Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000350 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000350
Unique NameTCONS_00000350
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length370

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000350 ID=TCONS_00000350|Name=TCONS_00000350|organism=Clytia hemisphaerica|type=transcript|length=370bp
CACAACTCACAAAGCAAAATTCAGTAAAATGCACAAAATACCTCCACAAG
AAAATAACGGAAGAGAGTATTCCAGAGTATTccgatgattttgaaaattg
aaggcGGCATGAAAAAGTAAGATAAAAAGtaagataaaaagtaaacacaa
aacaAGTGTTGATTAAATTATAAAGTCATAAGGTAAAAAGGTCTGTAACT
CCTCCAgatgattttcaattttgtcgCAGTGCGAATCGATGCACCttatg
tctttgaaaattagtCTTTGGAGGATACTGAGAAACGTAGCACATTCGTT
GGGGTAGTCCACGTTCAGTACGTAAAATAGAGCGTAGAAACAAAGCAGCC
CCATCGGTAATTGATCAACG
Run BLAST on NCBI

transcript from alignment at sc0000001:1589429..1589798

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000350 ID=TCONS_00000350|Name=TCONS_00000350|organism=Clytia hemisphaerica|type=transcript|length=370bp|location=Sequence derived from alignment at sc0000001:1589429..1589798 (Clytia hemisphaerica)
CGTTGATCAATTACCGATGGGGCTGCTTTGTTTCTACGCTCTATTTTACG TACTGAACGTGGACTACCCCAACGAATGTGCTACGTTTCTCAGTATCCTC CAAAGactaattttcaaagacataaGGTGCATCGATTCGCACTGcgacaa aattgaaaatcatcTGGAGGAGTTACAGACCTTTTTACCTTATGACTTTA TAATTTAATCAACACTtgttttgtgtttactttttatcttaCTTTTTATC TTACTTTTTCATGCCgccttcaattttcaaaatcatcggAATACTCTGGA ATACTCTCTTCCGTTATTTTCTTGTGGAGGTATTTTGTGCATTTTACTGA ATTTTGCTTTGTGAGTTGTG
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000224XLOC_000224Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000350-exon-sc0000001-1491911889:1589429..1589798TCONS_00000350-exon-sc0000001-1491911889:1589429..1589798Clytia hemisphaericaexon
TCONS_00000350-exon-sc0000001-1510915933:1589429..1589798TCONS_00000350-exon-sc0000001-1510915933:1589429..1589798Clytia hemisphaericaexon
TCONS_00000350-exon-sc0000001-1575043694:1589429..1589798TCONS_00000350-exon-sc0000001-1575043694:1589429..1589798Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:1589429..1589798 .
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.20208 0.475302 0 0 2.69678 0.0159875 3.43422 1.21793 1.02056 1.59656 2.30076 1.41199 5.41988 4.55301 3.8674 2.57874 5.73239 8.90203 0.135868 2.09682 7.25489 4.58738 4.13191 3.01176 4.1129 5.84211 2.55681 0 3.30625 2.09427
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00000350 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top