Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000357 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000357
Unique NameTCONS_00000357
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length304

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000357 ID=TCONS_00000357|Name=TCONS_00000357|organism=Clytia hemisphaerica|type=transcript|length=304bp
ccaaaagaaaaaagttttagaaaaaccaACATCGGACCAATTATGATATT
AAACTTAAAATCTTCATAAAGATAGCGAACTTTTTAAAAGGATAATTACT
GGATTTAAAGATAAATCGATATCTCGGTAGAatctaaaatcttaaaaatc
aacAGATTTATAATAAATCACAATAAATTATATttacacgaattacaata
ttatgATATACACAACAAACTCTTTATATTATTAAAATGATGTACAGAGC
AATCTCCGTTATCAAAATCATGCAGGTGTCTATTgccggggtgggggggg
ggNN
Run BLAST on NCBI

transcript from alignment at sc0000001:1880724..1881027

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000357 ID=TCONS_00000357|Name=TCONS_00000357|organism=Clytia hemisphaerica|type=transcript|length=304bp|location=Sequence derived from alignment at sc0000001:1880724..1881027 (Clytia hemisphaerica)
NNccccccccccaccccggcAATAGACACCTGCATGATTTTGATAACGGA GATTGCTCTGTACATCATTTTAATAATATAAAGAGTTTGTTGTGTATATc ataatattgtaattcgtgtaaATATAATTTATTGTGATTTATTATAAATC TgttgatttttaagattttagatTCTACCGAGATATCGATTTATCTTTAA ATCCAGTAATTATCCTTTTAAAAAGTTCGCTATCTTTATGAAGATTTTAA GTTTAATATCATAATTGGTCCGATGTtggtttttctaaaacttttttctt ttgg
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000231XLOC_000231Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000357-exon-sc0000001-1491911889:1880724..1881027TCONS_00000357-exon-sc0000001-1491911889:1880724..1881027Clytia hemisphaericaexon
TCONS_00000357-exon-sc0000001-1510915933:1880724..1881027TCONS_00000357-exon-sc0000001-1510915933:1880724..1881027Clytia hemisphaericaexon
TCONS_00000357-exon-sc0000001-1575043694:1880724..1881027TCONS_00000357-exon-sc0000001-1575043694:1880724..1881027Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:1880724..1881027 .
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0.363851 0.844932 0.413317 4.02539 1.59046 0.959411 3.14366 0.943265 0.389462 0.756042 1.24248 0.744452 0.515414 0.635611 0.454738 0.2801 0.861281 1.98318 1.24515 2.16452 1.05578 0.427813 0.388944 1.20181 1.07259 0 1.09203 1.65654 0.843875
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00000357 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top