Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000445 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000445
Unique NameTCONS_00000445
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1357

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000445 ID=TCONS_00000445|Name=TCONS_00000445|organism=Clytia hemisphaerica|type=transcript|length=1357bp
ttttgataacaGACTTTGTTGGATTTTTGAGTTATATTATCTTTATTGCA
TGTAAGATTAAACAAAACATTGAAATCAAGCTTTAAGAAAAAATGTTGTA
GATGAAAGCGTGGTTGTAAAGAAGGCAGAGAATGTCTAACAATGACAAGA
ATCACACAACCAACCCTCATGATATTGTGATAAGCAAGaaTAATGAGGGA
GGTCTTGAATCACCGTCCGATAAACATGCCCGAATATATTCTTCCGATCA
TTTGAATGAAGTTGTACCACATCAAACAgatgaaataattcttgaaagaG
AGAAGAGCAATACACGACGCCATGTGCACAGAGCTCAATCATTCGACAAG
GAGAATGCACAGAAGGCTTTATTTACACCAGTCTTCATGAAGCAGTGTAT
TGTAATGAGCCTTTGGTTTTTCACCAGCTTTGCCAGTATCGTTTTAAATA
AGTATTTACTATCAACTCTGGATGTCGATGCAAGTCTTTTAGGTGCATGT
CAGATAGTGATGACGACTTTCTTTGGTAGCATTGTAATGTACGTGCCTTA
CATTTGCAACTTGACCAGTAGGAAGAGACATAAAAAGATGGAGAATTTCA
ATCGCTTTCAGTTTTATAAGACCATGTCTATCCTTGGTTGGTTAAGATGT
GGTGCTGTAATATGTTCAGTAATTGGTTTGAAATATGTGGCAGTCTCATT
CTCCGAAACCATCAAATCGTCTGCACCTTTGTTCACTGCTCTATTCGCAT
ATTTCCTTCTAAAGGAGTATTCTGGCATTTATGTCAATTTGTCACTGATG
CCGATCATGTTTGGTCTAGCCATCTCAACGTATACAGAGCTGAGTTTCAA
TATGACTGGCTTCTTAGCTGCTTGTACAAATAATATTTTAGATTGCATTC
AAAATGTGTTTTCCAAGAAGCTGCTATGTGGTGACGATATGAAATTCtca
CCATTAGAGTTACAATTTTACACAAGTGTTGCAGCAACAGTTGTCCAAGT
ACCTTTATGGTTTTTCTTCAttGATTTGACGACAAAGTGGGAGACTACAG
ATTCATACGTAGCATCCATGTTGTTATTCAACGGTGTCGTTTTTTACTTA
CAAAGCCTCTTCGCATATTCATTGATGTCTCTCATCTCTCCTGTCACTTT
TAGTGTATCTAATACAGTTAAACGTGCTGGTTTAATTTGGTTTTCAATCC
TGGTGTTTGGTAACAAAGTCACTCTTTTGAATCTGTTTGGTACAGTGTTG
GTTGTAGCTGGTGTGTTTTTGTATCAACGAGCTCGTATGATGGAACAACA
CAAAAGGGACCAAATGATTGTTGAAGAAAAATTAAACCatggaaataaag
aaaaagg
Run BLAST on NCBI

transcript from alignment at sc0000002:757087..780347+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000445 ID=TCONS_00000445|Name=TCONS_00000445|organism=Clytia hemisphaerica|type=transcript|length=23261bp|location=Sequence derived from alignment at sc0000002:757087..780347+ (Clytia hemisphaerica)
ttttgataacaGACTTTGTTGGATTTTTGAGTTATATTATCTTTATTGCA TGTAAGATTAAACAAAACATTGAAATCAAGCTTTAAGAAAAAATGTTGTA GATGAAAGCGTGGTTGTAAAGAAGGCAGAGAATGTCTAACAATGACAAGA ATCACACAACCAACCCTCATGATATTGTGATAAGCAAGGTATTTATATTT CTTCCTGTATCATTTCGGTTTTGCTAAAAACAGGATTAGCTAATCTGCTC AAGTGCAAATGTATTTTTCTCTAAGCGAAAAAGTTACATGCAATTAGAAT TGTATTTTAGaagtcttatttttttcatcattttcttcttcagaaTAATG AGGGAGGTCTTGAATCACCGTCCGATAAACATGCCCGAATATATTCTTCC GATCATTTGAATGAAGTTGTACCACATCAAACAgatgaaataattcttga aagaGAGAAGAGTAAGAAAATCATTTATATATTGATAAATCTTCTTGACC CGTAAGAAGAATAACTGTTGAGCTCATTTTTTGGTATTAAAACTAATCTC TTAACCCCACCACAACCCACATACATGTGATAAAATATTTGTCCAGCTAT ATTTTTTCAGGAGATTTTGGTgacagagcagcatatgcatttcgtccttt aGGACTCAACATACTGCATACAGCATACTGCatgtatatgtatatttttg tTGTGCTAGTTTTACCTTACAATACTGAAAAAAGTTGGAACTATTTACAT TTTGTCAGTGTCATTTTTATTCCTCCTAGGCAATACACGACGCCATGTGC ACAGAGCTCAATCATTCGACAAGGAGAATGCACAGAAGGCTTTATTTACA CCAGTCTTCATGAAGCAGTGTATTGTAATGAGCCTTTGGTTTTTCACCAG CTTTGCCAGTATCGTTTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNcgccatttactcgttacttgcacgataatatcgtggaa actttttgattttggaatctacatatactaattcgagagtttccatcgaa aaaagtggaatctaagatgtgtatcacgaaaatcattttctagccacttt tttcgacctcagccgcgcaaCTATAAGAAGAATAACTGTTGAGCTCATTT TTGGTACTAAAACTAATCTCTTAACCCCACCACAACCCACATACATGTGA TAAAATATTTGTACAGCTATAttttttcaggagatttgggtgacagagca gcatatgcatttcgtctttattaggactcgtcaacACTGCATACTGtatg tatatgtatatttttgtTGTGCTGAAAAAAGTTGGAACtatttgtatttt attgtaCGTATTCCTCCTAGGTAATACACGACGTCATGTGCACAGAGCTC AATCATTCGACAAGGAGAATGCACAGAAGGCTTTATTTACACCAGTCTTC ATGAAGCAGTGTATTGTAATGAGCCTTTGGTTTTTCACCAGCTTTGCCAG TATCGTTTTAAATAAGTATTTACTATCAACTCTGGATGTCGATGCAAGTC TTTTAGGTACATTGAACAATGTCTTTTCCTCGTCAAATAAAATAACCCTa ttgttttagtgtttttttggTGACCTCCTATGACATTATTAATTTCACTG ATTGAAATTAAGTTTAAGGCTCCCTAAGGCTAATGTGTGCCTAATCTTAG CCTTTAATCATTTTATAATTAGCCCTTTATGCGTTTGATATGATATAAAG GTAAATTAACAATTATAAGTAAATAAAGATACACATAGATACACTTTTTC TCCCGTAAAATTTCAAAGTCTCaggcaatgttttgttcttcaACTTTTAG GTGCATGTCAGATAGTGATGACGACTTTCTTTGGTAGCATTGTAATGTAC GTGCCTTACATTTGCAACTTGACCAGTAGGAAGAGACATAAAAAGATGGA GAATTTCAATCGCTTTCAGTTTTATAAGACCATGTCTATCCTTGGTTGGT TAAGgtaactttttgattttcttttgaaaNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtcact aaacttcagcccccccaatatgaaaatgcttcctacggcactgctattgt tttagtgtttttttggTGACCTTTTATGACATTATTGATTTCACTGCTTG AAGTTATATTTTAGGTTCCCTAAGGGTCATCTGTGCCTAATCTTAGCCTT TAATCATTTTATCATTAGCCATTCATGCTTTGGATACGATATAAAGGTAA ATTAACAATTATAAGTAAATAGAAATACACATGGTTGATTCTACTTTTTC TCCCGTAAAAAGTCTCaggcaatgttttgttcttcaACTTTCAGGTGCAT GTCAGATAGTGATGACGACTTTCTTTGGTAGTATTGTAATGTACGTGCCT TACATTTGCAACTTGACCAGTAGGAAGAGACATAAAAAGATGGAGAATTT CAATCGCTTTCAGTTTTATAAGACCATGTCTATCCTTGGTTGGTTAAGgt aactttttgattttcttttgaaaccCCAGCTGTTACAAAACGTTTAAAAT ACGTTCAAAATGTTAGCTGGATCATGAAAAAGTTTTTGTGCACTGGGTTA TAAAGCAGTGTTGTACGCCAGCTAGATCATGAAAAGGTATTTGTGCACTG GGTTATAAAGCAGTGTTGTGCGGCAGCTTTATCATCTTTTGACCGTTTTG CAGAGCATTGTAATTTGATAATGTGGTTTTTATAGGCTGTTTCATGTTTT CTTGGTGTGCATCCCAAAATAGGACTTGTTTAGATGGGTGACTTTCGGTA TTCCTCTGCTCCATAGTATGTTATATAAAGGCAAATTGGAAATTTACAAA ATCGTTTCGAGAATATTGGAAGAGAATCAATAAAGATCTGAATTATAAAA GTACATTTTCAGTAACATTATTAAAGCTTGGTACTAATGGCGATAAACGC ACTTAGGCGAAATTCTTTACATAAGTAACTAAATAACCATAACATCAATA TACAACTTATAAAAGGAGTAATAGAATAAGTCATAACACTTTCAATGAGG TCAGATAAATTGAACGTATCCAAAACAAATAAATTGCAATTGAGGAAGTT TCACAACTCCGGAGCCTATATGTGAAATTCTTCTCTGTAGTCTACACAAA AATTGCTCTTCATTATGCTGTAACTATttataaaaaacctttttctaaaa ataaatattttgtgaCACTTTATAGTTGAATTGTAGGTCTTAATTAAGCA TAGTCATAAGATAAGTGATCAATATATGATTTGGTTTTGGTGTATTTTCT TTGATTGCATAGTTTGTCGATTTTGGATTACATTCTCTTTAATAAGGGAC GCCTCTGTTTGTTTTTATATAGAATGATGTGGTTGCTTTCAAATTCTTAA GAATTTTTATAGGTCTACACTTTAGAAATCCCGAATTTTAAAACTAAGAC ATCAAAGGATTTTGATTTAGGAACCTAGTTAGgcaaaattagatttttgt cGCTAAAACCATgattctctttctttctttttcctaaatttaaaCGAAAG TTGGAAATATAGTTTAGAAAAATGCCATTCCTAGTCTCGGAATATTCAAA CTCACGTAGCACGTTTCTAATTCTTTCGTAAATTCAGTATGACATGAAGC TAGTTCGTCATACCTTTTCTTGCGCAATTTTATGTCAACATTCATGCACC GCGTGACTAAAACAAACTTGATTGCTCAAGATCATTTACAAaggaaaacg ttttttttatccACAGCCAAATAatcaacactttttttatagttttgtaG TCATATCCAAAAGGGTTAAAAGGGTTAAAAACTTCTAGCAACTAGCTAAC AAAGTGTACCGCACGACAACCACTCAAACCAGCACATGGCCAACATTTCT CTACTGTGTAAAGTCCTGAAATGCAATAAAATTATATAATCTTTTAAGGT CATGACTGAGGCTACACGTAGAAGCATTGTTGTGGTTGATCCTGAACACA CATTTCAAAACAACACTAACAAAGCTTTAGGATTgcgtagaaaaatattt ttattcggCTTTAAATACAATTTCGTTAATGAAGCGATTTTTTCATTAAG AAGAGTTTTTTAATGCGAAAGTTTGTGGTTTTTCATTGAAACACTACAAc cattaaaacttaaaaaacgaaagaaaatttattttacttCCGCAGAAAAA CGTTCCGTTAGAAAAACCGATAATAATATATCATGATGGAATGAACACTG AAAACGACAAGGATTGTCTAACCATGATTATCAGAAAATTcgtttaacat tttttgaaagccTGTTCTTAAACCTGCATTCTTAAACTATGTAAAGCTCT TTGGCATCATTCGTAGTGCaataaaaaataagatttaAAGAAGTCAGTCA AGGCGTCAAGGTCTATTTATACTCCTTCtaaactggagtcgtttataatg cgtgtaatacaatagtataggcgttatatgattattgttacgggatttag tttgtataaactaaaactatagactaaaattgttccctccattacttttt gctttatttctatcACCAGTCTTAATTAGTCGTCTGGCTTGCTAGACTAT ATACTCcttctaaatttgaaaagttgatttatcattttcatcttGATTGG TGTAGAAAAGATTCACTTCTCTTTTCCGAATATGGTTATCAAGTTATTTC CATTAATCTTATAATACGGCCAATCGATTGCACAATACCAAACAGTAAAA TCACAACCTACACCCTGTACTTGAACCAACTCGTTGATATGTTTCCTAAT GAAATCTTAGAGGAAAAGCATCCTCAGTGTTGGCAAGCCAAGGTAAAGAA ACACGAAATGTTGCCAAATGCTGTTTAAAGCATTTCCATACTTGAATTAT TaaaatcactttatttttacttttgaatATTCCTTTATATTCTTTTGTAA CGAACCGTAGGTAGAGGTTATGGAGGCGTAAACAGTCTTGCTTACCCACG ATCCATTTTGACTGTGAAATGGTCTATACGAAACGTACTTGACAATTCTC TACTAATGCTCGCTGTAATTAAAGAGATGGATCAAGGGAGAAATTCAAGG ACAGAGAGTGAAGCCCTCCCTtgctaccttcgggtagataacTATCTATA AGAAGATACAAAACTAACACAAAATGTGACACCTACAATCCAAAGATTCC CCATGTTTTTCGGCAAAGTAAGAGTTGTAAGTATCCCCTCTGCTTCCCAA CCAAAAAAACTGGGACTGAAGATTTATAGTTGATGGTTACCTAAACTTTT TCACGTCGTTTCCGAGATAAAGAGACTCAATCGCTTGTGGACACAAAGGC TGTTAGACCTGCTTTACACCACAGCAATCACAGCATTTCCAATCACAAAA GCAAAGTGTGAATCTCAAGACTTCATCTTGCTTCATCATTGCTTTTTGAT GCTCCTTTcattcaaactttgaaaatttcatttatttccTTAAACGACTT TCTGAGATGCGTGCGTGAACATGAATCGAAAACCAATCGAACTTTTCTCT ATTGAATGTAACGTAAAAGTTTTTCGTTTCGTTTCATGGCATGCATTCTT GTATTAAAtgcatatttttatgaaatacacgctttttttttataagaata cactttataagaatgtccatgatgaaaatggccaaaaaattaagaatatc ctaagaatatcaccatcatggaNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaatgctgtaaga atattttaggatgattttcccaaaaaagttaagaatatccatgatgaaat ggatttacaccattcttataaaaaaaaaagcgtgtaacgaACACTCATCG ACCAATTAATAACTATGATTAAGACTGATATAGTTTTTTTGACATGTGAT TTTCCCTCCCTTTTTTTTGAGAAGGAAGCATGAAGCTCGTTTATCCTACC CCTCctattatttcttctttttgagtCGTTACATTTTAAGTTTAATTAGT tagattttgtaattatttttagaCTGTATATTCTAAGACTGTAAACCAAT TTGGGTATGGACTTAATTCCGTTCCTTTGCTTTGTGGTCTtcatttttga tcaattttgtcaatttataATGTTTTTACTCTTCTGTTTTAACGAAAAGA CTCATCTAATATCTGATTGCATATGTTATTAATAGGGCAAATATCTCAAC TGATAAAAAGTATGCGACAAACTCGCGAAATAAAACCTTTTGGCCTCGAA ACGAcacaaattagtattttgaatttaaaattgagCCTTGGCTTCACTTT AGCTTAGTGAtatcatttcaaatatttaaccATTGAGAAAGCAAGTAGAC AGTGTTAGAATTTATCAGGAGAGATAATTGAATTGTCATACTCACAAAAA TACTGACATTTAAACCGTTCAAGGACCGACGTTCGGCCCTGGTAACCTTG TGGCGCAAGGGTTGGATTAGGTGCACAATACTAACCAACTTGGTTTAGTA TGCAGACGGCTAATTCAGACACtgcaaaaaattatcaaaagaaaagacAA ATTTATAGTTTATAAAAACTGATATTACCCTATAACGGTTATCGTATCAT CATATGTGTGTTatatattatcatataacacccatatCACTGTACTACAC GGAATCTAGACGATTACGGTCTATATAACCAACAGTAAAAGATAAAAGTT ATGCAATACTGAACCATTCAACAAGAGTATAACCAACCAAAAACTAATAT GTTGACGTTTGCTGACCATAACCtccttttttttccttttcattcgAAAC AACCCTTTCATTTCCTTCTCTAGAAAAAAACATTCCATGAAAATGAATCA AAAGTAAGCCTTTCCTTCCTTAATCACTCATTGTATGGCAGGATTGCCCA TTCCTTTTCTTCCTTCCAATACAGACATCTCTATTACCCGAGAATCAATT ATCAGTATCAAAAATGTTTGATACAATATCCatataaagaaaatttcaaa agggCAACGCATCGTAtgtttagcttcaaaataattttgtaaGGACTTTC TTCACATAGTATTGTATATTCTCGGTAAAAAAAAGCACTTTTACTTCTTA TTTACTACTTCTAGAAGCTCACATTTGAATATGAAATATCTTCTTCTAAT GGAATTCGCATTGATTGTTTTCAACAAACGGGGGATATTATTGGCACTTA CTCGGCTGATTTAAAGACCCAAATTGTCTTGGCCCAATTAAGCTAGGCAA ACAATGCAATTAAAATTCCTATCCATCTTTTTAAGTAATTTTATTGCTGA CAATTTTGCTTTATAGTTGTCCTATCTgggaaaaatgttttgtttctgAG ACCGAAAATTGAATACTGTGCCAAGATTTCTTTTGTGAAGATATACTTAT TTTAAATGAGTttgtttacacgttttttttttataagaacgtcaaaaatt ttcgaagccttcggatgttcttagttttttggatttgaagcctaaaaatg ttcttaaaatgttcttattttcagcattttttgagcattttgatgtaatt tcttaagaaattgcatgttttaaagtctccaaagccttagtatgttctta gaatgttcttaaatttttgggccttgaagccttatgttcttattatagtt tgttcttataaaaaaaaacgtgtagtgcaAAGGCCAACTTGAAATGACCA ATTTGACTGGCAATTTAAACTCAAACCAATGGTCTGATTCCCTTTGTAAC ATTTTTGTACCTTCTAATCCTCCAAATTTTTTGGTAGAGCTAACTAGCTA ACTTGTCTCTATTAACAGTTGTTTTATGACCTCAGTTGAATGCTAGCAAA GCTAAGTTAATAATAATCTATAAGAACCATGTGGAAATTTCTTGTTTCAA GTGGGGTCCATCTgtggaaatttcaagataaaaaaagtatttAGAGCCAA TAACTATCAACCATTCACTTCAGTTTCAATAAATGAAAATGGTAAATCGA TTGTTGAGATAACAATCTAAATTGTCTTCATTAAAATATTGAATCCGAAA ATTTGATTCGCCTGCGTTGGCAAATAAATTCCCTGTAACACCCACGCTAA AATCATTCGAGGTGGCATTTGACCACTTATATCCggtgtgacgtcatttt gaagTGAATTAGCGCCACTTAAGAATTCTCATTTGTAGTTTAGAAATACC ATTtaaaccctttaactgccgatgtcagcatatgccgacatgggtaCTTT CGATTTATTTGCCaatgtcgggatttgccgacatgggcactttGCATCCC TTTGCCGCAAAATTTAacacttctacaaagattttgtattagatggtttg aaatgaaaaaagataatagttaaaagcttttctatgttgaaaaataacta ttcagCAATCTTCAACTCACaattatagtccttggctgatacttcatata ttattcagaaaatgaagtcaaaatcgcTACCTTTTTCCCATGTCGGTTTa tgccgacatctggcaaataggtcgaaccttctttttttcccgcggcaaat aggtcgaaccttaaaaaatacgaacggCAGTTAAATGGTTAaagcaacga tgtaaaaataatagataaccaacttgccttgattctcaaaaaacatccgt gctacgtttgtaaaaatattaatgacattttgcatcgtaaaaagtgcaat taaataaaaacttgcttcatttggaaaccttctattggacagaatcgatc acgtgatgtacatttttccaaaatttgggttagaaaaagtgtattttcct ataggcagcctcacagaaggaattttttaattagatattactgttctaca gggtgtccctaattaaagtatcgagtttgaacatgcgattgagtagaaaa gtttgtgtgtgttatcgctaaaatataagaacgttctccatcacacNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNagagggagagcttaaaata caattttgtgaacacgcacataaaactttctactcatagttgtgtttcga ctcgatactttaattagggacaccctgtataaacattcatctgtttattt tgtatcatgcaaccttcatgcacttttcatacgtgagatatcgcatttca agTCACACATATATTTTTCAGATAACAGCATTTTATGAGCGTTTATTTAT CCAGATGAagattaagtggtatcaggccgatccgtagtcaatttgtctaa agattggtacctttatcttttgaaaaaaattccaaaatttgcagtaaata ccaatttaaatttttatcaattcagtggatatcaaaaagtgtgtcaaaat ctagctaaaaggATAACACGCACTGCACACAGAGCTTTTTAatagagtgc tcatttcaataggaaaacaatggttgttctcttgggagaagtgccttcta gaggtagttggttatctattatttttacatcgttggttaAAGTCTATTGA GAAGATTTGTAACAGGGCCATGGAAGGAGATTTTGATGTTAATTATAAAA TAGTCTGGTGTAATTTCAGGCGTAAGAAATTAATTTCTGATAAATTCTGT TGCCATGATACCTACAAAGGTTTTACTGAATGGTTCTAAACAGAAATGGA ATAACGCTTCATAAGTATTAATGAAATACAGCAGAGTCTCTTTaaatcga acctctataactcaaatgtctccttaactcaaacagtTAACAATGCCAAA TAAACCATACTCCTTAtctcgaattttttcaaaacttgaacaAATGTGTG TCCCCCTACGTTTATTCTTATAGGAATGAGATCTTTTAGTAATGCCAgtt ttttggctaaaaaaatTGCCAGGCCTTATTCACGGACCCTCTATTAAAAT CCTATCTACCTTCGAACCAATCACATGTGGTTGCGTCTCACGAAAGATGC TACGGATCCAAAGGGATGGACAGGTCCTGTCAATATACTTCAATTGGACC GataaatatctttgaaaatgCGGCGTTAACGTAATAAAAACATAAAGAAC TCATTAAATTCTTCAGTCGAAACCTGCTTGAACCAATTATAAAGCGAACA CAGAGGGGCAAAGATGATCGATAATTACATGTAAAGAATTTTAATGACCG GAACCTTAAATAGCACGTAATATTCTACTCACTATGTGCAAACAATTTCT TCTCAAAAAAACATCTGGAAATCAATTCGTGCAGTTTGACCTTTCTTTGA ATGAACCATATCCAAGGAGAAAAAAACAGGAATGCTTTAATGACAAACAT CACTGTTTGAGCGGAAAATTAATCCATGTTAATGCATTTAATACactttt ctcgagatgcataaattttttgttgtcctcgttttcaaacagatttcatt gctatgaaattatacatttaaaccaatttaaattcccaaaaggcaaacat taactctaaaacaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNcaacacaattatcattgtgaatatgtaa ttttatagtaatgaaatctgtttgaaaacgaggacaacaataaatttatg catctcgagaagagtgtattagcCGTGGAACTTGCCTATAAACATTCTAT ATTTTTTCTTACATTCTGCCAACCATTAACAAAATCGGTCTGAAATAGAG CCATTTTAAGGCATATTAAAGAGGGGATCGAATTTTTTTCCGTCGGTGCC TCTTTAGTCACCATATTTATGGCCCTTCTACTTTCCAGATCCATCATAGT CCCTGTCACAGCAATATTTCTGTGTTTTTATTCATGTATAAAGTATATTC AGATGTTAGCTTTGTGAATGTTTTTTCAACTAACGAATATGGACATGCAA TCTGTGTATTTTTTCCTGCGAGAAATATACGTTGATTACTGTTATTTCAA TGTACacaaggaaaatttttaaacggaaaatttcattgatttataaATTG ACCCACATCGAGtaatgctaccattagggtagcacttttcaaaaaattat gatCAGAAATGGCGATTACAGCTTgcctaatagaccttttcataaattac gtcacgaacatcacttgcctcgttttgaaattattgctatggtgattaac tcccagcggattttaatAAAACTACTTTCTATTTATaaaaaaatcattta atgtctcaagggacataatcaccatggtaattgtttgaatacgaggcaag tgatgttcgtgacgtaatttatgaaaaggtctattgtctcTTTCTAATCT TCTTCCATAGATGTGGTGCTGTAATATGTTCAGTAATTGGTTTGAAATAT GTGGCAGTCTCATTCTCCGAAACCATCAAATCGTCTGCACCTTTGTTCAC TGCTCTATTCGCATATTTCCTTCTAAGTAAGTGATTCAACATATTTCTAC ATTCGTTTCTTANacagatttcattgctatgaaattatacatttaaacca atttaaattcccaaaaggcaaacattaactctaaaacaaaagtacttgaa attcactGTCACNCCGTCtcatcgagacaaaaataccattagatgctaga aatttccaacatgtttcggTCAGGGCCGTTTTCAAGGTGTACTCGTTTCT TAAGTAAATATATTCATCCGGTGGCTGTCGGAAATTCTAAAGTGAGGGTC CACGCTTACTATATATCAGCTCCGAGTTACTtacctagatcagattacct aATCTTAGCTACTCTATTCCGTtggagttggcggtgaccggtgAGCGAAC CAGAAACCCTTTAGATTGCGAGGTAAATGCCTTGCCGATtgaattgttgt tgttttttttgcaaaacccTACCTTTCTTAATTTTGCGTCTTAGAAGAAT CTTGGAATATCCCCANGTTTTCAAGGTGTACTCGTTTCTTAAGTAaatat attcatctggtggctgtcggaaATTCTAAAGTGAGGGTCCACGCTTACTA TAtatcagctcccagtaacttaccacctagatcagattacctaATCTTAG CTACTCCATTCCGTTGAGTTGGTGGTGACCGGTGAGCGAACCAGAAACCC TTTAGATTGCGAGGTAAATGCTTTACCGActaaattgttatttttttcgc AAAACCCTACCTTTCCTAAGTTTGCGTCTTATAAGAACTTTTCGGCTACT ATTTACAAAGTATCCCCCGAGAAAGCATTCGAAGctgaaaagatttaaaa aaattaacgcTGATAGTCTTCAAAgatctatttttcttttactttataTC AGAGGAGTATTCTGGCATTTATGTCAATTTGTCACTGATGCCGATCATGT TTGGTCTAGCCATCTCAACGTATACAGAGCTGAGTTTCAATATGACTGGC TTCTTAGCTGCTTGTACAAATAATATTTTAGATTGGTAAGTCGTTCACAT TAACATTTACGACTATTTTATGTTCAACTACTCTTCTATTATCATACTGA AATTACATTGAGCTTTAACAAGTATTTTCAGCAACGAAGATTTCAAAATC TAAAGCAATTTCGTTACTACATttaagtctccataactcgaaccttgATA AACTGGAATGTTTCCTTAGCTCagagttttcaatttttcaagttatcttT TCCATTCAGGTCACAAACCCTTATAAGTGAAAGACTGTATAACTCGAATT TTTATAACTCGGAAAAACTTTAAGTTCCGCGTGCTCGAATCAATGCAATC TTATCATTTTTATAACTTTTCCGAAATCCAAAAAAAGGAAATGGGTCTCT ATTGAACTACTATAATCAAAGACCTATATCTAGCTTTTTTTGACGCCGCC GGAAAATCGGTAAAAACCACTGTTTGCCATAACATAAAGGTGGTCTGCCC TTAAACAAATTATTTCCTCATCGCTACCAATATGTCTACGTAACGATGTg gaagatgacgtcatttttcaatgCAATGTCACCGCCTTCCGCGTGGAATA AAGTTTTAAGTGTTAACACCAAGACGGAATTGCGACACTTTTTCTTTGTG ATGTCGTAGTCCagatagcctatactagacgtcacggctttttttctacg ctacatttcccggtttttggtgaggtactcGCTATAGTCCAGACAGTTAA TTGAGGTGATTTGAAAGTTGCGATCGCAGGCCTGTTTCTTAGAACTTTTT ACGGAACACAACAAAAGTTTGGCTaaacgattttttttattgtcagCAAT CGAGTACCTACAGAAAACCTTTTAAAGCATTCAGCCATGCCAAGAACTTC TTAGTCTGATTCCCAGACCTCTGAAGACgtacttcctataagaaactttt caaTTTAAGGATGAGCAGAAACCTTAGTCTTTGGATCCGTCAAAAATctt gctttttgaaaatatttcaaatacagTCAGCAATAATTTTTAACACTCGC TTCTGAATAATTTTAAACTTACTTGATTCTTGACATTCTtactgaaaaac ttttttaagagGTTAACATAATTATGTAACGATGCCAAGAAGTCGGCCAT GTTGTTTGGCAACGTACAATAAACAAAACAGCTAATTAATGAGAGAATGC CAAACAATACCACGTAAAATGACTATTCAACTTCATCCCACTCAAAAATT CTCGTGTTGTTTTCCTTATTTGTGTCCACAGAAAATTTTCTTAGAAAGTC ATCAAGGCTTTCCTTAAGAAAATTAATTTCCTTTGAGAGTAATTATTGAT TGCTGACTGAGcaaattttaaactttcttcATGCAACCACttgactagag tctacttctgactgaactttgcttatTGATAATCTTTGATGACGCCGAAT CCAGTGAATTAGGCGTTTGGTGAGGTCGTCATTTCGAAGGAAAAGAAATC gcaaataattaaaaaacaacTTAATGCTGAAAAGTTTACTATATTGTAGA GGCCCACCTTGGGCCTGTGAGCTTGTATACTTCATAAAAATTATAATCCg aaaacttcaaaaatcttaATAATTGTCTCGCTAAAAACACGGATAGTCAC TATTCGGATTGCTTGCTCGATTCCCAAGTAGTTTCCTTTCTTTTTGACCC CCAAAACCTTCCTACCAAGTCTTCGTCCTTTAATTTATCGCTGTCTCTAA TTCTCATTCTTTATAGCATTCAAAATGTGTTTTCCAAGAAGCTGCTATGT GGTGACGATATGAAATTCtcgtaagatttttttttttcacttcccTTTCT TCTCTTCatggtttttttattttgggtATCAGATAAGTTTTGGTCATAAA TTAACTTCATAGGGAGTTCGGTTGACCAGAATTAAAAATGTTCCGTATTA GACAAATTTCTCTCTCAGTGAAGTATATTTTAAAGAGTCTCAAAATTCTG CTAAATAGttcaccaaaattttttaaagaataatttgtgttaatttgctg tgtaaaatgCTTTTTCTGTCTCAGACGAATAACTTTACTTTCACTACTGG GTAATGCTTTTGATCAAATAGGAATACGAACCCTTTGAAGAGAACTTATg gccattttttcttttgtttttcagaCCATTAGAGTTACAATTTTACACAA GTGTTGCAGCAACAGTTGTCCAAGTACCTTTATGGTTTTTCTTCAttgta agttttatttattttaattgTTGACTGAATCAATTGAACAGATTCACTCA ATCCCAGATCGTGAAGAATTGCATCTTGTAAGGAATNTGAACAGATTCAC TCAATCCCAGATCGTGAAGAGTTACATCTTGTAAGGAAACTCCTTACATT TTGTCGCAAGATCCGATATTGTTCCTTTAGTTTTCTTTAGTACGGTCTCT AAATTTATTACCATCAccattaaaaagttttaaatgaaaaaagtttcatt GGATATTATAACTCAACTTACATCCAATTAACAAAATACAGATGAAAATA ATAGTTACCTTTATCACAAAAAGaacgaccaagaaaattttgcaaagaaA GACAATTTGCTGACTTGCAACAATTACTCCATTCAATTTTTAAGCCGTTG TATTCTATTATTTGGAACGTTAGACTCCTCTATTATTTATGTCCAGATCT GGTCATCAAAAAACCTAGCCACCCAATTAAAATCGGTGATACCGTTAATT ACATACCCGTTGTCCATTCGTTTACACTTTCAAAAACTCAATCAGGAAAT CTTAAGTATTATTTAATTAACCCACAAAATGTAATTTGATGTCTTCGCTC AAACCCATTGcctcagaaaaaaatgaatgcatagaGTTTTTTTATGTTGC AGTAACGTAGATAGAAAGCAATTGAAGGAGAGCGCTCAATACCATATAAG GAATTATGAAAACTACAATACTCTTAACCGTAGAATTTCCTTTCTCCTCG TATTCCATTTTTCCGTTTTCAAAGCGAGATTATGTTTCTTCTCCCAACGG GCAAATGATTTCCGGAAAATTCATTAACAAACTCACTTTTTCTGTTACAA TGTTTTTTCAGCAAATGCACTTAAAATTGAACTTTCTGCTTTGCATACCA GCAAATCCTATATCATATGAGGGGATTTAGCTTGCTTCTTTTGAAGGAAC ATTCCGTCTTATTTAACCATGACTTTTAGGCCCCCAGCGGTAATCACGAT ATcgcgcaaatttttgtcttcaatcacgatcatgtaaaacagcaaaaaaa ttggaTAATCACGCATTCCTTTGAAAAAGACCAAATCACACATCACggtt caaaaatctttcaaatcacgatcacgttttgacctctgatcacaCAATCg cgaaataaaaatttccaaatcacgtaatcacgctagaaaaaagtccctat cGCGCCATTACGAAAACCGCTTGGGGAGGGGGCTCCTTTAGATATTTGAA ATTCCCGATGATAGACAAAATGCAAACTTCAAGTATCGAATTGTTTATGT ATGTTTGGACGACTAAAGTTTAAATTAGTGCTTATGTGgacatttttgaa catttcTTTTTGAACATTGTGTAACGCTtgtaaatatctttccaacaatg gCAAAAATAGTCTGTTCCGTTACATCTGGATTTCTTTAAAGACTTTCGAA TACAAACCTTttctacacccccttctcacggaCCCGCTGGGAATTTTTAA GCTagtggggtaaaaataacggaccgaAACTCGAcgggattgatattcct atgttttttatggctggagattAGAATTATATTGTTTTCGAGCTGgaaaa ttcagtgaggatgCAAATTTTTAGTAAGGATTTGCTCATCTAATTACTta cagtggggacaaaaattagagtataattttccactggggacgatattttg atcaatttttccagtgggaagggatccgagtgggtctgtgagaagggggt gttttcttTTCActatcaaaacaatgaaaaatagaGTGCTTGTAAAACGC TACTAAAATCCAAATGAAACTAGATGGACTACAGATTAAAATCATTATTT GCGAGAGATGAGAAAtggaataattatttttcatctACTATCATGGAAGA GTAGAAGGAAGAAGGAACTGACTCAGGGGGATTACATTTTTCGCTGACTT CCTTAATGCGACTTAATATCTTCCTTGTTCGATGTCGAAATTTGTACAAA AATATACACAAATATTGGCGCCTAGAGAAAATTCAAAGACATGAAATTAC TGTTTGGACCCTTAGGGGACTTTGATTATGATATTTTGATGTTGTTAGAA ACGATTATATTGATACCGATATTTCAAACAACTATTTTCCCAGACGATTA TACATGTATCATTTGAATTTAAAAGCATATCCAAGATCAAAGCTTGTAAA AATCAAAGCCAATCCTGAACTACAcgtttttgttataagaacataaggct ttgatggctaaaatgttaagaacaagttaagagcataTTAAAGCTTTGCA GTCTCTAGAACAtcgaatttcataggaaaatggacaaaaatactcaaaaa atggcgaaaataagaacatgttaagaacatttttaggcttcagactcaaa aagttaagaacatcccaaggaaTCAAAGATATTGcctgttctcataaaaa aacgtttaatcTCATAACAAAACATTCATTCATTCTACTAGCACAACACT CTACTCTAAAGGTTTGCTGATTATAAGACCTGACaagcttttttaaccaa aatatttaaaaccaaATTGGATCATGTCTGAAaatgaaagcgaaagcgac tcAACGAATTTCAaagaataaatcaaaaaatggtCGTCTTTTTGCCTCCT GATATTATATTATATGTTAATCATTTTATAAGCataattattcttaactt caatcatgcacgtttttttctaataaaaaactatatagaaacataaggct tcgatggccaaaatcttaagaacaagttaagaaaattttaaggctttaat acccaatttctcaggaaaatactcacaaaatggtgaaattaagagcatgt taagaacatttttaagcttaaactcaaaaagttaagaacattcgaatgct taaaaaatcagatgtttttatagaaaacgtGTATTACAGTGTCTAGAAAT GTTATTCATTTAGGCTTCAGTCCAGTACACCAATTATCGTTAGATTCTGA TCAGGAAGACGTTTGAGCCTTCGTCACCAAGATGGACTTAATTGAAATGC TTAGAAACGGATAGCATTGAATgagtttattttgaaaattaatggGCAAC TATTTTTGTAAAGAATAGATCAAGtccgttaattttttctttttgtcttt gatTTGAAGGAAATAAATTAATCGTTAAGCTGCTCTTGGAAACCTAATTG CCAACAAGGCCATTAACTCTTCCTTAAACCATTATAAACCAGACTAAAAT TGTGCATgattatttgaaaattataaCAAATCTTTCGGCTTCAATAAAGG TGTTACTGGGTGGGATGTACCGATTGTCTATTTCAAAGTCAAACTTTTTA CGATTGTTTTTAGACCTAGTACCCCCAATCTTGGGTTAGTCATTTAATTC TATCATTCCTTTGGGTTTATGCATTGCCTACCTAATAACAGTACTACTAC CATTTGAAATTTGATgatcccaaattgaaatattcgattaaattaaagag agaATTCTCAatatacacgttgtttttttttagaaacacacttttaagaa acatgaggctcagaatgtctaaaatctaagaaacatctaagaaacatgat gaggctgagaatgagaaaataacatttttttaattcgttttttaaagagc cttccaatccagccttccatgaggctgaatacgtcaaaaagtttagaaac atgtaagaaacatttaaggctcaaaaggccgatttcttaagaaacattga ggctgcttggtaaaactagtttcttaaaaaaaaacacgagtatttcgacc atgattgtatccTGATAGTTTGAAATCTTGTCGAAACCTTAGTTATATAT AACCTTGAAATATACCAATGTAAGTGATACTTTAATTGTGAACTAGGact gtacagggtgtccggaaagaaagttcttgtgtgttttaacactaaatttg caatgtttatcaaagtttctatctgtgtcatattaattgtcatgagacat cttttatgaataacttttacaaaaaacaagcctcaataactttaacgtca tgaaaattgtaaagaaagttaactctttttaatcataatgacttttggaa aaaaattattttgttggtatatattttcttacattttgttaaacacaagc aacaaccttctacttagaatcatgttcgaactcgatatttttttcggaca ccctTTTTTCTACGAAGTCCTAACAATGTATGAATAAAGGTGATTTCTCA GTTATCCTGTGTCGTGTCTAATGTTATCAACAAAGTTAAGTTGTCAAGAA AAACTGGCATTAATTGGGCTGGCAATGTTCCATTCAAAGTTAAAATCCCA TGACACAAATGGCTATTTATTTTGatggtttcaaattattttaaaaacac tttAGAGTAATTTATGATGATGGACAGCGTAGGAGTGGGTAGACCCATAA ATTGAACATTCCTCTTTTGTAACAACcggttaaaatcaaattatatgTAT CTTGATTTTAAACACTCATAAATCACAGTTTTTAAAAGATCGATTATCGT GGTTTAATTGATCATTTTAATGAGGTTCCAGAGAAATCACTGCTCACACA AATTGccaaagtttcaaaaagatAATGACATTAAATACCTAATgtaaggg aagaaatttcggTGCAATTTGGccgaatttattttggcgatttaataaaa tttctaaattttgcgagtagaaattttggcgaatgacccatttttgttca atattttagctgaaaaaagagAGAAGAAAAGGGGTTTTAGGAGAAATACa gactaaattgaaagaaaattaaatttgacgagaatttattttggcaagTT ACCTATAGATTTCAATTTGGCGGAAAGagattttggcgaatttggcgaaa ttTTTAGGCAAATATTCTTTAAACGATGGTGTAAGAATAACGTTAAACTC TAACTCgtttcatttttataagaacaatttgataaGAACAATGAACCTCA TGGATGCCAAAAATAAGACGCACcgtaatcacgacgacggattGTTTcca gcggttcctttgttttagaGGACTAcaacttttgaaatctagcgatagat tttagtttcaatccggcgtttgtgtaaaaactacgcgcgggcgttctgga tgggaaataggtGGTTTCATTTCatatccaggagtctcgcctctagccct ttgggcttgaaactcaatggtcggTACCCGCAAACAAGCCATTGTAGtat tgtagtgtttgaaactttacCTAACCGACAAACGGCGCTATATCATTAGT GTACAAGCGaaactagatctagcgctctctccgcgggtaccaattccaaa aaaactccgatcataatattttgctcggccggcattgagtaacttggtcc aggggtCAAAGGTCAGTgggtttgatcaattagggggggggggtccaatA AAGATGTGAGGTAATaatattttgatcaaaacatCTATCATATTTCACGC GTTTagataatctttttttttttaacaaaatatgTCCATGTTAatagcaa aattttaaaatttggaaaataggGATTGTGCTATAAATAGGGGTTCAAAC CACTCTGGGCGCGCTCCAAGTGCCCAAAAGTAAGAACAGAttcttttaaa ataataatGGGTCAtcccattaaatttccatacccCTGTATgagtggacg aaccttttcgaGTCAAAAACATCTCTTGGATATGTGTGGATTCGcctgga aaatgtcaaaatttacaaaaaaaaacttggaaaatttcttcccttttctt aaagtgacggtggacgaactaaaatcagtcttttaccccctgaaaattgT AAGATaatttttacccccccccccggagaaATGAAAGGAACACTCCCTTA GACCACCTTGAATTATTCGTCCACCCAATGTATGGANNNNNNNNNNNNNN ttttccccccccccccccctggagaAATGAAAGGAACACTCCcttagacc ccctggaattATTCGTCCACCcaatgtatggatataaaatggaatggccc aatagcAGTGAACTAAACTTGAAAAAAGAATTATactcttcatttaattt tttgtagGATTTGACGACAAAGTGGGAGACTACAGATTCATACGTAGCAT CCATGTTGTTATTCAACGGTGTCGTTTTTTACTTACAAAGCCTCTTCGCA TATTCATTGATGTCTCTCATCTCTCCTGTCACTTTTAGGTAAGTCATTGT GTTTCTATTTTACTACACGCCTTTTTCACAGACTCGGTGGACcccctccc actggaaaaaaattgtccccaatggaaaattatactccgaGTTTtgtccc gctgaaaataatcaaaaaaacaattccTCACTGCAAAACACCGTGCaata ttttctataaaaaaacatgataTTCAAATCTCTAGCTATAAAACACGGGA ATGTCAATCCCAATAGAGTTTCAGGCATTTATTTTTACCatgactggctg aaaaatcctaccgggtctctGAGAAGGGGTGTTTTAGTGCACGCCTTTTT TATCGGAACAATATTTATAAGAAAGCTGGGTTGAAAGGTAGATACATTTT ACTTGGTTTCGTTATTAGAACATTATTTATTAGAACAGAAATATAAATTT AGAATAAGTTGCTAATAGAATGCTGATTTTTAGgccctttgggctttttt ctttattttaattatttaagTAGAACCCTTGAAGAGcttgaaaatcattt tgaaagaattcagGGACGATCAATCGTCCAATCAGAGGTTCTAGACTTTT TGAATATCTTGTAAGTTATGTCTTTATAGtgtcatattttttaatatttt tactttcGGGTTCATTCAGGTCATCCACATTCTTCTAAAATGGTTGATTA GTTGTAGATCGAATTCTTGATGATTTCTCAAATAGTTTTGATAAATCGGC TagccaaatttgaaattcaattcaaACAAGTAGTAGTAAATCACATCAGT TATAAAGTTCAAAACAAAGTAGAGAATGTGTGCTCTCGGACCAGATATTG TGTTCGAGGTACAGAAATTTTCCTAGATTGTCCACAACTTTTCATAGGGC CAAAAAAGGTTTTCAAAATAGATGTGCTGGTCGCGTAGTTTGACTAGAGA TTCACATCGTAAAACCTTAAACAAACGATCAAATCGCTTATCTTGCTTCA AACCACCTGATAGATATAAATAATCCTGTAtttcagtttttcaaatttct attcAAAACAACGTAAGAAGTACGTGAGATTATAAGCATCACGGCAACAG CAACCAAATGGAGTGagagaaaatcaaagaattgAAAAGAAGAGCGGGCA AGACGAACAAAGTTCGAAAAACGCAAAGTCAAGTGTAGGCTGctcgcatc ccctctgatatgcaATAAACTGTATCTTAGAAAATACTTTAGAGTTTAGA GGCCCATGTgagtttgtaatttttttgtgaTACTAATATTTGATAGTTGT TATAGTTCATAGAGATTTGTATGTACCATAGATGTCTTTAACAAAATGTG ATTGAAACAGAAAACTTGTTTCAAAGAATGCGAGTTACACAAGTGTCTTA ACAGAGGGGTCAGAAAGACATCCCGAGTTAAGTAGAATTCGAGTTAAAGG TGCGAGTTAAAGATTCCGCTGTAAAGACTTCGTGTTACAAAAGTGTTTTA ACAAAGGGGCCAGAAAGATATTCCGAGTTAAGAAGAATTCGAGTTAAAGG TGTGAGTTAAAGATTCcgtaaaatatcttttcacttTTCACTTGTCATTA TTTTTAGTGTATCTAATACAGTTAAACGTGCTGGTTTAATTTGGTTTTCA ATCCTGGTGTTTGGTAACAAAGTCACTCTTTTGAATCTGTTTGGTACAGT GTTGGTTGTAGCTGGTGTGTTTTTGTATCAACGAGCTCGTATGATGGAAC AACACAAAAGGGACCAAATGATTGTTGAAGAAAAATTAAACCatggaaat aaagaaaaagg
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000283XLOC_000283Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000445-exon-sc0000002-1491911889:757087..757274TCONS_00000445-exon-sc0000002-1491911889:757087..757274Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:757087..757274TCONS_00000445-exon-sc0000002-1510915933:757087..757274Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:757087..757274TCONS_00000445-exon-sc0000002-1575043694:757087..757274Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:757430..757547TCONS_00000445-exon-sc0000002-1491911889:757430..757547Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:757430..757547TCONS_00000445-exon-sc0000002-1510915933:757430..757547Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:757430..757547TCONS_00000445-exon-sc0000002-1575043694:757430..757547Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:757866..757924TCONS_00000445-exon-sc0000002-1491911889:757866..757924Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:757866..757924TCONS_00000445-exon-sc0000002-1510915933:757866..757924Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:757866..757924TCONS_00000445-exon-sc0000002-1575043694:757866..757924Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:758616..758742TCONS_00000445-exon-sc0000002-1491911889:758616..758742Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:758616..758742TCONS_00000445-exon-sc0000002-1510915933:758616..758742Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:758616..758742TCONS_00000445-exon-sc0000002-1575043694:758616..758742Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:759037..759190TCONS_00000445-exon-sc0000002-1491911889:759037..759190Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:759037..759190TCONS_00000445-exon-sc0000002-1510915933:759037..759190Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:759037..759190TCONS_00000445-exon-sc0000002-1575043694:759037..759190Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:768997..769112TCONS_00000445-exon-sc0000002-1491911889:768997..769112Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:768997..769112TCONS_00000445-exon-sc0000002-1510915933:768997..769112Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:768997..769112TCONS_00000445-exon-sc0000002-1575043694:768997..769112Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:769989..770121TCONS_00000445-exon-sc0000002-1491911889:769989..770121Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:769989..770121TCONS_00000445-exon-sc0000002-1510915933:769989..770121Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:769989..770121TCONS_00000445-exon-sc0000002-1575043694:769989..770121Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:771853..771906TCONS_00000445-exon-sc0000002-1491911889:771853..771906Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:771853..771906TCONS_00000445-exon-sc0000002-1510915933:771853..771906Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:771853..771906TCONS_00000445-exon-sc0000002-1575043694:771853..771906Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:772261..772333TCONS_00000445-exon-sc0000002-1491911889:772261..772333Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:772261..772333TCONS_00000445-exon-sc0000002-1510915933:772261..772333Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:772261..772333TCONS_00000445-exon-sc0000002-1575043694:772261..772333Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:778444..778574TCONS_00000445-exon-sc0000002-1491911889:778444..778574Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:778444..778574TCONS_00000445-exon-sc0000002-1510915933:778444..778574Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:778444..778574TCONS_00000445-exon-sc0000002-1575043694:778444..778574Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1491911889:780144..780347TCONS_00000445-exon-sc0000002-1491911889:780144..780347Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1510915933:780144..780347TCONS_00000445-exon-sc0000002-1510915933:780144..780347Clytia hemisphaericaexon
TCONS_00000445-exon-sc0000002-1575043694:780144..780347TCONS_00000445-exon-sc0000002-1575043694:780144..780347Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000002supercontigsc0000002:757087..780347 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 8.92314e-08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9.04963e-05 8.47607e-09 1.07118e-08 0 0 0 0 0 0.00132099 8.60235e-07
Blast
BLAST of TCONS_00000445 vs. Swiss-Prot (Human)
Match: S352B (Solute carrier family 35 member E2B OS=Homo sapiens GN=SLC35E2B PE=2 SV=1)

HSP 1 Score: 277.33 bits (708), Expect = 7.375e-88
Identity = 158/355 (44.51%), Postives = 227/355 (63.94%), Query Frame = 3
Query:  270 HQTDEIILEREKSNTRRHVHRAQSFDKENAQKALFTPVFMKQCIV-MSLWFFTSFASIVLNKYLLSTLDVDASLLGACQIVMTTFFGSIVMYVPYICNLTSRKRHKKMENFNRFQFYKTMSILGWLRCGAVICSVIGLKYVAVSFSETIKSSAPLFTALFAYFLLKEYSGIYVNLSLMPIMFGLAISTYTELSFNMTGFLAACTNNILDCIQNVFSKKLLCGDDMKFSPLELQFYTSVAATVVQVPLWFFFIDLTTKWETTDSY-----VASMLLFNGVVFYLQSLFAYSLMSLISPVTFSVSNTVKRAGLIWFSILVFGNKVTLLNLFGTVLVVAGVFLYQRARMMEQHKRDQM 1316
            H++++I+  +    T  +V      +    +  L   V+  + ++ ++LWFF SF ++ LNKY+LS L  + S+LGA Q++ TT  G +   VP  C L    +HK   ++    F  TM  +G +R   V+  ++ LK VAVSF+ET+KSSAP+FT + +  +L EY+G+ VNLSL+P+M GLA+ T TE+SFN+ GF AA + NI+DC+QNVFSKKLL GD  +FS  ELQFYTS AA  + VP   FF D+     +  S+     V  +LL +GV+F+LQS+ AY+LM  ISPVTFSV++TVK A  IW S++VFGNK+T L+  GT LV  GV LY +AR   QH+++ +
Sbjct:   35 HRSEKIVFAKSDGGTDENVLTVTITETTVIESDLG--VWSSRALLYLTLWFFFSFCTLFLNKYILSLLGGEPSMLGAVQMLSTTVIGCVKTLVP--CCL---YQHKARLSYPP-NFLMTMLFVGLMRFATVVLGLVSLKNVAVSFAETVKSSAPIFTVIMSRMILGEYTGLLVNLSLIPVMGGLALCTATEISFNVLGFSAALSTNIMDCLQNVFSKKLLSGDKYRFSAPELQFYTSAAAVAMLVPARVFFTDVPVIGRSGKSFSYNQDVVLLLLTDGVLFHLQSVTAYALMGKISPVTFSVASTVKHALSIWLSVIVFGNKITSLSAVGTALVTVGVLLYNKAR---QHQQEAL 378          
The following BLAST results are available for this feature:
BLAST of TCONS_00000445 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
S352B7.375e-8844.51Solute carrier family 35 member E2B OS=Homo sapien... [more]
back to top