCGTTCTTTTCTTTTGTGTTGAAATAAAAG CTCAATCGATTTAGTCGTCACAAGACCTGAATTTCCAGATCTTAAGTCAT AATTGCTTTCTCGGCGTTATTATTGTTAATGATTATGAATTTTTCTTATT CTAATTTCTTTCAAATAATTGATGTGGTTATAACTAGCTCATTAAAAAAG TGATATAGTCATTTTAAACTTATGATTCATTGAGAATGATCAAGCCTAGT TTTATGGAAACTCAGTCACAGATTCATTTTGTTAATCTAAAACTATTTTC TTCATGAATGTGTCACAAGGCTGGCCGTTCAGAGTATGCCTTCTCTTGTT TCTGACTCAATGTTTTGATAATTGAGGTTCATACTTTTGACGAAAAATGT AAAAGTATTTCCCTAACCTTTCTGCTTTCCCTTGGTCGCTTTTTTACTAA CGGAACACGTTTTTGTGTTTTCATAACGTTAACACTATCTTTTATCTCGA CTGAAATGTTTGCTTTCTAAATTCTTAGAAATGAGGTTGTTTTTTGAAAA AATATGTTTGTCAGAAAGGGATTTTCCAGTTGTACAGTTTTGTTTTTTTC CACGAGGAAAATGATAAAAAAACCTATCGAAATTGTGACAGGATTAGAAA TTGAATTTGAAAGATATGAAAAATGAGTGAAAAGTAACGAATATCAATAA TGAATTGGATATGACATATTATTTCCCACCAATAGAATCGGCCCAAAATT TGAATAGCAAGTCAATGAGATTTGCTTATTTCGAGAAGAAGTATTTAAAT TATTTATCAACATTAAGGCAAATTCTCTATATACATTTTATTTTAAGGTT CAATATCGATTTCTGTTATGATAAAGGTTTAAAGCATTTGAAGAAAAACA TCAGAATTGAAAACCCCAAAACGCTTAAGTCGACGAAACGAACTTCACAT CAATATTATTGTGATAAAGATTAAGAATCATTATTAGCAAAAGCCTTGTA CAATCTTTTATAAGAAAAAATCGATTCTTTGTGATTTGGCTGTCAAAATT AAGGTACTCTCATCCAAATCTTACTACTTGACCCAAAAATGCTTGAATTT CAGCAATTGCAGTATCAGCATTCTTCTTAAAAAATTATTTTTTAGTCTTA GTTATTCTTTTGAAGATTTTGAGCCTCACTCTTTCTTAAAAATATGAAAT TGTTCTGATAAAAAAATGTTAATTATTTTAATAAGTTTTCACAAGTAAAA ATTCCAGACAGGTTATAAAAATTGACCTGTCAAATAATGTCTATTACAAT GTCGTGTATGAAAACATAATCCTATTATTCGAAATAACATGTCTGTCATC TTATACGCCTTGCATCTGAACTCTCCCTTGTATTACTGTCTGAAAACAAG AACTATCATAAAATATTTTTTAAACATCCCTTTTCTTAGCTCCAAGCAAC TCTTTTCAAGTTTTTCCGTTTTTCGTGAAAGAAAATTGTTTCTTTGGTCC ATCACCGCCATCACCAAAGAAGCTAGGACAAATAAGATAATCTCAGTCTC AGCTTTCAGAATTTACCAAGAAAATGCTTTTTTTAGCCCCTTTGAGGCTA ATAAGTACATTTTCTGATCATTTAATTTTTTAGATTGCGGGGCTTAGCCA AAGCTTTGCTCCTATTGTCTTTTAGGACTTGCGATGGACTGTAATTTTTT GCCATGAATTAGCGTGGAGCAAAATATTGTATTGTCCATTATCGGAAATC TCTACTCTTACCCCACATTCGTAAACCTTTTTGAAATCTCAAAGAAGAAT ATACTCTTATAAAACAATTAGAGTATTAATGATTAAAATTATACTTGTTT CAATTTCCCTCTACTGTTTTTAATGTGTTTTCTTTGTAGAGAACACATGC CTGGTCACTTCAAATTCAAAGAATATATGCCGTTAGTTTTCCGGAACCTA AGGGAACGATTTGCAATCGATGAAAAGTTATATGCAGTAAGTACAACATA ATATACTCCTCATGACATCGTGATTTTAGGGCTGCTCGGTTTTCTGCTAT AGAAAATCCCAATCCTGATTTAAATATTCTTTGGAAAGGAGGTTTTTTTT TTGTTTTCAAGCACCTTTCTTACTTGCTTTCCCAAACTGAATAAAAGCCT CTTCACTTTTAAAAACTATTTTCTTGTTTAGTTAATATTGATGTTTATGA AATTTCAATATTTTCTTCCTTTTTAATAGGCTTCATTTTTAATCCAACCG CAACTCAGTAAAGCACAAGGGAATAGCGGTGCAAAATTTCTACTGACCAC CGACAAGAGATTCTATATCAAAACATTGCAGAGCGTTGAAGTGGAAATGA TGCATCATATAATGCCTAGTTACCACAGAGTAAGTTTGTTTGTTTGCAAA GATTTTGTTTGAAAATCCTCCTTCGTCGTCACAGCAGCATTTGCTTTTCC TTTCGTCAAGTGTCCCATCGTATCTCTACTAAGCCTAGATTACACTTTGA TTTGCTAAAGCTTACTTCACACTAACTGTGCAGCAAATATAGTTTTAAAA ACCCTCCGAGTACCTTCTTTTGGGCCCCACCCCATTCAGACCATCTGTAT CTTGTATTATTGAATTGATCGTTTTTAATCTCTGGGAGCTAACAAACAAC TCCCATTGGTTAAGTTGATTTTTGTAAAACAAGGCGGCATTTTTATTTTA ATCTCCACAACAATTAGTGTTCGAAAGTATTTCCACCTACCTAGACTATT CCAGACCCTCTTCTATTATGTACGCTAAATATAAACCTTCCACCGTTCAC AAACCAATGGTGAGTTTATGTATGAGTGTTTTTCTGGATTTGTTAGATCC TGACTGACTGAGGACGACGGTAAATAGGCACTTTTACAAATCGTTTCAGT CGCTCCGCCGTCCTCAAAATTGCAAATACATCAACTCGCTAATAACTGGG GAGGGGGCGATAGGAATAAGAATGGCTGGACAAGATGTTGGGTGAAGTGT TTATTAGACTAAAGTGTCTCCAGATATAATTGGCAGTGGAAACAAGAATG CCTGTAACTTTTGATAGTTTTTATTAAAAATAGCGCTTTTGATTCTCTAA AACAAGCAAAAGAATTTCCGCAATTATGTTTGACTATCAAAAGTATTCTT GTTTCCACCGCCAATTATCTGGATAGACTTTAGAGACCGTTCTTCAAGGC GTTTTAATTATTGTTTTTCATTTTTAGTATATCGTCGAATCACACTCGGA CACACTGTTACCACAATACCTTGGTATGTATCGGACGACGTTGGACAACA AAGAATATTACTACCTCGTTGTACGAAGTGTTTTCAGCTGCAAGAAGAAA GTACAAAAGAAATACGATTTGAAGGTACGAAGATACAGCTGAGTCACTGT TTTTCCTTATTATAGAGAAATTTTTGTTCTTTGCCCTTCTTTATTTAAAG ATATTAAGATTAGCCCGCTGATGGGAGAAGAATCTCTCGAAACGTATCCG AACGTAAAATCTCTTTCGTGGGGCAAACCACGGTGGACTTTCAATCTGAT TTTTTAATTACTTATCTTTTCTTCATCACAGGGCTCGCGAATCGATCGAG AAGCCAAAGACTCTGAGAAGGTTTGTAGTTAGAATATAGCTTGCTTCTTG AACTCGCCTTAATATTTTTGTGTTGGCTGGTTTGGGCTACTTGAAACATT GGGTTCACTCGGAAAACTTTTTTGCAAACCTTTTTTAACTTGGCTGAATT CTGCCTCGCAACACTTTCGTACGGTCTTGAGTTCATTTCACAGGTTTTCA ATGCTTATACGGACCAATTTTCACCCTCCGGAGTAAAGGCAAGCTTAAAC AGAAAAAGTAATTTAATCAACTTGAATTAGATTATTTTCTGAAGCTGTCT GAGGTAACAATATATTTTTAGGATAAGGAAAGTGTCACTTTCAAAGATAA TGACTTCACCAAAGAAAATGCCAGGATATTCATTGGTGCTGAACAAAAAG AAAAATTCAAAGATAGGCTAACTAAAGACGTCAACGTAAGTGTATTTACT ATGAAAGTGTATGGGCCGAGGCTGTGAGGTGTACATAATGTAAAATGACA TTTGCATAGCATTACGACCAGACTCGCTGCTATTCAATCAGCCATCCTCA GTTGATAACCCAGTAATGTAGGACTTTTAGACGATTGAGAGTATTTGTTT TCATGGGGTCCATGACCATGAACATGAACATGAACATGAACATGAACATG AACATGAACATGAACATGCGAAGAAGTGGGGTTCAGGGATTAAGGGGGTT GTGGCATTGAGACGTCTAGATCATTCCATCACCGCTCCTAAAAAACGAAT TTTATTTTGCTTCAGTTTCTGTCTGGTCTGAACATAATGGATTACAGTTT ATTGGTTGGTATTCACGACACCGAACACGTCGACTCTTCCGAACCGGAAG ACGAACAAGACGGTGAAGGACCTGACGGTGGCACTACCGGTGACGAATCT GGCGACGGCCTCGAAGAGCCGGCATCTCCTACTACTGACGGAGAAACATC TGCCGCTACCCCTGAGACGCTTGCAGCACGTCGCCAACGTTACTCGCGAA CGGAAAGTGTATCCAGTAGCGATGGTTACGAATCGGAGTACTTTGCGCTC CCGTCCTCTGACGGTTTGTATTTTCTTCAACCTAAGAAGTGTATAGGCTC AGAAAACATCACTCACTCTTTATGGTATCCTTTACTACAGTACCTGAAAA TGTTAATTTCAAATTTTTTCTTTTAAAGAATCACTTCATTCCGTATATTA CATGGGTATCATCGACGTCTTAACGTATTACGGCGCCACCAAAAAAGCGG CACACGCGGCAAAGACAGTGAAACACGGGGTATGTTTTTTTACGTGCTGT TATTTTAATTAGTGATTTTTTTTTTGGTTTGAGGGATTTTATGCACTTGA AAATCTCTGTAAAACCTTTATGTTTGTATTGCAGACGTTGGGCTTACATT ATTAAAGCTATAATTTTTAGTTTGTTAAAATTTGATTGTTTGATGCTTGG TTGTGGAAGCTCAAGTTGATTTCTTCGAAGCTGATCAAACTCGTTTTTTA GATGTCCGAAAAGGAAAATTTCTAACAAAAATAATGACAAATTCGCCTAG GGTGAGTCATTAGGATTAGAAGTTAAGGATCGGCTTATTTCAAAGTAAAA GTCGTTACCTTTCCAACTGTTTCGCTTTACTGTTGGAAACCGCTAACGTT TTGTATAGATTTGAAAATCGATATTTGAGGTTTTAAAGTAACAAGATGTT TGAATAATTCATTATGCGAGATGAGAGAATTTCAAAAGATTCTTTTCATG CATTCTTGTTGTGGGTGTTACTAAGGAAAATATTATGCAAGGTTCACTTT CAAAACGTATTCAATTTCAAAAGAGGGTGGTAACGAATTATTTTCTCAAA GAATTTTCGTTAGGTCATCATTAAAGTAAAATGGTAAAATAATTGTGAAA GTGGGCTGGTTTCTATTTGTTAATTTTATTCGTTTATCTGTTGGGTAAAT GAACATTCAACTTGTTGTACATCAATTTTCGATATTGCATAGTTTCTAGA GGGGTCAAGACCCCCCCCCTTATGTAAGAGGACCCCCCTTAAGTGCAAAC CCCCCCCCCCCTATTAAGAGGATCCCCCCTTAAGTGCTACCCCCCCCCCC CTTAGGAAATCCATTTAAAATTAGAAACATGTAAATGATTTTTAAAGTTA CGTTTAAATTTTTAGTATGAAATAATTTTCCTGTTAAATCGAGAAATATA AAAGAGTTGATACTAATATTAGACGAATATGCTAAATTTTATACACTTTA AAATAAAATATAATCGACGTAATTTTGTTCAATCATTCCAGCTTAATTAT AAACGCTCGGGCTAAACCAATCTTATTTAAATTTTCTCACGAATAAATGA ATTAAATATTTTTTTAATCTCACTAATCATTTTGATTAATAGGTGTTAAA CATAAAACGGCGTTCGACAAGCGAACCCAATATGCCCAACATGAAACTCA GCATGGAGTTTAATAAG
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000350XLOC_000350Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000596-exon-sc0000002-1575043694:1335663..1335950TCONS_00000596-exon-sc0000002-1575043694:1335663..1335950Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1328923..1329020TCONS_00000596-exon-sc0000002-1575043694:1328923..1329020Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1326515..1326611TCONS_00000596-exon-sc0000002-1575043694:1326515..1326611Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1326122..1326271TCONS_00000596-exon-sc0000002-1575043694:1326122..1326271Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1325127..1325273TCONS_00000596-exon-sc0000002-1575043694:1325127..1325273Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1324881..1324919TCONS_00000596-exon-sc0000002-1575043694:1324881..1324919Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1324466..1324579TCONS_00000596-exon-sc0000002-1575043694:1324466..1324579Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1323838..1324135TCONS_00000596-exon-sc0000002-1575043694:1323838..1324135Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1323622..1323722TCONS_00000596-exon-sc0000002-1575043694:1323622..1323722Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1575043694:1322434..1322508TCONS_00000596-exon-sc0000002-1575043694:1322434..1322508Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1335663..1335950TCONS_00000596-exon-sc0000002-1510915933:1335663..1335950Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1328923..1329020TCONS_00000596-exon-sc0000002-1510915933:1328923..1329020Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1326515..1326611TCONS_00000596-exon-sc0000002-1510915933:1326515..1326611Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1326122..1326271TCONS_00000596-exon-sc0000002-1510915933:1326122..1326271Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1325127..1325273TCONS_00000596-exon-sc0000002-1510915933:1325127..1325273Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1324881..1324919TCONS_00000596-exon-sc0000002-1510915933:1324881..1324919Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1324466..1324579TCONS_00000596-exon-sc0000002-1510915933:1324466..1324579Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1323838..1324135TCONS_00000596-exon-sc0000002-1510915933:1323838..1324135Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1323622..1323722TCONS_00000596-exon-sc0000002-1510915933:1323622..1323722Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1510915933:1322434..1322508TCONS_00000596-exon-sc0000002-1510915933:1322434..1322508Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1335663..1335950TCONS_00000596-exon-sc0000002-1491911889:1335663..1335950Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1328923..1329020TCONS_00000596-exon-sc0000002-1491911889:1328923..1329020Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1326515..1326611TCONS_00000596-exon-sc0000002-1491911889:1326515..1326611Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1326122..1326271TCONS_00000596-exon-sc0000002-1491911889:1326122..1326271Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1325127..1325273TCONS_00000596-exon-sc0000002-1491911889:1325127..1325273Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1324881..1324919TCONS_00000596-exon-sc0000002-1491911889:1324881..1324919Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1324466..1324579TCONS_00000596-exon-sc0000002-1491911889:1324466..1324579Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1323838..1324135TCONS_00000596-exon-sc0000002-1491911889:1323838..1324135Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1323622..1323722TCONS_00000596-exon-sc0000002-1491911889:1323622..1323722Clytia hemisphaericaexon
TCONS_00000596-exon-sc0000002-1491911889:1322434..1322508TCONS_00000596-exon-sc0000002-1491911889:1322434..1322508Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000002supercontigsc0000002:1322434..1335950 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
12.2103 10.9927 6.45478 8.52843 59.8535 48.4799 55.6467 61.895 39.0604 47.1875 30.4573 27.9539 31.7896 31.8678 32.1209 33.8096 31.1208 29.9412 25.4604 37.6368 18.1638 18.0852 26.7493 29.826 31.913 35.3972 20.8367 13.6151 32.6985 33.8129
Blast
BLAST of TCONS_00000596 vs. Swiss-Prot (Human)
Match: PI42B (Phosphatidylinositol 5-phosphate 4-kinase type-2 beta OS=Homo sapiens GN=PIP4K2B PE=1 SV=1)

HSP 1 Score: 302.368 bits (773), Expect = 3.808e-97
Identity = 143/254 (56.30%), Postives = 186/254 (73.23%), Query Frame = 1
Query:  235 FRVHDPKMAVLMWGVTHSVSQLSHVPQQVMLLKDDFKAYSKIKIDNHFYNKEHMPGHFKFKEYMPLVFRNLRERFAIDEKLYAASFL-IQPQLSKAQGNSGAKFLLTTDKRFYIKTLQSVEVEMMHHIMPSYHRYIVESHSDTLLPQYLGMYRTTLDNKEYYYLVVRSVFSCKKKVQKKYDLKGSRIDREAKDSEKDKESVTFKDNDFTKENARIFIGAEQKEKFKDRLTKDVNFLSGLNIMDYSLLVGIHDTE 993
            FR  +P ++VLMWGV H++++LS+VP  VML+ DDFKAYSKIK+DNH +NKE++P  FKFKEY P+VFRNLRERF ID++ Y  S     P  S +QG  G +FL T D+RF IKT+ S +V  MH+I+  YH++IVE H +TLLPQ+LGMYR T+D  E Y +V R+VFS +  V +KYDLKGS + REA D EK K+  TFKDNDF  E  ++ +G E K+ F ++L +DV FL+ L IMDYSLLVGIHD +
Sbjct:   36 FRASEPILSVLMWGVNHTINELSNVPVPVMLMPDDFKAYSKIKVDNHLFNKENLPSRFKFKEYCPMVFRNLRERFGIDDQDYQNSVTRSAPINSDSQGRCGTRFLTTYDRRFVIKTVSSEDVAEMHNILKKYHQFIVECHGNTLLPQFLGMYRLTVDGVETYMVVTRNVFSHRLTVHRKYDLKGSTVAREASDKEKAKDLPTFKDNDFLNEGQKLHVGEESKKNFLEKLKRDVEFLAQLKIMDYSLLVGIHDVD 289          
The following BLAST results are available for this feature:
BLAST of TCONS_00000596 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
PI42B3.808e-9756.30Phosphatidylinositol 5-phosphate 4-kinase type-2 b... [more]
back to top