Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000400 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000400
Unique NameTCONS_00000400
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length7253

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000400 ID=TCONS_00000400|Name=TCONS_00000400|organism=Clytia hemisphaerica|type=transcript|length=7253bp
tatttgtgaACGGTTGGTTGCCATTAATATAAATCGAAttcatttgttgt
tgtttttgcaCACTGGTATATTTTACGGcgctaaaatttttattaaaaga
attgaGCAAAAATGACGATGGTAGTTCAACTCAATGTTAGTAGCgaagaa
atattttctctcAAACGTAAACATGAACCTTCAAGCTCCACCGATGGGGA
TACATCGACGGAAGGTTCCATTTCACCTGATCTATTGATCACCAACGAAG
TTTCTCAACCACTTCACCAACCAACGGGTCACTCTGCAGCTGCTGTTGCC
TCCTTGAATGCTAACGCCCCTGCCTTCACCTCAATAAGCTCAATGACTCC
GGTCCTAATCaccaaaaacatagaaataggGAATGAGCGCTGGAAACCCA
CGGCAACCATAGTCGAAGAAAACATTAATTCGGTCCCGATTCACGACCTA
CCGCAACCGTACATTGCACCGGACGGTTTATATTACTGGCCGGCCGACAT
GATCAACGGATTCCCTCCCCAACCTGTGCTGATCGAAAGCCTGCCAAACG
GTACGGCAACGGTCATCCAAGCAGACCACGACAGCCAGCAAGCTTTCACT
CAACAAAACGCCCTCGTACGCCCTGATATAATAACTCAAGTTTCAGCACC
GCCGCCTACACCGCCCATTAACAACGTTGTCATCCCGCCCTCCACTAAAG
ACTTGACACCAGATGAGCTGAAACGCTCCATACAAAATCAGTTTGAATAT
TACTTCTCACGGGAGAATTTGGCGAACGATCAATACTTGAACTCACAGAT
GGACAGCGATCAGTATGTACCGATCTCTACCGTTGCTAAATTCAATCAAg
tTCGAAAATTAACTTCAGATATTGATCTCATAGTGGACGCACTTCGAGAA
TCACCATACGTGCAGTTGGACGAAACCGAACAGAAAGTGCGTGCAAACAT
GAAAAGATGTATTGTCATTTTGAGAGAAATCCCAGAAGTCACACCCATCG
AGGATGTTAAAGCGTTGTTCGCAAGTCCAAACTGTCCTAAATGGACGAGT
TTCGAGTACGCATACAATGACAACTGGTATGTCACCTTTGAATGCGAAGA
TGACGCAAAGAAAGCTTACAGATATCTCCGCGAAGAAGTCCAATCATTTC
AAGGTCGGCCTCTGATGGCTAGAATCAAAGCTAAAACGCTACTCAGCCGG
ACAGTCTATCTACCAAAGAATGCGGCAAGCGCCACCGGTTCGACCACAAC
TAACACGTCACCGCCCGCCGATAATGTGACGTCACAATTCTCCACCACCG
GTGGTGTTCCGGCGTTCACTGTGAGCCACCCGCAACAAATCTTTTCACCC
AATTTTCAACCGTTTTACAACACAGCACCTGTGAACGGGAATCCCGGCAT
TCTTCCGGCCGGTGCTCAATGGATCAGTACAACCACACGATTCATTCCTC
CAGAGATCCGACCGAAAAATAACTACAACAAATACAACAACTACCAAGGG
AATAAACAATTGAATGGACAACGCCCTTACTTCCCTGGCTCTAAGCCACG
TTTCCGTAACAACTATAACAACCCCAACAAAGTACCGTTCCACGAAAGAA
ACGGGAACGTTGACTACAATTCTGAAGACCGCCCGTCCAACGTCCCTACT
AACAGGCGTAACAACAACCCGAGCGGACATAATCACCAAAACGTACACAA
TACAAATGTCAATAGTAATTATCGTGGTAGAAATAGTGAAGACCCACGCT
TCGTACGTCACAGTGGACCGCGCAAAGACTGGAATCGAAACAGTTCTGAA
GAAGGACCGCGCTTCCAGCGGCTCCGTGAACGACGCGGCAAAGACGACAC
AGGAGGGTCTTCGTCGACGTCCTCCACGAAAGACGAGAAAATGTCTTCTC
ACTCTAAAAACCCTTCTTCGAAACACGATAAAAGTTCCATTTCCTCAAAT
GAGGGATCTGAAGATTCATCCAATGCTCCTCAAATTAATGGTGATTTGAA
CTTGGATCTGGCTTTGGATTTCCCAGCTCTACCAAGCCCGAACTCACCAA
ACGAAACTGGTAGTAATGGATCAGCAAATAGATCTGCTTCCTCTCTCAAG
GAATTGGCTGCCAATGTTTTGAGTGAAGTCGaatcaaataaagaaaaacc
aatGACAACATCTCCTGCAGACATGAGtgAACTTTTGACGACGGCTGAAG
TTTTCGAACCAGCAGCTACCGAACCCGCCCAAACCACTACAACGAACGCC
AACGAAAACGCCCCCTTAATCACCACAGTGGTGAGCACAGATAACGGTAT
ACCAAAAATGCTGAGCTATGCACAAATGGCGCAAAAACCGAACAGTAATa
aggaaaattttgtaaacGATATCGACACGGCGAAGGACATTTCAGATGCG
GTCGCCGCCAGTGACcctaaaaaatcttcaaataataAGACGGAAAACGG
CAAAAACGGACAATCGGCAAATggaaaacaaaatagaaaacctGGAAGTA
AGAACTCTCCTAGAAGTCAACGTCGGAAATCCAACGGACAAGACAAATCG
GCGGAAGTCGAACAGATGAGCGTTTCTTCGAACTTAACAAATACGGTGAT
GAAGGAAACTTACGCATCTAAATTTGGTTCGTCCAGTGACTCGTCAAGAA
CTGGCAACTCTCCGTCAAGACCCAAAACCCAACCAACGACTAACACAAAC
TCTATAAATAAGCAAAACCCACCATCAacgaataataaaaataatagcGG
CCTACCAGCGCTGCGGCCTTTGATGAGCCAAGTCATCAATCCACCTGTCA
GTAAAATGGACGAAATCAACGGACTAGAGTTACAACAACAGCAACCGATT
TCGTTCAGTGATACTGTTAAAAAACAATCTTCAATTGAACCTTCCACTCC
TACTTCACCGAGGTCAATAGATCTCAACTCTGTGAGTAGTCCTCCATCCT
CTAATACTGTTTCTCAACCGCCAGAGACCTCTTCAACGATAGAAGCTCCG
AAAGAGAAATCATAGTTGTATAGATGCTGAGTGGTTTTTAGTGTGTTTTT
ACGTGCAAACGATGTGGATAGGATGGTTTTTCTTTCCGCTAAATGGTTGC
TTGAATCATTGGATGGTTTCTATATGGTATTTGATAGGGTGgatgatttt
aagaaaaagtaatCAACCAATTCGCAGCAAATGATCGAATCGTCGCTTGA
TACCCACCATCTTGTTCAGTCTTTGTGTTCCAACACAAAAGATGCTGTAA
ATTAAAGAATTCGGTACCTGAATACAAAGAGTATCCCCGATTAATCACGC
GCGTTCAACGCACTGGCTGGTCTGTAAGAGAGCACTTCAGAAAGTATATT
TTTCTATtcgatctttttattttttttgtttttcctcTCTGGATATAAGA
GACGAGCGTGCGAGCGAGTGATCGCGACGGGCAACCGTGATATGAACGTG
ACCGCGTGGTCGCGAGACATTGAAATAAACTTTCGTGTTgtgtattttga
atttttgacgctttagttttattgttttgatttttttagtttttagaatt
ttttcttcttcaataatTCTCTACTCTTTTAGCTCCTGACATCACGCTTA
TATTTATAGCGCCATTTTGTAGGTCATTAGCAGCCCAGGAAcatgaattc
atgatattcatgacgtaatgttttatacggaaataccccggttttagcca
atagtggcaaatttaaaatagacaaaagttgtatgaAATTTGCCGCtatt
ggcaaaaaccggggtctttctgtagaaaacattacgtcatgaataggCAA
ATACACATCCACTAAGATTTATACAAAAACCTAAGACAAATTCTAACAGT
AATTTACGAAATGTGCATCTACCGTTATTCTCGTCAGAGTCACTTGTGAG
TTGTGGTGATTATCTCTAGCATGCTTACTGGAGAAAAATCGACCattacg
gtgcattttcttgaattttttttaccattttcaagcaaaatatggtcaga
ttttcgaaattttacacccttacagtgcatctttctcatctttgctgacT
TTGACCCTTACAGtccactttgggaagcttggaaaatataccTATAAGGG
CCGCAtgtatggtaggtcatttaccttgagtgccccggTCTTTGAGGGTT
TTACAACAACCTTTTATAGTCTGACAATATTTTGTTCCCATAATGCAATG
ATAGAAGTAGTAGTTTTATAGGGGTCCGATGTTTTCTGTCTTGTTTTCTG
TTCTGTAGTATATTATATATTGCGAGTTAAGTCAGGCCTCAACTCTTGCG
TAGTACATTTGCAGGAATAAACTACCGTCACTTTTCGGGTTGAATTAGTT
GTGAAAATCTACAttgattattgaaaattttcaccaTTAAATTTTGCAAG
ATTGTAACTTTAACTGTTTAATtgaacagaattttttttctaaagttttt
ctTCTAATTTGTGGATGGAGTTGAGGCTAGgcttaaaaattcttttttct
gtagttttcaaaccaaaaaaatcttttattttatattttttaaaacaaaa
aagtcaacttTGTTCGACGTAGAGTTCCCAATATTTGTCGTGTTTTTAAC
GAATCGAGTTTATttagaaagagagaaaaaaatcgtttaaaaaactaaaa
atagatATATTATATGATATgaaattttagaacttttcttCGGGTTGATG
CTTTATCACTTGTGATGAGATAGATTTAAAGGTTCTGTCCTATTCACAAA
AAGACTTTTCATATTCGTTACCCTTCATGCTTTAATCGGATTGTCTTCGA
AATGCATTTTGGGTATTAAAGTTCAATTAAGTCATTTGGTAGCTCTCAGC
ATGCATTTGATAAGCTTTAAAACCTGAGCGCGATTTGCGTGGATATCCTG
CTATCCCTATAGTGTGTAGAAAGCTAATCTACTTGAACAGAGAATACTCA
TGCCAGCAAGCTTTTGTTCGACTGATAACTGTCGAggatgaatttctttt
ttaactgGCTGAATAAAAGATTTGTAGATTTGCCATTTTTGAGAATGTCT
GTTCCTCTTTTCATCCCATAATAATGTTCCCTAAATATGAAAACTCAAAT
GAAACTCACTCAANTTACATTTGCAGGAATAAACTACCGTCACTTTTCGG
GTTGAATTAGTTGTGAAAATCTACAttgattattgaaaattttcaccaTT
AAATTTTGCAAGATTGTAACTTTAACTGTTTAATtgaacagaattttttt
tctaaagtttttctTCTAATTTGTGGATGGAGTTGAGGCTAGgcttaaaa
attcttttttctgtagttttcaaaccaaaaaaatcttttattttatattt
tttaaaacaaaaaagtcaacttTGTTCGACGTAGAGTTCCCAATATTTGT
CGTGTTTTTAACGAATCGAGTTTATttagaaagagagaaaaaaatcgttt
aaaaaactaaaaatagatATATTATATGATATgaaattttagaacttttc
ttCGGGTTGATGCTTTATCACTTGTGATGAGATAGATTTAAAGGTTCTGT
CCTATTCACAAAAAGACTTTTCATATTCGTTACCCTTCATGCTTTAATCG
GATTGTCTTCGAAATGCATTTTGGGTATTAAAGTTCAATTAAGTCATTTG
GTAGCTCTCAGCATGCATTTGATAAGCTTTAAAACCTGAGCGCGATTTGC
GTGGATATCCTGCTATCCCTATAGTGTGTAGAAAGCTAATCTACTTGAAC
AGAGAATACTCATGCCAGCAAGCTTTTGTTCGACTGATTACTGAAGTCGA
ggatgaatttcttttttaactgGCTAAATAAAAGAATTGTAGATTTGCCA
TTTTTGAGAATGTCTGTTCCTCTTTTCATCCCATAATAATGTTCCCTAAA
TATGAAAACTCAAATGAAACTCACTCAATTCAAGGCAGGATATTTCGCGg
aatcgcaaaaaatatgaaaaatagaaattatattatttGACATGTGAACA
CGATTAACGTGTTTTACAATTTAGAAACCCTAAAAAGAACGTTTATAAAC
TTTATTATTTTACCACGAGTATGTGTACACAGATTTTTACcatcttaact
tttttttgaaattaagtGTGTGGATCAGAGGTCTTTCAGGTTCGGCCAAG
TTATAATTTCTATAATTATGAAAGAAAACGATATTCGAATTTGCACAAGT
TGTTTTCTTTCATAATGGCAGATCCCCCTTGCAACACCTGTAAGACCTCT
TTACGGGAAAGGTTCAAACGCGCGACGGACTCGTATTTGAATTCTTCCCG
CAGCTGACACAGTGCTGACACACTGTCGTTTATGATATCTGCCGCTCAGT
TGACCTCAAGAAGAATACGCATAATTTAAACGGGCAGGCATCGCCATGAC
TTTATGTTCATGCTGGAATATTTATGCATGATATTATTTTGAAGGCTATT
AAATATGTTATAAACTTGCCAGAGAGTGGGCTGTTTTTGACCCGTTCGTT
TCATTTGCTTCAAATATATACAAGGAGAAGTGCTTTTGCATGGTCATAAA
ACATTGCACACTAAGGCGGTATTTATGTGTGATGCCTGTCCTCGTGCCAG
TCTTTGTTGTTTATGCTTCTGAAGTCGACGAGCTTGTAGAAATCATGAAA
TTAAAAGAAAAGGTGTAGCCTtaagattattttttttatctttatcaTAA
CAAGGCTTGTCTAATATTAAAGCCAGTCAGGATGACTCAAATCGTACTGC
AAACTTCTTGTACCCAATTTGATAAGTAATTTTTATGATTCTTACATGGC
TCGCGAATCTACGACCTGGGTACGATATTATGCTTACTGATTTTCGATCC
GAAAGATGAAAGCTACACCGATCTTCTTCTGTGATTTCTGTATGTTCTTT
GAGGCTTGGAAACGAGAGTAAATCTTaattaaaatcaattaaaatttACT
TACATCCAATGGATATCCAAGAAGAAAGTAGATGAGTTCAAGGCGTGTCT
TCAAGAGATCTCTAACTTTTTCGAAATAACTTTTTGAGTCTCGGAAAAGC
TATAACTGGTGGACGATAGTTGCATTATCAAGCTTTGGGGTAGTTAAACT
TTTCTTGATTTGTGGTCTTGGATATTTTGGATAAGGAAAATTATTTCTCT
GTTTCACAAGCATAAAAGACATACATTTACTATATTTGATGACTTTTTCA
ACTTGTACATAGCCTTCtaacatttcttttttcagaaaaaagtcaCTTGT
ACA
Run BLAST on NCBI

transcript from alignment at sc0000002:70524..100958+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000400 ID=TCONS_00000400|Name=TCONS_00000400|organism=Clytia hemisphaerica|type=transcript|length=30435bp|location=Sequence derived from alignment at sc0000002:70524..100958+ (Clytia hemisphaerica)
tatttgtgaACGGTTGGTTGCCATTAATATAAATCGAAttcatttgttgt tgtttttgcaCACTGGTATATTTTACGGcgctaaaatttttattaaaaga attgaGCAAAAATGACGATGGTAGTTCAACTCAATGTTAGTAGCgaagaa atattttctctcAAACGTAAACATGAACCTTCAAGCTCCACCGTAAGAta ttgattattttgattttatttttcagtttcgTCCTGAAAATTCTTTCTAA ATTTGATTAAATGTGTTTTTTAACGACCTAGGAAACGTTAATACTTTCTT TACTATGATTCTTCACCTNTCAATGTGTTTTTTAACGACGTTTCCTATAC ATTAATACTTTCGTTACTATGATTCCTCACCTAATGTTAATCTTCCTTAA CTACAAAACCTGTGGGAAAACTTTGTTTCGTGTAGCTGCCACACACAGCA TAAACTATTCTACTACATCGTAACTTCCGGGTTTCTTGAATTTCAGATTT TGATCAAACTGCTCCtctttcatttcaaattattcCAATGATCTTTGTGC TGCACTCGAATCTTATTTCGAAccttaatttaaatttaatcTCATGATTT ATGTTTTTCAATGAATATCTAGATTTAGTGCGATTAGATCACGCGAGTGA AGTCTATTGCTTGTTGCAATAAGGCTCTAATTTCCATTTTGAAGGGTTTT ataacagggggggggtcagtactaaaatgtaagacatacatgagtactaa aaggatttttgctaatttttgacatacccccacctatttttcgaaaatgt tattttagtaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNcaaaatggggtcattgttacaaacct agtcgaatttagtgcatcaatctgcaaaataatataattttattactaaa ctgtgctgaactgtacataaagataattttagaaaatatttaaaaaattg gaaaaattctgaaagatttctgaaggtttttttgaaaattcctgaaaaaa aaaatcaaattttttccaaaattgttaaaaaaatgctccattttggctga ttttagaacaaaatactaagatttttNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcccccccccctgtt tataaaggttttgtttttaaataagagtgatattgtaATTTCAAGCTtct tgatattgaattgacacggatgtggagcaagattggtccgaaagaggaaa agaaaaacattttttgcttatatcagcacaatcaggcacaatataacaat aggcagacactgtcctaatatgaaacatgtgtctgatatgaaacgggaat actaatgaaaaaatgaaacctTTACAAGGAACTTCGACATATGGAACTTT CAGGAATGAAATAAGCCACATTAAGCAAGAGGAAATATTgtgaaaataaa tacaaaatacaaaGATTGCTAAATGAAATGGTCTATAAAACTACCAGAAT CGAAAGTTTTGATTCCATGGAAGTTCCATTAAATACACGCTTGTTGTTAA TATGATCATGAAACTGAAAGTTCTAGAACATAGTTTTTAAAGGACTATTC GAGGCTCACATTTCAGAAATTACCAAGAAAATACTAAGCCTTCAGATGAA AGTAAACCTATTTAAAACATCTTAAGAACAACTTAAAAGGAAGTGAGTTT ACTTGTgttcttattgaaaattttgtataattttttattagagAAATCAT CATCATGTTTCTATCGTGTGTGGGCGTGTAAGCATGTAAGGATAATGAAT GGGGGTGGTAAAGAGGTTGAGCGTGTAGTAATTTTCCATCGAAACAGTAG GCACATACATTACATATTTTATAATTAACAACATCCTAGGTATTAAACGT TATTTCTATTTATTAAGAAATTCTTATATCAGTAAAACCAATGTGTCTTG ACTGCTTGAAAAATCTCTCTCGTGATCAAAGGATGTGATTGCTCCTGTTA TGCGCCTGTTGTCCCTCTTCGGACGCTTAGATGTCTTAGATGTATTTTGA AGGTTTCATACATTTCGagaattaatatttttattaccttagCTTTACTT TGTTTTTATGGTTGCCTTGACAGATTTGGAGATGAAATGATATATGCAGT GCAGTGAGCTCTCTTATAAACTTTACTTGACGGGCTAATTCTATTTTGTA CAGTCTTCGTAGTATAGTTTGTAGAAGTTTATGTGTATTATGACAAGCAA ACCAGACAAcgttttaccattttgtgaccgTGGTTGGCTTCACCTTTCAA CGGGAGCTACTAAGGAGATACCAACGCAGTTAGTTTGAAGTTCGTTGGGA AGctaagagaaaaataaataaaaatttcttttgcatcTAGGAACGCGATA GCAGTATGTCGCACCTTATTTTTTCTAACCATCGCGAGCGACACATAAAA CCCCATAAAAGGGGCTTTTCAAACTCGGGCTCAAAAAGGGGATTCCCAGG GATTCCTGGTATGTGACTTAGTTTGTTTTGTCACGTTTTCGGCAGTTGAG ATTGATTATCATCAACACAACATATTTTGATAAAGCTTGGCCTTTTTTCT TAAGTTGTAGAAGCTATTGTCAAATACCAAATTATAGGTGGGTTAAAGGG CTGGTAAACTgcttatgaaaataattttactaTTTATTATTCCCCAGGAT TATTACACAAAGTTTCTCAGTTCTGCCGTTGATCTTGCTTGAAGTTTGTG CTGATGCGCTGGCGTAACCATCCTATTGATCGTGAAGATAAATTCTTGAT AAATGTTCCTTGATTCTGAAAGCGGAAGAGATTTGATCTATATCAATGTT GTTGAATCTACAAAATAGAAACCGCCTTGAGAACTTTTGGGCATCCTAGC GTATCTCGTATAGTATGTTTACTGAGAATCGATAGTAAACGTGTATGTTG TATCTTTGTTTGTTATCCTGACTGGACAATATAATGTACTGACGGTGGGC ACGCAAACACGTACGTTTCACAACATTATCTCCGTGCGTAAAAGCATGCC GTAGGTGCCGGACCCCTATCATTGGAATGCAATTCTCCCTTCAAGCATTT CatatacaaacaaaatgatTTTGAGGGTGAGCTAGAGCGATATTCACCAT TATGACGATCGCTTCATAAATTCATACGTCTAGTCGCCATTTCTATTTCT TTGATTGTTTTCTTTATTAGTGCGAAAAATATGTATGTTTCCCCCTTCGT CTATAGTGTCTAGTAGTTTGTCCCTGTTTGGTGTTTGTTTTTGaatatga tttcttcttttttggatAAAGTAGGTAGAAGTAGAAAACATACTTCGGAT TGGGttacaataaatttttttatagaaactagtaaatttttgctgaaccT CAACTTTTTTTCGTGAATTTTAGGCTGAGTTGCTTTTTAGAAATGTTCCT GAATTTATCGAATACCTAGCAAAAGAGCAGCATATTGGTTAGCAATGTTT GAAAGTTGAGTCAATAACTGTTCTGACATTGTTTTTGTGTTTGAGCAAAA TCGAGCCTCGTGATCTTATAAAATTGTATTCATATAAAAAACATTATCAG ACTTGTGAAAACCTGGTGATTATGACTAGTTGAAGGGAGGGAGGGAGAGA AACCGTGAAAAACAAAACCGACGGAAAttctcagaaattttcaaaaacaa cgaGAAAGGAGCGAACATTGAAAACAAAACACAGTTTTTTTGTCACTAGA TTGTTACCAAACGTACGTTTGTCGTGGGCtgcttttttatagaaaaagtg tgatgaaaaaaaaagggaaaaaaataaagaattctaaaaatagtaTGTAT CCGCCGACGACTAACATTGCGAAAAAAAATCCCGAATAAATATTAGAAGG AAATAGAAAGAATAAGAAAGAAACCGAGAAAAGTTGAAGCAGAGGCGttt cgaagaagaagaaatttcaattttcatcaaTTGCCAATGTTTATCATTTC TTccttattgttattatttttttctacgATTGTTCCTTTGTTGTCcgaaa aaatctcttttgttttgctttatAATAATTTGACGAACAATGGACAGAAT TTATCAAATATTTACTAACATCAATACAGATGTGTTAACGAATActacaa aagaaacaaaaaaaaggaagaggttttaaaaataaaataggaagaaaaat gaagaagaagaaaaatgaattcTTCGGTAGCGATGATGGTAGGCGATAAA GAAACGACGAATTTCTTCGGACTAAGTTTAAGTTTTCGGTTACGGACGGT AGTCGTTCTTATACAGCGAGAGTCAACAGTTATGGCAGTTCAAGTTCTCA CATAGAAGAAGGGAGATAAAACTGCgctaaaaataaagaagaaattatag ccagggagaaagagtgaaAGACAGTGGGGAGAAAAGgaatagagaatttg aaaaaactcaaaacaaaaaataaaacataagtttttattctttcataCTG GACCAAAAAAGAAGaaccatgaaaatgaaaatctatttctctttctcttc ttattctttttttttatatccaTTTTTTATTCTGTTCGAGTCGTACTGTT TCGTATTAAGATACTGGTCTGGGTCTAGTATGTCTAGCTGGATTTGTGTT GTATCTCTCTTCCCTTCTACAGTACAGAGGGGGAGATGGTGAGGAAAGGA GAGAGATGTTTTCACTGTTATTTTTTCGttgtttttaaaaactattTCTT GAGACCAGGCATGTTTTCCTAGTAAGCATAAAAAGTAAGACTTTCGAAAT TCTTTGAACTAGTTATCCTCTAATTACATTACAAATCCTTCAATCTAGAC TAGATCACCAcattatttctcattttttgaattAGTTGTACCAATAACAT ATTATTCTTATAGTATAATTTACGTATAATGTTTTGGAAAAGCAAGTGTG AACTACAGTAGTTTTGAAGACCATCACTCTTGAGGAGAGATTTTTTAGAG ATAtagaattttcttttcaatgttgttctttaaattTTCGTTCAGACTAG GTTATGTTATGATCAACAATACATACATATTTAAAATCCAGTCTAAAAAC CAGGAACAAGGAAATGTATTAGATGTAAAAAGTAGATTCTGTTAGATTAA ATTATTGTTTTATGAGTGGATTGATTCACTTTTTTCAACTTAATTTTTCA TGTTCTTGCCCTGTCTTGCCAGACTGAAAGCTATGAAAAAGAATCAGCTT TTCAAGAGTGGTTGGAGTTTatgtcttttcatttttgaagtccTGTTTTA CCGAGTTTAACATTTCAGTAACATTTGGATGTTGTTCAAAGTTGTTGTTA TTGCCTGGGTTTAGCTGTGATTGGGACCAAAAAAATGATCGAAAGTGACA ATCGCTTAATTTCCTGTTCTTAAGATGATGATTGACCGAGTCATGANctc aaaacaaaaaataaaacataagtttttattctttcataCTGGACCAAAAA AGAAGaaccatgaaaatgaaaatctatttctctttctcttcttattcttt ttttttatatccaTTTTTTATTCTGTTCGAGTCGTACTGTTTCGTATTAA GATACTGGTCTGGGTCTAGTATGTCTAGCTGGATTTGTGTTGTATCTCTC TTCCCTTCTAGAGTACAGAGGGGGAGATGGCGAGGAAAGGGAGAGAGATG TTTCCACTGTTATTTTTtcgttgtttttaaaaacaattttttgagaCCAG GCATGTTTTCCTAGTAAGCATAAAAAGTAAGACTTTCGAAATTCTTTGAA CTAGTTATCCTCTAATTACATTTACAAATCCATCAATCTAGACTAGATCA CCAcattatttctcattttttgagtTAGTTGTACTTCCACTAACATATTA TTCTTATAGTATAATTTACGTATAATGTTTTGGAAAAGCATGTGTGAACT ACAGTAGTTTTGAAGACCATTCACTCTTGAGGAGAGATTTTTTAGAGATA TAGAATTTTCTTTTCCATGTTGTTCTTTAAATTTTCGTTCAGACTAGGTT ATGTTATGATCAACAATATATACAGATTTAAAATCCAGTCTAAAAACCAG GAACTAGGAAATGTATTAGATGTAAAAAGTAGATTCTGTTAGATTAAATT ATTGTTTTATGAGTGGATTGATTCACTTTTTTCAACTTAATTTTTCATGT TCTTGCCCTGTCTTGCCAGACTGAAAGCTATGAAAAAGAATCAGCTTTTC AAGAGTGGTTGGGGTTTatgtcttttcatttttgaagtccTGTTTTACCG ATTTTAACATTTCAGTAACATTTGGATGTAGTTCAAAGTTGTTGTTATTG CCTGGGTTTAGATGTGATTGGGACCAAAAAAATGATCGAAAGTGACAATC GCTTAATTTCGTGTTCTTAAGATGATGATTGACCGAGTCATGAAATACCA TAATTCATGATaagcaccattgcaatgtcttccacggacccaacaactGA TGATTGGTTGagagtgacgtattgactgattttacgtcacttacaaccaa tcagctattaggtccatgatgtaatgtcagaagacattgcgatggtgcat atcatgaatagaacaCCATAGAATATGATAAGATCTGGATTTGGGAGACT TTTTCTCagtaaattcttttttaaagggGTTGCACAGATTATTTTGTTCA GTTGTAGTTGCAACTTAATCTTAAATCTGAAACCACTATTAGTTGGTTAT ATTAAGGTTTTTATTAATCTTTATATTTAGGAAAAACAGAAAAGCCTCTA TATTTGTCATTGTGACTCTTTTTTTTCCGAGACATAAAATCATCTCTCGT GTATTGATTTAAACCGATACATTTGGTGGATTCTTTAAGGATGGTCGTTG GTCATGCATGATTTCTAAAGCAATATGTTGTTGGGGAATTTAATCCAAAT GTTGTATTTGTAACTTATCTTGactttttttggttttgatggtttttgct tttttcgttTGGATAATCATTTTTATATCTTCCACAAAAAAGCCTTGGAT ATAAAGCCAAAAGTAGATTTTTGAGTCATATTATACTTCTAAACATGGTG TATCCAATGCGACGAGTGTTCCACGTCAAAGTCTGGTTGACTGAAGTCAG CTCTGACGATGAAGATGAACCAGAACGTATTGTGATCTGTAGAACGCCCA GCCCTCGATATTCACCTGATCTCCACGCCCTTCACCACCCACCGCCCAAC ATCATAAAAACAGAGTTCAATAATATACTTTCCAATAATCTAAaacctga ttttcaaaatatgcaTACGACTCACTTGAAAAACGACTTCAATACAATGC CACATCATACAGCTCCACACAATACTACAAACATGTTAAAAACCAACTAT TACAGTAGTGATTTACCAGACAAGAGGGGTTTGAATGGAATTGTAAATCG CCATAGTTATAATAGTGGTGTTGGACACAACAGAAAATATCTTGAAGTGA ATAACAATGTCCCTTCTGAATGTGATTCCAGTGAAGGTTATGAGACTTTC GATGAAATGTCTTCTCATCTCGGCTACGTAAGTGTTAGGGGCTGTTCACA TGGAGGTGGGCCTCGGATAGATTTTCGAACGTCACGTGATCTATTTTTAT CCATTTGACTCATCGTCAAAAACTGTGACgtaacgttcgaaaatctatcC CATCTCACATGGGGCAGCCCGCCTCCATATTAACAACCCCTTAGTTATTT TTGGTTCTCTTCGTTTGTTATTACCATTTAGTTTCTTACTTACAGACAAG CAGGTATAGACATGTAGGACATATAGACATGTCTATTAAAGTTTCATTAG CACAAGGGATGCTCTGATTTAAGAATAGACAAGATTACGAACTATAGGGT TGATTTGATTGCTGGCTTGccggaaattttaaatttgaaaggTTTTTGGT ATTGGGTGTGTCAGCGATGACAGAAAATTGTACAACTGCAGTACAGCAAG TTAtgctaatttttcttttctttccacTGTTTTGTTCCTATCgaaagttt ttcaaatcttagaaaataatatttttcctttaattttttttctgaccaTA ATCAAAGAGAGGaacatatttttcttaaagTGCATCAGATGTTCTTTCTT CATCTTCCCTTATAATATTATCCTAATGCCAAGACAAacgattttttttt ccttcGTATTAGCTTGTTTGATTACTTTCTTtactttcataatttttttc acgttctcgtttttcttcttcttcttttttagttTACTTCTCTCGTTTTA GATATCTGTCTTCACAAGACCACTATTTGTTTGTGTCTATGTGTTGATGA CTCATTGAGGctcaaagtgaaatttttgtcatttgCAATTCCGTGTTTTA TCTTTATGTCTGACTGACCgtcttgaaaaagtttttttgaaacagCAAAA ATTCCGTATAATTTTCTAGTAAATCTTTTGTTAGTTTGTGAACGATATCT TTTCACTTTGATACATATTTGCGTCAGTTCGGCCACATTTTCATAAAGGT AtaccaattttaaaacaaaaagcaaCATCTCTATATCCGTGCGTGAATTT ATTCCGGACTTATGGAGACAGAATCTGTCTTCTTTTATATTACTTGAAAA CGAAACCATAACAGAGAAACATCTTCTTTAAATGGCAACAATGTTTTTTG TGTTTGGAAGTTATCAATATATCTAAtctaattttgattatttcatcTAA TGTGCCCCTGaaacacttttaaaaactaGAGGGAAAATCTCGCGGTACGG CGCATGACGTCACCTCGAAAGTATCCTCTATGCGTTACAAGgggtaaaaa atattcaaaaatagaaTATACGATCTAAAATCGGATATATCTCTTCTCTT TTGTTCTGCTTATCATATCAAAGGACTAGGAAAAGGGCAAATTTCCCCTT TTTGGGTTTGTTGTTTCCTAATAGTGTTTAAAGGCTCAAAGCTCTTCTTT CCATCCTTTCCGTCTCGAAGTTCACCGAATCCAGGGCGAATTTGATGTGT GAAATCAACGGCAAAATTAATTCTTTATCTGAAATGAAAGGTGTACTTTT GAATACTGTTTTGTTTGCAATTCAGAAGAAGTGCATTCCTTTTCCTCTTG CTCATCCTTCTATTGTATATCACAGGGGTCTTATTTAGACCCGGCGCAGA GCAAATTTCGCCGTTGTAAGGCACGAAGAATAACAATTCACTGGGTTAAA ATTCTGTTCGCCGCCCCACGCACATAATCAATACACTGGGTTTGCTAAGA ATTCTCCGGTATAAAATCTAGaattgttaatttttcattcgccagcctAT CAGAAACAAAGCAAACCCCCTGATCATATTCCGATGACGGTACCTGGACT CACTTGTAAAGATAAATTGGGGCGAATGTTTCTTTGATAACGGCTCAAAC ATCTTCTTTAATAATGTTCACCGGAAAGTCCCAAAAGACTTAAATTAGGA AGTAGCTTTAAAGAAAAATCGAAACTTTGATTGATTGCTCAGGATTGCTC ATGATTTCTGAGAGGTCCCTTTTTTGATCGGTTTAGAAGAAAAGGTTGGC CActaaaattttgatcaaatgaaactttttttttgaaatgattcCTTTAA TCTTTATAAAAATTAGAGAGCCTCATTTGAAAGATTTCCCACTTGTTAGG TTCCCCTTTTTGCGCTTGTTTCTGTCCTAGCCACTAatatatttatttgt ttttaatattcATATATATACAAAGTTGATTTGAAAGAAACTTTAAGGGA AAgggaagaaaaacatttttgatatGAGGCGACTAATATATCTGTAAATT TGTGTCTAATTTCCTCCCACGTTAATATATACTGTTGAAGAGGAAGCTTG TGATCAACTTCCTATTTTTAAAGTACCATTCTGAGTATActgttttttgt aagaactagtGAACTTTCATTGAGGCTCGGGTGTTCTCAaatcgttcgtt cgtccgtttaccagcttttctcgggattggcccattatctttttcttatt tcttgCAAAATGACAGTACTAAAAAAGtcacagagcccgattttcgagaa aaaaaattgtgcaaaaaaatttgtCTAATTTCCTCCCACGTTACTATATA CTGTTGAAGAGGAAGCTTGTGATCAACTTCCTATTTAAAGTACCACTCTA AGTATActgttttttgtaagaactagtGAACTTTCATTGAGGCTCGGGTG TTCTCaaatcgttcgttcgttcgtccgtccgtttaccagcttttctcggg attggcccattatttttttcttatttcttgcAAAATGACAGTACCAGAAA AGtcacagagcccgattttcgagaaaaaaaattgtgctCCCACGTTACTA TATACTGTTGAAGAGGAAGCTTGTGATcaactttctatttttaaagtacC ATTCTGAGTATActgttttttgtaagaactagtGAACTTTCGTTGAGTCT CGGGTgttctcaaattgttcttatacttTTTGTAAGGCCGAAATTGAGCA ATTTTATACTTTAtatgctttttttttaatttgacgtTCAGGATTGCtgt taatttttcttattttttgaattgtttcagcctcattgttcttataaaat tgttctaacAAAAAAGTGTGTActatttcgatttttaaaaattccgtcCT GAATCTGAAACTACGCGGTGGGATCGTCTTCTACACGTCGATTTCACTAA GGCTAGGAtgaaaggtgattttttttattacctTGTAGCACCAAACTTAG CCGAGTTTTCTTCTCCAAAGCTTTAGACATCTAGCACTGATGCAGCTTAA ATATATTCCTCATTCTGTCATCCTGTATTGAACCGATGCTctaaaagaaa acacaaaacaTTCATTAAAAGATATACTACCCTAGATCCGGATGAAAAAT TCATCTATTAGTAAAATTGAAAGTTGATTTTCAAACATGAAATTCAAATT GAAGAACTGTCATTGAAACagattgaaacattttgttAACAATAAATATT GTCTGCCGACCATTGTTCACTCGTTGAGCATTGTAAATTTGTAGTAGCTT TTACTTGAACACGGTTCTAAACATTCGCTATGCGCTATCAAAACATTGAT CAGACATGGCCTGTGGTTTCTTGCGAAGAATTGAAGCGAAGGTTTACAAA ATTATTAATAGAAGTGCGATGTTCGATCAAAATCATCATACGTAATAGAA GTACGGTGTTcgatcaaaatcttcaaattttccattctggaatttaATTG TAAGATTAAGTTTGTTCTTGCCTACTATGTTTTAAATCTATTGCTTTTgt ttttgtcaatctttcgccTGATTTTCACTCCGGTCGGTTCAGTCATTCCT GCAGACAGGATTAAGAAGCAAATAGGAGGATTTCTAAAAGCTCTTTGAGA ATAGACGACGAGATGAGAAAAGGGTAGTCCAAATTTAACGATTCGAAATT TCCCGATTCTAGGACATTAGTTAGAGGTATGTAGTATGCTATCATATGAT ATCAggtggaaatttaaaaaaaattattctatgACCATGTGCAAAATTTG ATAACTTTAAAGTAAGCTTTATTTTACAAGTTAACAAACATTACTTGATA GAAACATTGTTATACCAAATTAGCTTGaatcgtcaatttttttctggttt caagTAATTCTGGTAAATTTGCATTAGcccatttataaaatataaataat caTGATAGAACTTCTTACGCAATGGAAAAGTCTGAGTTGTTNatttataa aatataaataatcaTGATAGAACTTCTTACGCAATGGAAAAGTCTGAGTT GTTTTATACAGGAATTACGTCAGTAACGCGAACTTTGTGAATTTTCCAGA GAATCGCAATGACGAATATTTTGATCGTCCTTTAATTctaatacagttga cgctcgcTACGAATAGTAGAGCgccgtttatgagagtttctcaTTGACGA TggatttcaatattatcgaataatggagcgtatcaaatagtagaagGTCG ATAAACTCGATTAACTAATACTTTTGATTTCTTGTTTTAGGATGGGGATA CATCGACGGAAGGTTCCATTTCACCTGATCTATTGATCACCAACGAAGTT TCTCAACCACTTCACCAACCAACGGGTCACTCTGCAGCTGCTGTTGCCTC CTTGAATGCTAACGCCCCTGCCTTCACCTCAATAAGGTATGTGGTTTTTG TATGTttcaattcttgatattttgagaCGGGAAACGGGAaatcttttttg tgaaaatctggtacggcggCCACTGCACCTGCCGTACCCGGTGCGTCGTG TCTAGGAACTGGGTACTGCAATAGCTTCTCGCGAGCTGTGGATAGAGTTG TTTTTTGTTCCCTTCGGACCTAGATCAAAGGATGATGATGATGATGGTTT GCTGCTGATTTTATCTACATGTTTACTTATAATGGGCTCTTCCAGAAAAT CGTTCATAGGGTTTCGAAGATATAATATCAATGGCATAAATTTGAATATA TCCAGGATTGATTAAATTATCCGGCGGGGGAATAAATTGAAATCACCACT CCCCCCTTTGTTTCTGGAAGAGCCCAATCTGACCAATTCTATTTAATTCT AATAGTATCCAAGGCTAATACTTGAATAATCATATGATTTGCGTCTGTAT TTAGTCATTATTTGAAAAATTGTTTTACGTTTATTGAAGTGACGTTTGAT GTGAGAAATGACAACTGtgtttttcttataataaaatcaTATGCTAGTTG ATTTATAGTAGTTTTCCATCTCCTTGGCAACTTCAACTTTTAAAAGCTAA TAAATCAGTTGGTGCTCCTCGTGTCGCGATTGAACGTAAAAATGTGTTTA ACAGAACTACgcgtttattttgtaagaacaaactttataagaacataaag cttgaTGGCCAGAATGTTAAGGACacggttaagaacatttgaggCTTCAT GAACTCTTAAACACTCAAATTGCCCAAATATACTCACAAGATGGCCAAAT TAAGAACTCTTTAAGAATAACCctccaaggcttcaaaaatttcggatgtt cttataaaaacgtgtgcTCTTTGCAGGCGTTAAAAATTTAAGCCCTTTCC AAGTTGGTGTTTTTGAAGTTGTTTTAGAAATTGTCTATTTTGTTCTAACA AAATATTGACCAAGTGTCTCAAGTCTCTAGTTTGATCTTTAAGGGGCTAG AGAAAGAGTATGCTTTTAATTTTAGGGGAGGGTGGTGGTAAAGATCCGAG TTCCAAAATCATTTATAGAGATATATACATGAGgaagtttcaaaaatcat tATAGAGGTAAATATCTGAGGAAGTCGACAGTAGGTCTCatcattttttt gcaattttggttGTTCATACTATTTCGACGTCTAATTTACATAAAGATGT CGAATAATGCTTTTTGCTTATCAACAAGTATGATTTCTCGTTGTAGCATT TCCATTGTTTCTACTGTAAAAGGAAATTACCGTTGACATTAAATTTAGAC GGATCCCTTCTGTTTACATTCATATCATTAATGACTTCTTTCACTCAAAA AGTAGGTTTTTTTAACGAGAACTCTGTCTGAATTACTTAGCTAGCTCTCC TCCCTCTTTGTATTTGTGCTGTAAAGAGGAATTTTAAACAGACAACGTGT GCTAGCTGGCtgggttttgaaaaaatgaagtgtATTTCAAGTTATAAGAT TACAGAATTGCCCCCTCTAAAGCCCCTGGTCGTGTTAGTCTATTTTCAAA TACTTCAAACAAACAATTGACCGGGCTATTCTGAGGCTCGTCAGATGATA AAAAAGGATTACGTCATTATCTTTGTTTCTAGATTTGGCATGGATGTGTT GTGTCTGTATAATACACGGTCTGGCAGTATTCGGCtatttttaatgactg attacattttttttgttttcgtaCAGCTTAATAGAGAAAGAGAGGGTTTT TCTCTTGAACAGTATTCTCTGGTTGGTTGATGCTATTATGGTGGTggttt tgcttttaaataaGCTTTTTTAAATTGCTTATTGAAGAgcgttggaaata tttttgtatcagTAATAGTGTGGTGCGAACACGTTGTCAATTTGATTTGG AAATGCGGTGGTGTTCAGCTTTTTCTGTGGATAGTGGAAGAGTTTTTTTA AGGAGTTTTTTAAGATGTTCTTTAAtagcattttttttttgagagattat attattttgaagaGTCCTTTGATATTTTCCATCTTATTTCACGTAGATTT TTGTTGTTGGACAATCAAATTCATCGAATACAGTCTTTGTAGCGGTTAGC GCAAAAAACTGTCCGCATAATGAGAAATGTGCTCTATTTTCGTTCTAAAG AAAGTAATAGACTATTTCTCTCTGGATTGGAATAGCTGGAATGTAGAGGA TGAGAATTGTGTCCTTTATTTAAGAGCGTATTTTTATATCTGAGTCCTCG CTTACAATCAGTAGTCAACGATTGTGTTCGTTTCGCTTGTGATTTTTCCC CAGAGTTTTGTTATTATTGTATATAGCTCTAGTGAAACATGTTCTCAGAT CATCCCCTCTTAGAGacaagatattcttaacttaaGACTGTATTTAAAAC TAAActgagaaaagaaaaattagaaagtgaaaaaaaaagagttcAGACTA GAAACTGTATTCGTTTCCCTACCTCTAGTGTCTCCTTTAAAATTCACGTG TGTGACTAGCCCGTAATCTCTATAAtatactttaattttgatttgatgGG CTGTAACGGGATTATTTCCATTATAATACCTGGTAGAAATTCATACCTCT GATCAGATTATTTTTTATGGTGTAAGTTTTTACtctctttataagaacta gtaaAAGAATGTTTGAGACTCGTTTTAATGGCTTTTGACGTTGAATCCTT GAAGTCAGCTACTATTTTAGGACAgaattttaagcattttgtGCCTTTCA GTACATGATTAGTTTTTTAGTTTAACTATTTCAGGNGGGATAGTggaata gagttttttaaggaGTTTTTTAAGATGTTCTTTAAtagcatttttttttt gagagattatattattttgaagaGTCCTTTGATATTTTCTATCTTATTTC ACGTAGATTTTTGTTGTTGGACAATCAAATTCATCGAATACAGTCTTTGT AGCGGTTAGCGCAAAAAACTGTCCGCATAATGAGAAATGTGCTCTATTTT CGTTCTAAAGAAAGTAATAGACTATTTCTCTCTGGATTGGAATAGCTGGA ATGTAGAGGATGAGAATTGTGTCCTTTATTTAAGAGCGTATTTTTATATC TGAGTCCTCGCTTACAATCAGTAGTCAACGATTGTGTTCGTTTCGCTTGT GATTTTTCCCCAGAGTTTTGTTATTATTGTATATAGCTCTAGTGAAACAT GTTCTCAGATCATCCCCTCTTAGAGacaagatattcttaacttaaGACTG TATTTAAAACTAAActgagaaaagaaaaattagaaagtgaaaaaaaaaga gttcAGACTAGAAACTGTATTCGTTTCCCTACCTCTAGTGTCTCCTTTAA AATTCACGTGTGTGACTAGCCCGTAATCTctataatataattttgatttg atGGNGACTTagtattgttcttaatttgtccttaggttttggtcaatttt cagcctcgtacTCTTAtaagattgttcttataagaaaagtgtGTTTTCCC GAGAAACAAGAGACTAGAACTGCGTTTTGACATTTTCTGAGGCTCGTGTT catATTCTAATGAAATTTGCTTTTAATTACAAGAGCAGCATtcgctcttt tttataagaacaactttaAGAAAGAGAACAAAAGACTAAAAGTTTGTAGA CTAAGAATAAGTTAGGAAGCAGTTGAGCTTTCATCAATTACCTAGAAATT ATTAAAGCCACTTTAGGCCCAATTTAGGCTCTGAAAAACGAAATTATAAG TACTTTGAGAATTTTTTATGTCTTCAgacttcgaaataaaaataagaaaa gccaAGCCTTAGCCGAAGTGTACTGTGACGTATTCTGAATTTAGAATTCT AATTGCTAAATCCAGTGGTCGGGTAGGATCGTTAAACTCTAATTATATCG AGTTAACTTTTGTACTatatttccataactcgaatctTCAATTAACAAGT TTTATTATAACCCTTGAACAATTCTCATTATATCGAACAAATTTTCGTTT CCCTAGCGTGGTGGAGTTATAGAGTCTGgagctacacgctttttttttta taagaatggtgtaaatccatttcatcatggatattcttaacttttttggg aaaatcatcctaaaatattcttacagtattcttNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNtaaagtgtattcttataaaaaaaaaagcgtgtat cagtCTTGTCATGAGATACTAAAGCCGACTAAAGCCACGAGGTTTTGATT CAAAGAGAGAGAGAGGGGGAGAAAGAGAAACGTGTTCTGGAAGTATTGTA TAGCTGAGGTCTTATagtgttatttttcaaaatagtaaTCAAACTGTCCC CCTTTTTTATGTAAGACAAAACTGTTGACAAACTTCAAACTGTGTTATGA AATggacaaagtaaaaaaaataatataacaaATTTGTTATTTTCTGTAAC TTGAACTGTGTTTTCTATCGATTTTCGATTTAGTAGTCGTTCGTTGTCAC ATGGCCTAATGACAGTCAGTTTGTGTAGCATAGAAAACTTACGTTGGTGT AATGAATGGTTTTGGTCCTAATTTTGAGTTCTTtttttgacaaacttttt tttcaatgatgAAAACGATCAGGGGGACAGAGGAGGCGATTGTTATGATT ATTCTAGATAAATTGGGTATTCTTAATTGATCTTAGTGTATGTTGCGGGC AAAAATTGCTTTAAATGtttattgttatgttttcattggaaaaatgatta aatttaCAATTAATTTTCACAAGCATACCAGATCCTATTGACATTTTATT ATGGAACGCTTGTTTCGTTTTCCTTCtacaaatttttactttgttaCAAT ATAAAATCTTGATTAGTGGTACAATGAGTTGATTTGTTGTAATTAGTTCG GTCGTGACATTGAGAAAGATATTATAtggtttttttctttaaatactTTG TATTTGAATCAATGAGATAAGACTTTGTCCGATTGGCAAGATATTTTCAC TGATTGGTCTCATTCTTACTGCAGCAGAGGTCACTGAAGTGTAAGACATT CTTTAATGAAAAACGATCGCACGCCTAATTAACTTAACATGGTGATTTGA GTGGTGTGTGTCATATAGCTGAAACAACCAAGATTTATAACATTTATTTC AAGCGTAATGTGATTTTATTATTtccaatatttttgttatttcagCTCAA TGACTCCGGTCCTAATCaccaaaaacatagaaataggGAATGAGCGCTGG AAACCCACGGCAACCATAGTCGAAGAAAACATTAATTCGGTCCCGATTCA CGACCTACCGCAACCGTACATTGCACCGGACGGTTTATATTACTGGCCGG CCGACATGATCAACGGATTCCCTCCCCAACCTGTGCTGATCGAAAGCCTG CCAAACGGTACGGCAACGGTCATCCAAGCAGACCACGACAGCCAGCAAGC TTTCACTCAACAAAACGCCCTCGTACGCCCTGATATAATAACTCAAGTTT CAGCACCGCCGCCTACACCGCCCATTAACAACGTTGTCATCCCGCCCTCC ACTAAAGACTTGACACCAGATGAGCTGAAACGCTCCATACAAAATCAGTT TGAATATTACTTCTCACGGGAGAATTTGGCGAACGATCAATACTTGAACT CACAGATGGACAGCGATCAGTATGTACCGATCTCTACCGTTGCTAAATTC AATCAAGTAGGTCTCTTATTTCACATTTACACATAGGGTTTATGCCgtac atttttttaattgagtCAGACGGTCAGacctttttgaaattatttcatcC AGCAGCTGTCAAGTCAATAAGCTATTGGACATGAAAATTTACTTCCAGAA TAATATCTAAAACAATCATCTTCTGAAATAGTAGCTAAATGATGAAGTTA ACAATCTTCTTAAAGGCTTGCGGTGTATGTTATGTCTTTGATTCTATAAA TTTcctctttatttttgtttaggtTCGAAAATTAACTTCAGANGATTCTA TAAATCTtctctttatttttgtttaggtTCGAAAATTAACTTCAGATATT GATCTCATAGTGGACGCACTTCGAGGTATCTATTAGTACTTTTGTCGTGT GCATTTTTAAAGATGATGATTAGTTTATGGATAAtaccttttgttttgat tgttgcCATAACACAACGTCATCTTTATGGGCTTGGGTGACTAATCAACA TGCTGTTTTTGATACAGTGGAAtctttttaactcgaacttctataagTCT CctgaacaagttttatggtacATATAAGCATCTTTATTTCTTATAAACTC TACTCCATATCTCGAACAAAGTTGCGCGTGctcgaattatggagactcca ctgtatcatATAAACGTCACTCCCAGTAAAAGTGTTTTTAGTAATTTAAA GAAGAAACTCTTTTCAACTCTACTATTGAAGCTctacaattaaaaaaata tttctttagtcAACGAAAATTCTTGTAGTGATTCAACCAtgtccattttc tttatcttagAATCACCATACGTGCAGTTGGACGAAACCGAACAGAAAGT GCGTGCAAACATGAAAAGATGTATTGTCATTTTGAGAGAAATCCCAGAAG TCACACCCATCGAGGTAAGAAAGACCTTCTTTTGATACTGCTTCTCCTTG GCTGGAAACATGTCACTCTCCACTGCCGAAATCTCGAAAAACTCAGCTCC TTGTTACTATTTCCCTCGTCCGTTTAGAAATATGGGGAATGTAAGTCTAG AGTTTTTAACTAGTCCAACCGAATGTCTTCTTAGTACTATTCTACTGTCT ctcaggcgaaaataaaaaaaatatatagtgtttccggaaactgGCCGGTT GAAAAATGCATTTTTCTGACCCgaccgcagactatgggttcatctatatg gttcatcataaagaaaatcaagttaaccgtccaagctatcaaacgttgtt tggttagatattcccgcttgtaaattAAGTTTTGTTCgctagtagttgat acattagtattcagggcctacttcatactgtttgtacataaaatttatct ttaaagttctatttcaatgatcttgaGTTATCGAAAAtagcaagaaaaaa aattttccggccggccgcatgagagctttcttgcttcacccgcattccag aaacactgcatttttttattttcgcctcacCGGTCTTTCACTGCATTCCT AGGTTTAATTTAGAGCTTGGAGTTTAAAAGATGCGGTTTCATATAACTGG GTATAGGTTCTCATTTCCTCTAAAAAGTGAGGCCTTCTTTATACAGACAT CACTAATGACGATGTTATAAGGATAAACAAACACGGAAATTTTCGAACGG GAAAAAAATTCTTACACAACGCACAGTCTAGGCTctctctttgtttttct tttgttttccttgtAGAGCAGTTCATAATCCTTTGTGTAGACTAACCTCA TATTTCTTAATCGGTGACTGTTTTTCTATGCTCTGCTCCTTTTATGGTTC ATTTCATGAttggaattttaaattttgtgtttatttttcaaattaaactT TCATCGTGAATATATCGCAAAGCTATTTGCGAAATTCATTAATGACTTTT GAGGAGAAAAGCACCTAATCATCATTGGGTTACTGCGTAGTAAAGGACCC AAAATAGGTCATGATTTTGTTTCGTTTGAGAGTTAAAAATgtgcaatgaa aaaaaatattttgaaaggtGTAAGAGATAAAGTGGTGATCTTTATTAACT AGATTTTCCTTCCCCATTCATACATATGAcaattttttcctaaaaataat GTTCCTGTTTTGCAATCGCCCTCCGAATGATTTTTTCGATTTGAGTTTCC GTCCATGATTTATAACTGTACAGCATTTAAATTTTAGATATTATATAAAT TATAATTTTCGGAAATATAGTGAGATTCTCCGTATTTTAAGCATCAAATC ATGCATAGACAAGGAGTTCGAAACAGGTAATTTTTGGTACAAAATCAAAT TACTAAATTCCTTCTTTTCCCTGTATATAGGATGTTAAAGCGTTGTTCGC AAGTCCAAACTGTCCTAAATGGACGAGTTTCGAGTACGCATACAATGACA ACTGGTATGTCACCTTTGAATGCGAAGATGACGCAAAGAAAGCTTACAGA TATCTCCGCGAAGAAGTCCAATCATTTCAAGGTCGGCCTCTGATGGCTAG AATCAAAGCTAAAACGCTACTCAGCCGGACAGTCTATCTACCAAAGAATG CGGCAAGCGCCACCGGTTCGACCACAACTAACACGTCACCGCCCGCCGAT AATGTGACGTCACAATTCTCCACCACCGGTGGTGTTCCGGCGTTCACTGT GAGCCACCCGCAACAAATCTTTTCACCCAATTTTCAACCGTTTTACAACA CAGCACCTGTGAACGGGAATCCCGGCATTCTTCCGGCCGGTGCTCAATGG ATCAGTACAACCACACGATTCATTCCTCCAGAGGTATTCTTGTATAAAAT TTGCTCATTCTAATTTGATATCTAAGGGAATGAGACTTTCCTNGTATAAA ATTTGCTTGTTCTAATTTGATATCTAAGGGAATGAGACTTTCCTTAGACT TTAGAAAATGAATCAGATTGAAAGACTTTCATAAAAGGCTTTCCGAACTG ACGGAAACGAGTTGAGGGTATCAGAGGTTTGGATCTGAGATACACCTTAA GTGgtttaattttttgcgtggacaaaattttgcGAATCGGTTCCTTTTTA cccaatttctttcattttgctAGGGTTTCGGACCAAATTGGCGAgttcta ctttaatgggataaatttttgcagGAATTAAATTTCGTGGATTTCGCGGA CTTGGGTGTCATCCACGAAATTAAgtctcaatggaaatttggaaagtcGT TATCCGCTaaatatttttgaggaaaagctcgaaaaatgtaaaataactaT TTTTATAATGTTCACTAGCATCAAAGAGGTGCTGACAATGCGTATTTCGA TAACCAAATGCATAAATTGGCATAAAAAGGCATAAAACTAAAGTATAGTG CTATCTGCCAAATAAAGTCCCCGCAAGATCTTAAAATTTCGTGGATGAGC TCAACTCCGAAATTTAATCcgcgcgaaaatttatcccattacagtagttt tcgcgaaaataaatccacaTCAAACTCAACCTACTTAAGGTACCTCATCT CTGTAATAATTTATTCTTTGACACTAATATTTTCATCAATGTTGATGAAG TTTTATAGCCCTTGGAGGACATTCGAATCGACGTTTCTTTTCAGGTTAAT GGGGATGCTGCATAGCTAAAATATATTATGAATGAAATTTGTATAACTCA CGTGTTGTGTTGTAATTCAGAACTGGACAGTACGCCTACTCCACTACTTT ACGAAATgagcaatttttttctctcttagTTTTTTTTACCgtatttgttt atttattttcgcTGTAATTTGATCTCTTTACTCTCTGTCTGAATCTTTAA TTCCTCTTAGCGTTTTCGTGGTTAAACTTGCTTTCATTCTTATTTGACAA ACCAACATGCAAAAATCATGTCATTTCTCACATGGCATCTCTGCATTACT CTCGAATACCATGTGGTACTGTCATCATGGGCAGATCTTGTTTCAAAGCT TACCGTGTAAACAGGAGATGCTAGAAAATTACCTCCCATCACTTTCAGat cctattttttacttttgCACGCGAGCTCACGAATAATATAGAGTGTTTCG CGTCGGAACATCCGAATAATATCGAGTGCTTTCCGTCGGAGCATccgaat actttaatgggataaactttcgcggatttcgcggatttgggtgtcatctg cgaaattaagtcccaatggaaatttggaagggcctcatccgcgaaatatt tctaaacaaaaatcAAAGTGTGTCAAATAAATAGTATCTGAATGGTTACC TGCATCAAAGAGgtgcaaataatgtgtatttcaacaaccaacatgcatga tttgatagtaaaagtcacaaaatcgtgaagatgttgccacccgcgaaatt aagtccccgcaaaatttttgaatttcgcggatacgctcaaccgcgaaatt taatccccgcgaaagtttatcccattaaagtaatatGAAGTGTTTTCCAC CGAAGCATTTGAATAGGATCGAGTTTACCACCAACTATGAATCTAGTGGC AAGCACCCAGTTTTACGGGCTGTTTTCAATCAAGATTGCATCGCTAGAAA GTTTCCCTCGTCTTTATTTTCAGATCCGACCGAAAAATAACTACAACAAA TACAACAACTACCAAGGGAATAAACGTAAGAAACTTTCTTTCCTCATCCC ACCTCATCATTGACCAGGGACCTGTCCCCTTTGAGAATTTTTTCATACCA CCACCCCAATTTTTCGAAGTGGTATTTTAGTCCACTAAACGTTTTTGGGA TATTGTGATACAGGGACCATCTTATTTTGGTCTtctcaaaaaatgataaa tattgcTTATTTTAGTACCAGTGTATTTTTGGCTTGACAACACTTTTTTA GTATTTAGTATGCCATCAAATCAACCCTTCCCCTGTATAGACAAAAACTT ATAAGAACCTTTACCTCTAAATTCAAGTCCTTGATAATTTTGGTCGCGTT TGAATCCGTTTTAAACACATAGTTTCAGGCcccttaaaaagcttttttgt cATAATAAAATATCTCACTCAAGTCACCGTTTGTCAGTTATCTATTTCAT GTCCTTTTACTTTTACAGAATTGAATGGACAACGCCCTTACTTCCCTGGC TCTAAGCCACGTTTCCGTAACAACTATAACAACCCCAACAAAGTACCGTT CCACGAAAGAAACGGGAACGTTGACTACAATTCTGAAGACCGCCCGTCCA ACGTCCCTACTAACAGGCGTAACAACAACCCGAGCGGACATAATCACCAA AACGTACACAATACAAATGTCAATAGTAATTATCGTGGTAGAAATAGTGA AGACCCACGCTTCGTGTAAGCGAATGATTTATTTTACATTTGGCATCAAT TCGAGTTTATTACTTACTCCTCAGTTTCTTTATGCTAAGTCTAtctttcc taagcataacatttaTAAACATATGCAGGCACAATTTTTGGTACCTGAAC AACGGCTCTAATGTTCAGGAGCAATAGAATGCTTAACATAATGCGAGCCT AGTATAAGGGAAgacatttgtttaaaaaaaaacatgtattaaaAGTTAAG ATCTTTAGACTTTGAGCAATTCCAAATATTACAATGAAGTAAATTATCTT TTACTTGAAAATAATTAACTTTATTTAGAAAAGAAGTTACCACTTTCCTC TTCTATATTTTATTAGACGTCACAGTGGACCGCGCAAAGACTGGAATCGA AACAGTTCTGAAGAAGGACCGCGCTTCCAGCGGCTCCGTGAACGACGCGG CAAAGACGACACAGGAGGGTCTTCGTCGACGTCCTCCACGAAAGACGAGA AAATGTCTTCTCACTCTAAAAACCCTTCTTCGAAACACGATAAAAGTTCC ATTTCCTCAAATGAGGGATCTGAAGATTCATCCAATGCTCCTCAAATTAA TGGTGATTTGAACTTGGATCTGGCTTTGGATTTCCCAGCTCTACCAAGCC CGAACTCACCAAACGAAACTGGTAGTAATGGATCAGCAAATAGATCTGCT TCCTCTCTCAAGGTTCGATTCTCAGTTTAGAGTTCTCTGTTAATCATTTC AGGCTATCGTACttattttgtttaatttgtCTCTGTCTCTCATGGGAGTC TCTCCTTTGGTTAAGACTTCAGTACAAATTTAGATTtcggaattttgaaa ttgaaattcataGCAACANGAGTCTCTCTTTGGTTAAGTACAAATTTAGA TTtcggaattttgaaattgaaattcataGCAACATAAGTTTAAAATAATC GGTAATTTTCCCCATTCTTGGATTTCACTGATTCCAATTATGTATTCTTG TTTTAGGAATTGGCTGCCAATGTTTTGAGTGAAGTCGaatcaaataaaga aaaaccaatGACAACATCTCCTGCAGACATGAGGTATTAAACTGGCTTTT TTGTCTATGTGGTTTGGTTGTACATTTAGACATcgaattagcggacacta aacATACAAAACGTATTGGTAGGTGAGCAACCCACCTCTAAAAAGCGTCG TTTACAACCAATGAATTGAGGCACAAGTTCTTCAAAGAACTTAATTATAT AAACTTCACAATCTTATAACTTGACAACCAATGGACCACGTTTAAAAGAT TTTACCACAATTTTTCTAATAAAGGTTCCAGCTTAGGGGTTCAAAGTTTT CTTGAGTCACCCGGTATGTATTTGCTCTTTATAGTAAATCAAGGTCTGGA ATATACAGATTCAAATCAGGATTGAGAAATTTATcgtatttctattttct ttgttttagtgAACTTTTGACGACGGCTGAAGTTTTCGAACCAGCAGCTA CCGAACCCGCCCAAACCACTACAACGAACGCCAACGAAAACGCCCCCTTA ATCACCACAGTGGTGAGCACAGATAACGGTATACCAAAAATGCTGAGCTA TGCACAAATGGCGCAAAAACCGAACAGTAATaaggaaaattttgtaaacG ATATCGACACGGCGAAGGACATTTCAGATGCGGTCGCCGCCAGTGACcct aaaaaatcttcaaataataAGACGGAAAACGGCAAAAACGGACAATCGGC AAATggaaaacaaaatagaaaacctGGAAGTAAGAACTCTCCTAGAAGTC AACGTCGGAAATCCAACGGACAAGACAAATCGGCGGAAGTCGAACAGATG AGCGTTTCTTCGAACTTAACAAATACGGTGATGAAGGAAACTTACGCATC TAAATTTGGTTCGTCCAGTGACTCGTCAAGAACTGGCAACTCTCCGTCAA GACCCAAAACCCAACCAACGACTAACACAAACTCTATAAATAAGCAAAAC CCACCATCAacgaataataaaaataatagcGGCCTACCAGCGCTGCGGCC TTTGATGAGCCAAGTCATCAATCCACCTGTCAGTAAAATGGACGAAATCA ACGGACTAGAGTTACAACAACAGCAACCGATTTCGTTCAGTGATACTGTT AAAAAACAATCTTCAATTGAACCTTCCACTCCTACTTCACCGAGGTCAAT AGATCTCAACTCTGTGAGTAGTCCTCCATCCTCTAATACTGTTTCTCAAC CGCCAGAGACCTCTTCAACGATAGAAGCTCCGAAAGAGAAATCATAGTTG TATAGATGCTGAGTGGTTTTTAGTGTGTTTTTACGTGCAAACGATGTGGA TAGGATGGTTTTTCTTTCCGCTAAATGGTTGCTTGAATCATTGGATGGTT TCTATATGGTATTTGATAGGGTGgatgattttaagaaaaagtaatCAACC AATTCGCAGCAAATGATCGAATCGTCGCTTGATACCCACCATCTTGTTCA GTCTTTGTGTTCCAACACAAAAGATGCTGTAAATTAAAGAATTCGGTACC TGAATACAAAGAGTATCCCCGATTAATCACGCGCGTTCAACGCACTGGCT GGTCTGTAAGAGAGCACTTCAGAAAGTATATTTTTCTATtcgatcttttt attttttttgtttttcctcTCTGGATATAAGAGACGAGCGTGCGAGCGAG TGATCGCGACGGGCAACCGTGATATGAACGTGACCGCGTGGTCGCGAGAC ATTGAAATAAACTTTCGTGTTgtgtattttgaatttttgacgctttagtt ttattgttttgatttttttagtttttagaattttttcttcttcaataatT CTCTACTCTTTTAGCTCCTGACATCACGCTTATATTTATAGCGCCATTTT GTAGGTCATTAGCAGCCCAGGAAcatgaattcatgatattcatgacgtaa tgttttatacggaaataccccggttttagccaatagtggcaaatttaaaa tagacaaaagttgtatgaAATTTGCCGCtattggcaaaaaccggggtctt tctgtagaaaacattacgtcatgaataggCAAATACACATCCACTAAGAT TTATACAAAAACCTAAGACAAATTCTAACAGTAATTTACGAAATGTGCAT CTACCGTTATTCTCGTCAGAGTCACTTGTGAGTTGTGGTGATTATCTCTA GCATGCTTACTGGAGAAAAATCGACCattacggtgcattttcttgaattt tttttaccattttcaagcaaaatatggtcagattttcgaaattttacacc cttacagtgcatctttctcatctttgctgacTTTGACCCTTACAGtccac tttgggaagcttggaaaatataccTATAAGGGCCGCAtgtatggtaggtc atttaccttgagtgccccggTCTTTGAGGGTTTTACAACAACCTTTTATA GTCTGACAATATTTTGTTCCCATAATGCAATGATAGAAGTAGTAGTTTTA TAGGGGTCCGATGTTTTCTGTCTTGTTTTCTGTTCTGTAGTATATTATAT ATTGCGAGTTAAGTCAGGCCTCAACTCTTGCGTAGTACATTTGCAGGAAT AAACTACCGTCACTTTTCGGGTTGAATTAGTTGTGAAAATCTACAttgat tattgaaaattttcaccaTTAAATTTTGCAAGATTGTAACTTTAACTGTT TAATtgaacagaattttttttctaaagtttttctTCTAATTTGTGGATGG AGTTGAGGCTAGgcttaaaaattcttttttctgtagttttcaaaccaaaa aaatcttttattttatattttttaaaacaaaaaagtcaacttTGTTCGAC GTAGAGTTCCCAATATTTGTCGTGTTTTTAACGAATCGAGTTTATttaga aagagagaaaaaaatcgtttaaaaaactaaaaatagatATATTATATGAT ATgaaattttagaacttttcttCGGGTTGATGCTTTATCACTTGTGATGA GATAGATTTAAAGGTTCTGTCCTATTCACAAAAAGACTTTTCATATTCGT TACCCTTCATGCTTTAATCGGATTGTCTTCGAAATGCATTTTGGGTATTA AAGTTCAATTAAGTCATTTGGTAGCTCTCAGCATGCATTTGATAAGCTTT AAAACCTGAGCGCGATTTGCGTGGATATCCTGCTATCCCTATAGTGTGTA GAAAGCTAATCTACTTGAACAGAGAATACTCATGCCAGCAAGCTTTTGTT CGACTGATAACTGTCGAggatgaatttcttttttaactgGCTGAATAAAA GATTTGTAGATTTGCCATTTTTGAGAATGTCTGTTCCTCTTTTCATCCCA TAATAATGTTCCCTAAATATGAAAACTCAAATGAAACTCACTCAANTTAC ATTTGCAGGAATAAACTACCGTCACTTTTCGGGTTGAATTAGTTGTGAAA ATCTACAttgattattgaaaattttcaccaTTAAATTTTGCAAGATTGTA ACTTTAACTGTTTAATtgaacagaattttttttctaaagtttttctTCTA ATTTGTGGATGGAGTTGAGGCTAGgcttaaaaattcttttttctgtagtt ttcaaaccaaaaaaatcttttattttatattttttaaaacaaaaaagtca acttTGTTCGACGTAGAGTTCCCAATATTTGTCGTGTTTTTAACGAATCG AGTTTATttagaaagagagaaaaaaatcgtttaaaaaactaaaaatagat ATATTATATGATATgaaattttagaacttttcttCGGGTTGATGCTTTAT CACTTGTGATGAGATAGATTTAAAGGTTCTGTCCTATTCACAAAAAGACT TTTCATATTCGTTACCCTTCATGCTTTAATCGGATTGTCTTCGAAATGCA TTTTGGGTATTAAAGTTCAATTAAGTCATTTGGTAGCTCTCAGCATGCAT TTGATAAGCTTTAAAACCTGAGCGCGATTTGCGTGGATATCCTGCTATCC CTATAGTGTGTAGAAAGCTAATCTACTTGAACAGAGAATACTCATGCCAG CAAGCTTTTGTTCGACTGATTACTGAAGTCGAggatgaatttctttttta actgGCTAAATAAAAGAATTGTAGATTTGCCATTTTTGAGAATGTCTGTT CCTCTTTTCATCCCATAATAATGTTCCCTAAATATGAAAACTCAAATGAA ACTCACTCAATTCAAGGCAGGATATTTCGCGgaatcgcaaaaaatatgaa aaatagaaattatattatttGACATGTGAACACGATTAACGTGTTTTACA ATTTAGAAACCCTAAAAAGAACGTTTATAAACTTTATTATTTTACCACGA GTATGTGTACACAGATTTTTACcatcttaacttttttttgaaattaagtG TGTGGATCAGAGGTCTTTCAGGTTCGGCCAAGTTATAATTTCTATAATTA TGAAAGAAAACGATATTCGAATTTGCACAAGTTGTTTTCTTTCATAATGG CAGATCCCCCTTGCAACACCTGTAAGACCTCTTTACGGGAAAGGTTCAAA CGCGCGACGGACTCGTATTTGAATTCTTCCCGCAGCTGACACAGTGCTGA CACACTGTCGTTTATGATATCTGCCGCTCAGTTGACCTCAAGAAGAATAC GCATAATTTAAACGGGCAGGCATCGCCATGACTTTATGTTCATGCTGGAA TATTTATGCATGATATTATTTTGAAGGCTATTAAATATGTTATAAACTTG CCAGAGAGTGGGCTGTTTTTGACCCGTTCGTTTCATTTGCTTCAAATATA TACAAGGAGAAGTGCTTTTGCATGGTCATAAAACATTGCACACTAAGGCG GTATTTATGTGTGATGCCTGTCCTCGTGCCAGTCTTTGTTGTTTATGCTT CTGAAGTCGACGAGCTTGTAGAAATCATGAAATTAAAAGAAAAGGTGTAG CCTtaagattattttttttatctttatcaTAACAAGGCTTGTCTAATATT AAAGCCAGTCAGGATGACTCAAATCGTACTGCAAACTTCTTGTACCCAAT TTGATAAGTAATTTTTATGATTCTTACATGGCTCGCGAATCTACGACCTG GGTACGATATTATGCTTACTGATTTTCGATCCGAAAGATGAAAGCTACAC CGATCTTCTTCTGTGATTTCTGTATGTTCTTTGAGGCTTGGAAACGAGAG TAAATCTTaattaaaatcaattaaaatttACTTACATCCAATGGATATCC AAGAAGAAAGTAGATGAGTTCAAGGCGTGTCTTCAAGAGATCTCTAACTT TTTCGAAATAACTTTTTGAGTCTCGGAAAAGCTATAACTGGTGGACGATA GTTGCATTATCAAGCTTTGGGGTAGTTAAACTTTTCTTGATTTGTGGTCT TGGATATTTTGGATAAGGAAAATTATTTCTCTGTTTCACAAGCATAAAAG ACATACATTTACTATATTTGATGACTTTTTCAACTTGTACATAGCCTTCt aacatttcttttttcagaaaaaagtcaCTTGTACA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000269XLOC_000269Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000400-exon-sc0000002-1491911889:70524..70715TCONS_00000400-exon-sc0000002-1491911889:70524..70715Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:70524..70715TCONS_00000400-exon-sc0000002-1510915933:70524..70715Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:70524..70715TCONS_00000400-exon-sc0000002-1575043694:70524..70715Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:83014..83159TCONS_00000400-exon-sc0000002-1491911889:83014..83159Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:83014..83159TCONS_00000400-exon-sc0000002-1510915933:83014..83159Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:83014..83159TCONS_00000400-exon-sc0000002-1575043694:83014..83159Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:88619..89129TCONS_00000400-exon-sc0000002-1491911889:88619..89129Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:88619..89129TCONS_00000400-exon-sc0000002-1510915933:88619..89129Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:88619..89129TCONS_00000400-exon-sc0000002-1575043694:88619..89129Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:89450..89498TCONS_00000400-exon-sc0000002-1491911889:89450..89498Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:89450..89498TCONS_00000400-exon-sc0000002-1510915933:89450..89498Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:89450..89498TCONS_00000400-exon-sc0000002-1575043694:89450..89498Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:89934..90037TCONS_00000400-exon-sc0000002-1491911889:89934..90037Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:89934..90037TCONS_00000400-exon-sc0000002-1510915933:89934..90037Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:89934..90037TCONS_00000400-exon-sc0000002-1575043694:89934..90037Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:91454..91906TCONS_00000400-exon-sc0000002-1491911889:91454..91906Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:91454..91906TCONS_00000400-exon-sc0000002-1510915933:91454..91906Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:91454..91906TCONS_00000400-exon-sc0000002-1575043694:91454..91906Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:93697..93748TCONS_00000400-exon-sc0000002-1491911889:93697..93748Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:93697..93748TCONS_00000400-exon-sc0000002-1510915933:93697..93748Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:93697..93748TCONS_00000400-exon-sc0000002-1575043694:93697..93748Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:94192..94438TCONS_00000400-exon-sc0000002-1491911889:94192..94438Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:94192..94438TCONS_00000400-exon-sc0000002-1510915933:94192..94438Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:94192..94438TCONS_00000400-exon-sc0000002-1575043694:94192..94438Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:94790..95135TCONS_00000400-exon-sc0000002-1491911889:94790..95135Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:94790..95135TCONS_00000400-exon-sc0000002-1510915933:94790..95135Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:94790..95135TCONS_00000400-exon-sc0000002-1575043694:94790..95135Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:95430..95506TCONS_00000400-exon-sc0000002-1491911889:95430..95506Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:95430..95506TCONS_00000400-exon-sc0000002-1510915933:95430..95506Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:95430..95506TCONS_00000400-exon-sc0000002-1575043694:95430..95506Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1491911889:95883..100958TCONS_00000400-exon-sc0000002-1491911889:95883..100958Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1510915933:95883..100958TCONS_00000400-exon-sc0000002-1510915933:95883..100958Clytia hemisphaericaexon
TCONS_00000400-exon-sc0000002-1575043694:95883..100958TCONS_00000400-exon-sc0000002-1575043694:95883..100958Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000002supercontigsc0000002:70524..100958 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0.263626 1.04937 1.38713 2.48777 7.85729 1.33403 0.982658 3.25774 2.39782 2.09423 3.96666 1.92914 4.84542 2.35339 1.79299 5.84874e-08 0 1.43485 1.24842 1.10216 1.61995 0.000297886 0.563473 5.28669e-08 7.1704e-06 0 3.28622e-09
Blast
BLAST of TCONS_00000400 vs. Swiss-Prot (Human)
Match: LARP4 (La-related protein 4 OS=Homo sapiens GN=LARP4 PE=1 SV=3)

HSP 1 Score: 216.083 bits (549), Expect = 1.873e-57
Identity = 99/174 (56.90%), Postives = 134/174 (77.01%), Query Frame = 1
Query:  691 STKDLTPDELKRSIQNQFEYYFSRENLANDQYLNSQMDSDQYVPISTVAKFNQVRKLTSDIDLIVDALRESPYVQLDETEQKVRANMKRCIVILREIPEVTPIEDVKALFASPNCPKWTSFEYAYNDNWYVTFECEDDAKKAYRYLREEVQSFQGRPLMARIKA-KTLLSRTVY 1209
            S   ++ ++LK  ++ Q E+ FSRENL+ D YL SQMDSDQ++PI TVA   +++KLT+D DLI++ LR SP VQ+DE  +KVR + KRCIVILREIPE TPIE+VK LF S NCPK  S E+A+N NWY+TF+ + DA++A++YLREEV++FQG+P+MARIKA  T  ++  Y
Sbjct:  110 SNSAVSTEDLKECLKKQLEFCFSRENLSKDLYLISQMDSDQFIPIWTVANMEEIKKLTTDPDLILEVLRSSPMVQVDEKGEKVRPSHKRCIVILREIPETTPIEEVKGLFKSENCPKVISCEFAHNSNWYITFQSDTDAQQAFKYLREEVKTFQGKPIMARIKAINTFFAKNGY 283          
The following BLAST results are available for this feature:
BLAST of TCONS_00000400 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
LARP41.873e-5756.90La-related protein 4 OS=Homo sapiens GN=LARP4 PE=1... [more]
back to top