Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000166 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000166
Unique NameTCONS_00000166
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length5785

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000166 ID=TCONS_00000166|Name=TCONS_00000166|organism=Clytia hemisphaerica|type=transcript|length=5785bp
aatacaaaaaaagcGTAACATTCTAAAATGGTAGTGAAGCTACGGAGACT
AGACTAGGTGAAGCAACTTGACACAGAAATTTTGGGGAAACTTTCTGTGT
GCCAACATGATGACGTAAAGACTCTAAAGATGGACCTTTGTATACTTAAA
CAATTAGTTATGCCAACTTGATCATGAACTTAATAATCTGGTAGAAAGCT
GAAGAAATTTGGTTAATAAAGCacgtttttatttacttttgttttttgaa
tgcaccaaaaagttttaatttttgatttaccGTTGATTCACGATTTACAC
CGTCCAGTCCACCAAAGATTTAATTTATCCTTGCTTCAAAATTGATTACA
AAAGATGTCTACCAAAGTCAAAGTTGCAGTACGAGTCCGTCCACTCAACA
AAAGAGagTTGGAAATGGCCACAGACATCGTCATTGATATGAAAGGCGCA
CAGACATTTCTTAAAGCAcccaaaaatgaaaaACATTCGCATATGACCAT
TGCTTTTGGTCTATGGACCCaaacaataaagaaaaattttcaaGTCAAGA
ATACGTATTTTCATGTCTTGGGAATGATGTCTTAGATAATGCATTCAATG
GATACAATGCATGTATCTTTGCATACGGACAGACAGGCTCTGGTAAAAGT
TACACTATGATGGGTGCACCTGGACAAAAGGGACTCATACCCAGGATTTG
TGATACACTGTTCGATAAAATAAGTGCAGCTGTAGAAAAAGATAAAAGCA
CAACTTTCAAAGTTGAAGTATCGTACATGGAAATTTATAATGAAAAAGTC
AGAGATTTATTATGCCCTAAAAGcgaCAAACACAATTTAAAAGTGAGGGA
acacaaaatacttggcacataCGTGGATGGTTTATCCAAATTACTTGTAC
ATGGTTATAATGATATAGAAAATTTAATGAGCGAAGGTAACAAATCGCGT
ACTATCGCGGCAACCTCTATGAACGCAGAAAGCAGTCGATCACATGCTGT
GTTCTCTGTTGTCATGACGCAATCACAATCGGATGAAGCCACCGGACTTG
TCGGTGAAAAAGCTGCCAAAATAAGTTTAGTCGATTTAGCTGGCAGTGAG
CGTGCATCGAAAACGAACGCGTCCGGAGACCGTCTAAAAGAAGGAAGTAA
CATTAACAAATCACTCACAACACTTGGTCTTGTCATCTCTGCTCTTGCTG
ATCAGgcGAGCGGTAAATCAAAGAAGTCCAATTTTGTACCGTACAGAGAT
TCAGTTTTGACATGGATATTGAAAGATAATCTCGGTGGAAACTCCAAAAC
TGTCATGGTTGCCACAATCAGTCCCGCAGGTGACAACTACGAAGAGACTC
TTTCAACATTACGTTACGCCGATCGTGCCAAACGTATTGAGAATCATGCT
GTCATCAACGAAGACCCCAATGCAACTCTGATCAGAGAGCTGCGTGGAGA
AGTGGAGAAACTGAGAGCGCAACTTTTGAAGCACGGTATAGCACAAGATA
CAGAATCATTACAAGAAGCTCTTgatcagaacgaaaaattgatGGAAGAA
GCCTCGCTGACGTgggaacaaaaagaaaaacaaactgaACGCATTCACCA
GGAACGGCACAAGATCTTGAAAGAGATGGGTATCAGCGTGCAAGATGCCG
GTATCGCCGTTGAGAAGGGACGATATTATCTGGTTAACCTGAATGCAGAT
CCTTCGCTCAATGAGATGTTGGTTTATTACCTGAAGGACCATACAAAAAT
TGGTAAAAGCGACGCATCTGACCCTCAGGACATCCAACTAAACGGTTTGG
GTTTACAACCACAACATTGCGTGATCGATATTGATAACGAAGAAGATACA
TCCTATATCGTCCCTTTTGAAGGGGCTAGAACATGCGTGAACGGTCAAGT
GATCACGGAACGCACGCAACTACGACACGGTGACCGTATTCTGTGGGGAA
ACAATCATTTCTTCAGAATCAATTGTCCCCACTCTCCTCCACCACCAGGA
ACGCAATCAgaagaaaaattggatttcGATTTCGCACAAAATGAATTGAT
GCTGAACGAATTTGATTCGCTTGGAGaaCCACTCCAGAATATTATCCAAC
AACTTGAAAAccaacatgaaaaagaaaaacaagGTGCTCTCGACCAGCAG
AAGGAGATGTACGAGCAAAAGCTAGAAGAACTACGGCGCGAGCGAACGCC
TGACACAACAAGCGGCCGCACGNCGAGCAAAAGCTAGAAGAACTACGGCG
CGAGCGAACGCCTGACACAACAAGTGGCCGCACGAGTTCAGGGTACAATT
CAGAAGATCGGGTTTTGAACTCAACGCCGACCTCCTTTTATGACAGCCAA
CTTTTGTATGAAGAGAGTTTACGTCGCCTGCGTGAAGAAGTGATCCGCGC
AAACGTTTTGGTGCGCGAGGCCAATCAGTTGAGCTCTGAAATGAAAAAGG
ACGCTGATTTCGCTGTCACGCTTCAgATCCCAACAGCTACACTATCACAA
GCCGCCAGTCAAGGGCCGTTGACAAGCGAAGTAGCGGTCGTAGTGAAACA
CAAAACGCGTGGCACACAAGTTTGGTCTGTGGACAAGCTTGGTAATAAAA
TTTATGACATGCGAGATGCTTATCAAACCATCACAGAAAACCCACTAGAG
GCTAACCTGGACGATACTGATGATGACGGTTTATTTTTCGAAGTGGAATG
TCACACTTTGATTGGCGTCGCCACAGTCTGGTTGGAATGTCTGTATCAAA
ACGTCCCCTTGGATTATTCAGCTCCGGTCATTAGTCAGCAGGGTGAAGTC
TGTGGACGCATGTCTGTTGAGATTAGGAGGATACAAGACGAGACGACATC
TTTATCACTTGATGGGGACAGTGTCAGCGATGAAGATGATATCGAAGGAT
TGGCCATGGGAAGCTCTGTCAAAGTACAGATTACAATCAAAGAAGCTCAT
GGTTTACCTCTCTCCCTCTGCAATTACGTGTTTGGTCAATACACTTTTTT
CGATCAAGAACTGTCCGTCATCCCGCCCTTGAACGCGGCCGCCTCGCCCG
TTACCGCCTCGAAATCTAACTCAATGACCTTTAACAACACAAAAACATTC
ACTGTCGAAGTTGACGAAGATTTTTTAGATTACGTCACTGACGGTTCATT
GGCTATTGAAGTTTACGGTAACCGAAGTAGAGGATATGACACCAAACCAG
CTCCGTTGCAATTGCCTCAGGAAATGGATAATAGTAAATCACTTGTCGAC
AGATGGAGAGAGTTATCGCGGCAACTCGAATTATGGGTCGAAATCCACGA
GTTGAATGAACAAGGTTTTTACTCGCCTGTCGAGTTACTCCAACGTGAGG
GACAAGAGGCCGGCGGTGTGTTTATGTTACGTCAAGGGTATTCACGCCGT
GTCGTGACACAAGTCGTCGTCCCCAAACATAACAGTCAAGGATCGCAAGG
ACTTTTGCCAGTTGTTATCGAGTCCATTTCGAACGTTGCTGTTGGAAGTG
TCACCGTCCGAAATAAAACACAAAAGGGACTTGACAGTTATCAAGAACGA
GATTTACAGACCTTGCGAGATCGTTTTTCGAATTCAGTGATGAAAAAGCG
AGAATATTTGGATCAACAAATCCAAGAGATGATAAATAAACCaaACAAAT
CCCAAGAGGACAAAGAACACGAGGGAATGTTGATCGACCAATGGGTGTCC
TTAACTGAAGAACGAAACGCCATCTTGTGTCCGAATACTGGAAGTGGCGT
GCCTGGTGCTACCAGTGAATGGAACCCGTTACCGGGAATGGAAACGCACA
TCCCTGTCATCTTTTTGGACCTGGACGacaATGCATTGAGCGGGTGTGGA
GACATTGATGCTGAACCAGCCGGTCATCATTCCTTCCTCTCTTTCGAACA
ATCCGACTCAATCATTGGTCTCCCGATTATGAAATACGATCAGAAACGGG
TCACAGCAACTGCTTCTTGGGATTCGTCTATCCACGATTCTGTATATTTG
AACCGGGTGACACAGAATACGGAACGGGTCTACATTATTTTGAAGTTAAC
ACTACGATTGAGCAGCCCGGCTTTGGTGAACATTGTATTACGGAAACGTA
TCTGTGTCCGTATGTACAAACGCCCAAGTTTGAAGGACTCCTTAAGGCGG
AAGTTTTGGCGTCAAACCAATGTGCCCACCCGTTGTGGCGTACGTTTCGA
ATTGATCTCGCACATACCAAGGcAATCGGGAGAACAGACGGAAGAACGTG
AATCACTGGCGCAAAAAGCAGCAGAAGCAATGCATGTCGGGACAGATGGG
GAAGAACTCATGGATGGTGAAGCTATCGATAAATATAATAAAGGGATTTC
ACACGTCGAGAATATTTTGAATCTTCACAAACTTCGTCAAGAAGTCTTGG
TCAAAGAGAAGCTGGCAGCTGTTGGAAGGTCCAGTAAATCACTGACCAAT
CGGAACATGAGAAAATACGCAAGCACACCTAATCTTTTCAACGCTCCGAG
TATGTCAAATTTATGGCGATCACAAGCGTATCCATCGAATAGTGATTTGA
ACAACAGTGAACTTGCACCGTCCAGTGGTCTCAATGGAATGAACGGAGAA
CTAAACAAGAACCGAAGCTCCAGTCGTGCAAGTTCGGCGGGCGATTATTT
GCGCGCGCGGCAAACAAACCAACGAGCCAAATCACAAAACAATCGGTATA
GCGTCGGCGCATTCAACAGTCCCTCCCAATCCCCGCGTATGGCTTTACGA
CAATACGATATTGATATTGACGGCGAATCGGCGGGTCGCACGACACCTCC
GCGTGACCGCTTGGTCCCGCGTAATAACACCACACCTGTGTTACCATCTT
TAGTGGAAAGCTCTCCGACAACGACTGAGCCACCACAGATGGAACTATTA
ACCGCGAAACAGAATTTGAGCCGAACGAATTCCAAATCGAGTAATGCCGA
CACTGATGACGATGAGAAACCGACCATCATTGTCGGTGACGAAGAAATCC
CGAGCCCTCGATTAAAAGTCGGTGATGTTGTCAAGATTACCGAAAACTTG
GAAGGGCAAGTCCGATTCTACGGGAAAACTCAATTCGCTGATGGCACTTG
GGTCGGAATCGCCTTAACTGTACCCGAAGGTAAAAACAACGGTACAGTTC
AAGGAGTTAGTTATTTCAATTGCGATCCAAATCATGGGTTATTCATACGC
GCTGAAAAATTACTCAAAAgttgatgaccaaaatgttattATGATGATAT
TGTTGTCTGTCGGTACGTCGCCGTACGTCGCCAATGCTGGAGAAGGTATA
TAACGGGAATACGTCGTGACGGTACTCCCGTCGCTAGCCGTTATTTTACA
AATTCTTTCCCTTATGACGTTTGTAAAAGAGATATTTTCGATTCCAATTA
AATTTCACTTTATAACTAATTATGTGACTCTATGATGGATATTTAAATca
tgattttaaaaattctatCGTTGCATTGTTGGAGTataaataataatgtt
ttagGTGCTTTTAAATTGTAAAGAAATGGTTCATCtaccattttgatgac
gtcattatttcttggttttgtgacgtcatcattgaCAATGTCTCTTATTG
GTTAGTTGGTCGTATTAAAATAATACGCGCTTCAAGAGAGAGAGAATAAT
TTTATTTCTGTACTGTATAATGTagtgttgttttatttttaaacgaATTT
GTTTCATTTTACTACGATACTTACGTAAGAGACAAATATATATGAATAGG
CTAACAAATTTGAATCGGAAGgcgtaaaatcaaga
Run BLAST on NCBI

transcript from alignment at sc0000001:544789..591162-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000166 ID=TCONS_00000166|Name=TCONS_00000166|organism=Clytia hemisphaerica|type=transcript|length=46374bp|location=Sequence derived from alignment at sc0000001:544789..591162- (Clytia hemisphaerica)
AATACAAAAAAAGCGTAACATTCTAAAATGGTAGTGAAGCTACGGAGACT AGACTAGGTGAAGCAACTTGACACAGAAATTTTGGGGAAACTTTCTGTGT GCCAACATGATGACGTAAAGACTCTAAAGATGGACCTTTGTATACTTAAA CAATTAGTTATGCCAACTTGATCATGAACTTAATAATCTGGTAGAAAGCT GAAGAAATTTGGTTAATAAAGCACGTTTTTATTTACTTTTGTTTTTTGAA TGCACCAAAAAGTTTTAATTTTTGATTTACCGTTGATTCACGATTTACAC CGTCCAGTCCACCAAAGATTTAATTTATCCTTGCTTCAAAATTGATTACA AAAGATGTCTACCAAAGTCAAAGTTGCAGTACGAGTCCGTCCACTCAACA AAAGAGGTATAAAAGTTTAAGGTGGTACAACCTACTTTCTTTCTGTCTTT AGTTTGAGCTTTTTTCTTTAACCTTTCCAGCCCAAAAGAAGGTTCTAAAA CATTCACCATAGGTTCCTAAAGATACCTGGCTATGTTTTGAAAATCAACC ATAATTTTGATGATAGTCCTTTCTGTCAAACTTCGCCTCACAAAAATGCG GGAGAGCTCCAAGTCGGAGTATTTTTCCCTGATAATTAAAATGGGTGTGG GTAATTTTCCCACTAAATCTGATTTTGTCAGAAATATATTTGGGGAAATT TTCCAAAATTAGCCAATTCCATTTTTTCAAAATATGAATTTTTTTCTCAG GAAATTCGAAATCGTTTTGGAAATGTGGGAGTTGTGTGAGAATATCCTGA AAATAAATGTAGGGGAGAGTTCAGGAGTTGACAGCTATGCCTTTAGGAGA TGGCACTACTGTATACCGTAGAGTCGTCTAATCTCGACATACGTCTTGCA ATCTCGACACCGGATCTGTAAAATAATCAAAACAAACCTTGAATGAAATT CTTGGTATCATTCTTATTGAACAAGTTCATCCATCAAACTAGAAGTTCAG TAAACATTGCAATCCTTTCAATTATAAAAACAGCCAAATTATAAGCAGTT TTACACAACACACGAAACGCATGCAACTTCCTCGTAACTTTCTCGTGTCC ATCATTAAAATTTTACAACTTAATTACGCTTCAAGTCACGTGATAAAAAT AATTCGCGCGCTTAGCCTGGTTTCCCATTCCTTTTATATAAAAACACACG CTCTAGGCGCTAACAGGCCGCACGCCGTGATTGCCAGTATGGCGGTCACA TTAAATTCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACGGTAAAAATGTCTACT AAAAAATTCCTCGCGTGCAAAATGTTGTGTTGTTGTGATTTGGACATCTT CGTTGAAAGTATGCTAATTAGTTTTTAGCGGCTACTACATCGTTAAAGTT TTCTTTTCAAATATAAGTAATAACACTTCACATTTCTCATATTATATTAA CAATCTGTGACGTGATAGAGAGAGAGTACATTTNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTTGGTATGTATTTGTTTA TGTTTGATTTTTTATTTCGAAGACCAGCCTACAGCTATGTCGAGATTGCA AGACGTATGTCGAGATTAGACGACTCTACGGTACCAATTTTGTTTGACGT TTGCCGTCAATTTCAATCGATCTTGACAAATTTTATCTGAAGTTCTAGTT ACTTTTTAGTTCTAATCAAATCAAAATGGTAGTGTTATCTCTGAAGGGCT TTTCACTCCAGTCAGGACCTCTTTGGTCTTTTTTAACATTAGTTCGGATA TAATAAAAACATACCTGATCAACACATCCAAACCTTCTGTCTTGCGTTTA CTCTTTCCTTCCCAACAACTTTCGTTTTTGCTTATGTAGGTTTTAAAATC CACAAGTAATGAACCTCTTATAGCTTTATNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGCTA AGACCTTTGCTTGAAATCGAAAGCGAAACCAAGATTATTTAGCGCACACT GCCGTTTGCGTAATATCGATAAAGTGAAATGAGGTCCTGACTGCACTCTG TCTGATCTGTTATTAGTACAACCCAGGGTAAGGCCTGAACTGGTTATGGG GCGCTGCCCTTCTTTAGATTATTAGAATATTGGTGAAGACAGCTTTTTCA GTGGGATAACAATAGAAAAAGTGCCCTTTTAGGCCACCAACGTAAGCTGC CCTGCCTTTCTAAAGTATAGCCTGTTTGTCCAAGACAAAAAATTGGTCTG TTTCAGTCAGGAAAAGTGTAATTTAGGGAAAAATCAGTTGGAATTTTGGA TTAGGAAAATTTTAGAAATTTACAGAATGTTTGACAGAAAATATGGAATT TCAAAGAAATTGCAGTTTTAGCTGTGATATTTTAGACGGACCATCAACGC GATCCTTAGATCTCGCTATACAGTCCCTTTTTTTTAAGATGACGGGTGAG TTTATTGAGGTAACTGAGGAGTCATTTTTGGTTTGGCTTGACCAGACGAG TATGGATGGCAGGGATCTATGATCTAATTTAAAAAGTAATGTATTTTGTG GTTCACGATGTTTTTTCGTAAATGTATATACGAAGCATAAATTCCAAAAC TCTGCAAAACCACAATGCAACGTATCTCATCTCATCTTCTTTGAAAAATT ATTAGTTTAAACAAGAATTTTGAACTGTTACTTTGCTTACAAATTATTCT TTAAAGTAGAAAATGCATAGCATATATTATATATTGATAAAAACGCTTTG TGAAAGCTAAATAATTTTGAGGCTGCAGCGGCTTATTTAAAGCTTTCCTT TGTTTGTCAAAAAGTCTTGACTCAATTTCAAATCGTTAATCTGATCCCTG GATGGAATTTTCTGAGTTAATCGAGGTAAATTTTTGGTTTACCATGATAA GATGAGTATGCAGGGATTTTTCTAAGTACTTTGAGTTCCACCCTGACTTT TTTCTGAATTTACATTGAGATTCTAATATGCCTGACAGAGCATCTGCTCA GCAAAGCTGTTTATTGATGAAGCTGAGGGTCTGGGAAATGTTTAAATATG GAGGAGGGGGTTTCCAGTGGATCTAGGGTAAAGCCTTGGTTGGGGTTCAG AGGGGGAAGCTCTTGTAATACATTGAATATGTACATATTGTTGGTTATTT TTGCTTGTAAACAAAGGAAATATTTTTCTATTTTTGATCGAATTTCAAAT CTGGGATTGATTATTTTGACTGTATATATACCAACATAAAAAAATGCTTA GAAAAATCCCCTTAATTCTCCGTAAACATTTGAAGTTTAACACAAATTTT TCAATTTTAATCAAATTTTTATATACCTTATCTTTGGCTTCATCTCTGAC TTATTGATTTCTGCTTGGATTTATTTTTGGGGTATAATACACTTCAGTAT CCTTTAAAAAATTTTAGAAAGGAAAAAGGTAGGGCTCTCCAAAAATGTAC AGGCTTTTTCCTAAAATTCATACATTTTAGATTTATAAATTAAAAGTCGT TGACACCATCCCTACAAATACAACAGAGGCCATGAATAATGAACTTTCAC TATGAATTAATTAGTTAGAGTTACCATTAAAAAAAATTATAATGTATATT ATTATACATAATGTAATAGTCTGTCGTGATCACAATTTCCTCACTCTCCA CTGTCAGTGCATCTCAAACCCTCAGAGAAAATATACAGAAAACACATATT ATATTGGACTTAGTACCAAATTCTGTACTACCAAATACTAAATAAAATAA CAAAAAATGTGTCAAAATAAAGTTTTTTGGAATTTGCAAAAAATAGCTAC ATGGGATTATTTTCTAATTAAGGCCGCTACCCACGCAGCATTTTACGGTT GGCATACAAGGCGTGCAGCTTAATTATTGCATAGATTACATAAATTGAGC GCAACAAGAGTTGAAATTTTTCAACTTTTTTCGCTAGGCTGTGCAGCTTC CCTATTGTTCTTTTTTAAATAGCCAATCAGAAGAGACATTTAACTTTCTT GTACCGTGTGCAAAGGAATTTCAACAAAAGAGAAAAGAAAAAATGTGCAG CACATCTCCCCTTTAATTTGGATCAGTGGAATAAGAAAAGCATTTAGCGA CCAAAGCGCCCGAGCCATGCGGCTTGTTCGTCGAACATAAAATGCTGAGT GGGTAGCAACCTTTAAAAGTATTTGGAGCAAGCTACCAAAAACATAACTT TTTTATTTTTCCATTTTTTTTACAAATGTTCCAGTTTCATTTTGTCTAAA GGGATGAAGATAATTGAATGAGCTATGATGATATATAATAAGCTATAATT GCTCCACGTTCTCTGTGCTTGGTAAATTGATTGGCAGATTAAAGTCTATT CACCTGTGAGTTCCTGAGGGTTCTGCAGAGATGGCTTTTTCAAATCAACC CTGTCCTTGAACTGTTGTTTTTGAGATTGAACGGCAGCACTTAGCTACGA CAGTTCATTTGGATGGAAATTGATTTGGAGTACAAACAATAAGAATGTTT TGGAATGTCAGGAATATTGATGGACGTTTCACAATGTGCCTGAAAGTTCT ATGACATTCCTAAACTAGTAAATAAAAGGAAACAACCAGGATTGCTCAAG CTCAAGAACGTTCTGTAGTGTTCTTAGAATTTTCTTAAACCTTCAAGAAC GTTCAATAGCTTTTGTTGGACCTACCCCGGTGGAGGTCCTATAAATTAAC CTCTGTTCGTCCGTTCGTTCGTTTGTTCGTTCGTTACCAACTTTTCTCAA GATTGGCTCATTAGTTTTTTCTGATTTTTTGCACAAAGATGTGTAGCTAT AAACCCTCGAATGTGACGGAGCCCGATTTTCGAAAAAAAAATTTTTTGGG CAAATTTGGGCGAAAAAACGGCTAAAAAATGGGTATTTTGAAAAATTGGA TCATTAATTTTTTCTGATTTTTTGCATGAAAGTAGGGTACCATCATAGGT AAAAGATGGTTCAAGCAGATTTTCGCAAAAAAATTTTGTTGGCTCAAAAA AGGCATGTTTATCTAAGAATCACTATTAATAAGCATACATCAATGTTCTT AGTCAAATTACTCAATTTTTTTATGAGATAGATGTTTTTTTTTGCTCATG AGGGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNTCATGAGGGCTTACTTTTAAAGAATATGTGTGTTT AGACATAAAATTTTGGTTGCTTGGCGTGATTTTATAGAAAAACTGGCCAA ATTCGATATTTTTTTATAATCTCATTATCAACTTAGGTATTAGCTTTTCT CGAGATTGGCTCTTTCATTCTTTACGATTTTTTGCACAAAGATGCATAAC TATAAACCCTCGAATGTGACGGAGCTCGATTTTTGAGAAAAAATTTTTGG GGTAAATTTCAGCTAAAAAACGGCCAAAAAAAGATTTTTTTTCTGATTTT TTGCATGGAATTAGGTAAAATGGCTCAAGCAGATTTTTGTAAAAAAGAAT TTTTCAGCTCAAAAAACGCATCTTTATCCATAAGAATCACTATTAATAAG CATAAATTAATGTTCTNNNNNNNNNNNNNAGATGCATAACTATAAACCTT CGAATGTGACGGAGCCCGATTTTCGAAAAAAAATGTTTTTGGGCAAATTT GGGCCAAAAAACGGCTAAAAAACGGGATTTTTTGACTTTGTGGAATATTG GATCATTGCTTTTTTCTGATTTTTTTGCAGGAAAGTATGTATAAGATGGC TCAAGCAGATATTTGTAAAAAACAAATTTTTCAGCTCAAAAAACGCGTCT TTATCTACAAGAATCACTATTAATAAGCATACATCAATGTTCTCAGCCAA AATACTCAATTTTTTGATGAGATAGATGTTATTTTGCTCACGAAGTCTTG AATATGAAAAAATATTTCAAAAGCATGAAATTTTGATTTCTAAACGTTTT TTTAAAAGAAACAAATGACTAATTTTAATAGATCGTCAATATTTGTGTTC TGAATGATTGTTTAATGGTCACGTCACGTAGATATCAATTATAAATGTGT TAAATGCATATTCAGGTAGGTCCATAAAAGTATCACTTGTTTTATTTGTA TTCAAAAGTCTCTTGTGAGGACACATTTACACAATTAGATGGGAGTTGGT AGATTAGATCAACTTATATTACTGATTGTTTCTGTTAAAAATAAATTTGA TGACAATCCAATCACAGAGTTGTTTTCAGATTTCAACCAATGAGATTGTC CCATACAAAGCAGATTGCCCGCCAACGTTTTGGTGCTAATGGCTTTTTAG CATCTTGCACACCAGGTCAAGATATAAATATCACCTTTTTAACTCTTTCA TCTCTCTGAGGCTTAGGCTTATTTTTATCATTAATTAATTCTCAATGTAA GAGTTATGCTGTCAATAAAGTGCCACAAAAAATATTTTCTGGTTAGATGA CGCACAATTGATATTATCCAGGGGAATAAATTTGTAGTTCTTCTTCTATT TCTGCATATTGGCCAATTTGATGAAATATAAATTCGAAGTCTTATATTTC ATAGAATAGCTGATTTCTAATTTTGAGAATCCGAAAGATTGGCAACCAAT CATTTTTGCCTGCTTAGGGCTTTTCTCTTTGATGTTTTATTTTATTCTTT GTTGATTGGTCATGTTCATCAATCACTCACAAATCATTTCTTGAAATGAA AACAAAAGGCTTTTTACTAAACTGTCAGCAATGTCCAGGCTACTGTTTTT TGGTTTCAATGGCGGTGAGTTTTGAATTTTCTTGAAAAGTTTTCATAATG ATAATTGTGGATTCAGTGCTGAAGTTTTTTATTAAAAAAAGGTCTATCAT CTTTACTGATTTTTACAAGCAGTAGCACTGTGAAGCTGCAGCACATGGAA TTAAAAATTATTGGAGCACTTACTGTCAATATATCAATATTTCCGTTGGA TTTGAAGCCAATTCATTAGAGTTAATATTTTAAAATTTGGATTCACACTT TCATCCGTTCTCAACTTGTATTGTATTTCTATACTATTTGGTTGTGAGTT TCAGCTGGCCTTGAGGCCCATTCTCGCAACTAGAGATGCTTTCAATAAGT GGCCTGTCAGCACCTTGGACTGACTACCCAGTACCCCTTCACATGGCATG TTTTGCCTTGGACCAAGGTTCATTCACTTGCCAAGTGAACTGTTTCGAAT GGGAATTGATCCTCAGTCACTTGTCACATAGAGAAAGTGTCTACTTTGTA TCTATTGTTTCATCTTCAAAACAAATTTAAAACGGCTGCGTATATTTTTA TTTTATTACAACTGTTAGTCGTTATTATAAGCAAAACAATGAGGAATGAA TACATAGGGCTGGCACAGTCACTTTCGGTCGCGGTTGTGGATGGTGAATT TTGTCGTTCTTTTTTAACGTTGCGAAGTATGCACTTCTTCCCCCTCCTGT GCAGCAACACAGGCCAATGACCACTATACCACAGTTCCCTCTTTCCATTA TCATCATTATGATTTACAGGGTCCTGGTCCTGGCTTTTTCTAAGTTTGAT TTGTGTTTAATGTTTGTTCCTTCTGGTTCCTTTCCAAAACATCCACATAG AAGAATTTACAGGAAAAACTATTGTTTTTTTTTTCTTTTAAATTATCAAC CCAGTTGATCTTCCTTATCTTTCATTAATTATTCATCAGCAGGTTTTATG TTTGAAAATTGCTCAAGAATTTAAATTGGTTTTATTAAGAAGGGGTGTTT ATTTCCACAAGTTTTTAGTTCTCCTCTAATTCTCAGATCAAACACTCCCA AACATGCCATAGTTTTGAATACTAATATAAAATCGATGTTGATCTGAACT TTTTATATCAGTCCTCCTTCATCTAATAGTTTTTAAAACATGATTTTACA GAAAAACTTTAAAACTGGAAAAAAATATTTCTATTTCGTTCCTCTGATTT TACCATAAAGTATAAATGAAATTCAAAAATATGAGATTTCATATGTTGTT TAAAACAAAAAGTACATCTCACATCTGGTACTTTTTGATATTGATTATAG ATTTTTTATTCTTTTTTTTACTATAAAATCATCATGAAAATTAGGTGTTA AAATTTTTGATATTCACTCAGATTCACTTATGATAACACTCAGCCTTTGA AGCTTTTTGAATTTCTTTTTATACATTTTCTTGACAGTGTCAGATAACTT TAATCTGATTATAAAAAGTTTTTGCCTGGAATTACACTCAAAATGACAGA TTTTAGTATTCAAATAATACTTTAATTAAAGAAGTTTAAACCTCCCCCTA AAAAGTTTTCTTTTCTCATTTTTATGTCAAAAGAATCATCATACCAAAAA CAAATACCCAATCTGGGATTTTTCTAAGCACTTTTATGTCCGTATACCGG CCAAAATATTCTATCTAAGATTGAGTCTTTGAAGATTTTTTTCTAGCAAA ATTAACCTTTTTTGTTGTTTATGAGCAACAATGATTATTATCTACATATT CAAGAGTTTTTGGGAGCATCGCCCTCTGAACACCCGTACAAGACCCCCAG TTTCATCAATGTACAGCTTTGTTGAGCTAGTTCCCTTTCAGGCATATTAG AAATTAAATCTAAGTTTCAATCTGCCAATCTGCCAAAATCCCTGCCAATA CCTTATGAATAGAAGGTTTGCCATAGGACTAATATTCTAAATACAGTGGA CTTAGATTTGAAGTTATAGCCGATGCCCAAATATCCCAAATTATGGACTT TTTGTGAGCAATGTTAAACATTAATGATGTGAGGTCACATACGTTTTTAA TCCTGAGAAACTGGGATGATGACTTTGAAGCCAGGTCATGTTTGGATCTC TGGAAAATTTGTGCTTAATTCAGTACTTTTTAGACCTAACCAGATTTTCT AGCCTCTACCTCTAGGGACACTTTTTTTATAAGAAATTGGAAAGTTTTGA TGATAGTCAGCTTTTTTTGGCACTATGAGCCTCAAATTGTTCCTATCTTG TTCTTATTTATAGGATGTAATTGAGGTATTTTTGCGTTATACCCAATTTT TACTTTTTTGACCCCTAAATTGCTTGAAATTGAGTAATTTCAGGTTCAGC ATTGTTCTTAAATTGGCGATTTTGAGCCTCATTCTTCAAAAAAACTTCAT ACTGTGTAAATACAAAAATTATACTTTATATACCTGTGCTTAATTCTCAG CAATTAAACATCAAAGGTTAGTGTAGAAATCCAGTGAGAATGGGTAATAT GCCCTCCCCTCCCCTCCCTTACCTTCAGTTAGATAGTTTAAGTTATCTAA AGGGGAGCCTTCAGGTCGCTTCCAACTGCAGTTGCAAGACACACTTGCTA CCAAAGGTCGTGTTATCAGAACACAAAACATTTTTTTTTATCCAACAACT TTTTCATTTTTTAAAATTTAGTTTATCTTCATTTTTTCAGAGTTGGAAAT GGCCACAGACATCGTCATTGATATGAAAGGCGCACAGACATTTCTTAAAG CACCCAAAAATGAAAAGTAATCTTTTAATTTTGTTTATTTTTTACTTTAC AGTTCACATTTAGTAAGTAGCTTGAAAAACTTTTTATAAATTGTGCCTGC TTTGTATTATCATTTGACAAGGCAAGTTTTAAGGAAGCCTGCTTTTTGTT AAACCTTTCAGTCCCAGAGCTTTTTCACTTATTTAAAGATCAAAAACTCA AAATCTTTGCACAGATGTCTTACTGGACACCCAACAACCAACCTATTTTC TCCAAAATTTCATGCGCTTTCCAATAGTCCAGGAAAGGAGAGTTCCAGGA AACTTCTTAGTTCCAGGAATATAGCCCGTCAAAGCTGGATTCCTCCGAAG GTAGGGACTGAAAGGGTTAAAGAAAATCGGACAATATTTTCAAGGCTTCT GAGAGTTTTCCCACGTTTTACGTAATTTCAAAATTAATCCCTAATTTTTC TTTTTTCTTTCTTTTCATCATCTTCTGCAACAACTTAGAAAGTCACAAAG GGTAAGTTTAGCTTCACTTTGATTCTTTTTTAAGAAGATTCACACATTCA GACATTGTTGTGCCCAATTGTATTTTTAAGGAGCTAATCAAATAGTTATT GATATTTTGGCCTGCTGCAGATAACTTTTGTAGTCCTGAGAAAAACACCT CCAAATCTTTTGACTCAAATATTTAAACTGTTTATTGAGTAATTTGCTTT TCAAATTTCCAAAATTGAGCCTTTTTCACTAGCCTTTAAGATTGTATTTC CATTATTTTTAAAATACAAAAAAATTTCATTTCACAATTTCTTTTTTACT GATTTAGCTTCTTAGAGGCATTTTTCTTTTGGTGATTTCTGTTTTTTTTT TCAAAGAATTTTGATATTGAGATGCTTACTCAAGGCACCACACCTGATCT CAGACTTCGGTTTTCAGCTTGTCACTTCCTTTTGTGTCTTGTGAATTCCT TTGTCATTTATTCTCTGTACTATTGTTATTTTTTATTTTTTANTTGTCAC TTCCTTTTGTGTCCTGTGAATTCCTTTGTTATTTTTTTTTATTTTTTGTT ATTGTATTTTATATCTTTCTTCCATAATGCATATTGTTTTTGTTACAGTT TGTCATGGTTGTCGCTAGTTTGTATCTTCTTTGATATTTATATAACTTCA CTTTGTTTCTTTAGACATTCGCATATGACCATTGCTTTTGGTCTATGGAC CCAAACAATAAAGAAAAATTTTCAAGTAAGTCAATTTAAACTGGTTTTCT GCTATGCAAGGATTTTGCCAGAAATGTCAACTAACTCACTGTATGATTGT TATTTTTTGCAGTGTTGCATGCACATTGTTGAGGATTTTAAAAATATTTC TTGTCTATTCTTTTTCTTTCGGTTTAAAGAATATGTCAATGCCTATAAGC CTCCCCCCCCTCAGTTCACATATATTTGGCGAAAAATTCCAATATTTAGT TAAAAAATGGGATGTGTTCATATAAAAAGCATATGATTAGGTTTGAACTT CAAGCCTAAAATTATTTTTCTTTTAACCCTTTGAGTGCCAGGGTCCTTTT TTCTAAGTTTTTTTTAAAAAATCGCTAGTTCAAACTTTAAGGGCTTATAT CTCCTGATCTAGAAGGAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNACGATTTCTAACTCAAACTGGGCATTA CAGGAGGGCTTCGCCCTCCTATATAGCCCATGTCGTATATATACGACATC GGCACTTAAAGGGTTAAATCTTTTAATTCTTGATCCCTTGCTTCCCCTAT TGGCCAATTTTAATGCAATAAGGAGGCCATACTTGATATTAGCATTCTTT TTATTACCCTTGTAATCTATTCCAAATCAAAGTTAAATTGATAGACCTTT TCATAAATTATGTCACCAACATGACTTGCCTCGTATTCAAACAATTTCCA TAGTGATCATATCCCTTGGGACATTAAATGATTTTTTATAAATAGAAAGT AGTTTTAATAAAATCCGCTTGGAGATAATCACCATGGGAATAATTTCAAA ACGAGGCAAGTGATATTCGTGACGTAAATTATGAAAAGGTCTATCAATCA AAGATTTTACCCATATAATTTAATCAAAGTAAGAAATGATTATAATAATG ATTCTTTTTATCACCCCCTTTCAGGTCAAGAATACGTATTTTCATGTCTT GGGAATGATGTCTTAGATAATGCATTCAATGGATACAATGCATGTATCTT TGCATACGGACAGACAGGTATGTATACCTTGCCTTTCTGTAAATTTTAAG GCTTTATAGATTCTGAAACACTCCTAAATTATTCTTAAGACGTTGTATAG AAATACTCACAAAATAGTGAAAATAAGACCATTTCAAGACTTTGTAATGC TTAAAAAACTATTGACTTTAGTTACACGGTCTTTTCGAGCTGGGATACAG GATAAACAGGGCCAGTAAAGACCGTATTGGTGGCGAGGGTTGCCGAGTTT CATTCGAAAGCGCATTCGTCAATATGCAATATATCTTCTCTTTTTCTCAA TCGAACGTGAGGAAGACAGATACGGTATATATCCCACCTCCACGTGATGT CTTTTGACCAATGAAATCGCGAGATAATGACATGTATACCATGTATACCT TGTCTTACTGTAAATTTGAAGCAACAAGAGTGATTCCCCTAAATTTTTTA AAAGTGATTATTAAGTAAAAGTCAGGGATACTTGGCTTATTTAAACTACA TGTTTTTATAAGAACATCCTTGAAAATCCAAATTTTTTGAAGCCTTCAGA TGTTCTTAGTTTGAAGCCTAAAAATGTTCTTAAATTGTTCTTTTTAATTT CGCCATTTTGTAAGTATGTTTGTCAATTTTTGAGTGTTTAGAACTCGTAA AGCCTTATTAAAATGTTCTTAATTTGTTCTTAATATTTTGGCCATCGAAG CAGTATGTTCTTGTAAAAAATGAACGTGTAGGACCACAAGTCATGGAAGG TCACTTATGTAATTCAGATACTTTTGAAATATCCTAGAAATAGATGGGTA AATGGATGGATGGATAGAGTCAATATTTTGCGTGGATAGCCCAGTAATCT ACTACTTTGAAACGATCTTTTCAATTGTTATTACGGGGTCAAGAACCAGC ACGCTCGGCTATCTATGTACTGCGAGCGGAACATTAGAAGGAGCGCGGAC TCAAACCCATCGCTCCTACGTACAAAATTAAATCTAAATATTCAATGTTT CTTTCTCCCTATTTTCCAGGCTCTGGTAAAAGTTACACTATGATGGGTGC ACCTGGACAAAAGGGACTCATACCCAGGATTTGTGATACACTGTTCGATA AAATAAGTGCAGCTGTAGAAAAAGATAAAAGCACAACTTTCAAAGTTGAA GTATCGTACATGGAAATTTATAATGAAAAAGTCAGAGATTTATTATGCCC TAAAAGGTATAATTATGAGTTTTTTAGGGGTGGGGGTTCTAATTGGACGG TTAATTTTATTTAAATATCAATTTCCTAGTTCAAAATATGATTAGATGAA ATTAGGTTTGATTTTTATACGCAGTCTCTTATTTTGAACCTCTATTACTC GATTCGCTATTCTGAAGAAATTTTTAGGTCCAATTTAGAGGAAAAGTCAA TTTGCTCTCCTTTTTTATTTTCAGCGACAAACACAATTTAAAAGTGAGGG AACACAAAATACTTGGCACATACGTGGATGGTTTATCCAAATTACTTGTA CATGGTTATAATGTAAGTCAAAATGTTTACTCTTAGGTGCTTGATAAATG AGGGGGAGGACCTCTCATACCCCTCAGATACGTTAAATATCTGCTTTAGT GCACAATGAGAAACCTCTCTCTTGACAGCATTGACGAGCAGCCCAATATA GTATATTTCCGCATTTCCTGTCTCCCGATCATTTTAACTTTGAGTGGAAT CTCTGACATATTTAGCATCTACCGGGTGCGCCACGATAAAGTTTCTCTCT TTAAAGTTAACTTTCTCGAGGTCTAAATAGATTAAAAGAACCAATATTTT CCGTTGGAAAGAGGAAAGATAAACTTAAATTTTGATGAGTCATTTATTAA ATTTGGTTGTTAAATTTAGATCAAAAGTTATGGTCAATTGAATAAAAAAA TTACTTTCAGAGGGACCTCAAAAACGTTGAAAATCGACCTATCCAAATGT TCGTTCTAAAATAAGTATACACTCTGATGCCATCATACGCAGCAAGAATC AACCTTTACCTCTCATATGCTGGGCAACCACACGGATGTCTTGCATTCCC TGGTCTAGCGACCAGATCGAAATCAATACTTTATTTATACATTTGTTTTT TCACTCACAGGATATAGAAAATTTAATGAGCGAAGGTAACAAATCGCGTA CTATCGCGGCAACCTCTATGAACGCAGAAAGCAGTCGATCACATGCTGTG TTCTCTGTTGTCATGACGCAATCACAATCGGATGAAGCCACCGGAGTAAG TTGTTTATATCTTTTGTGTTATTCAAACGGTGTCCCTACTGGCCAGGCCA TTTTTCATGCCCTTTTAGAGTCGCTGTCTCTCCTGAAATCACAATAATTT TGGTAAAAGCAGTCTTTTTAGCCGAAAAACACAATACAAAGTGTCCTTTT TGACCACCAACGGACGCTGCCCTGCCTTTCTTAAATGTGTCCTGTTGGCC CTTTTTACATCAAAGGCATTTATTTGTGAGGATATCCAGCATTTACGTGC TGCAGGAAAAAAAACAAATATTTTTGGACCTACCCCGGTGGGCTGTAGGT CCTATAAATTAACCTCTGTTCGTTCGTTCGTCTGTTCGTCCGTTCGTCCG TTCGTCCGTTCGTTACTAGCTTTTCTCGGGATTGGCNNNAGCTGTACTTT ATATTTTTTCATGAAATTTTGCACACTGATGCAAAATGACAATACCTAAA ATGTGACGGAGCCCGATTTTCGAAAAATATTTTTTCCCGGCCGAACAGGG GGGGGGCACGCAGTTACTAGACATGATGTGTAGTAAGTGCTTTTTCAACA CTTTTTTTCAGGACCACCACCCTTTGCAGTTACTACACCTTGGTAGTAAC TGTTTTCTGAAAAGATTTCCAGGTACCACCCCTGTTTTTGAGTGATATCA TCAAAAACATCTCGAAATTACCCTAAATTGCGATTATTTTTCAACCTAAT ACCATTTTGTGCTAGATTTTCTTTTAATTTACTTGTTTAACAGCTGTTGA GAACATTTTAATGATAATTACGGAAAGCATAATTTCAAAGTTGGGTCTGA GAAAAATTTCAAATTTTTTTTCGTCCATTTATAACAAGAATATTTTTTTT AACAAAGAATTTTTTCACAAAAAAATTCATTTTTTGTAAAAAATTTTGAA AGTTCTTTAAAAAGAATCAAAATATAAGCACTTACTACACCAAAAGTGCT AGTTTTAGCGTTTGGCACCACCCCAAAACAGCAGTTACTACACTGTGTAG TAACTGTTTTCATAACTTCTGAATACAGTACCACCACGGTAGTAAATGTC ATACTGTCTTGTAGTACCTGCGTGCCCCCCCCCCCCGGGCCGAAAATGCC AGAAATATGCCGGAAAACCGTTTTTTTTTAACATTTTCTCGAATTTTCAT CTTTAGCTTTTTCTGATTTTTTGCAGAAAGATGCGTATTTGCAATGCTCA AAACATGGCCGAGTTCGATTTTTGAGAAAAATTCTATTCCGGCTGAAAAT GCCGGAAATATGCCGGAAAAACCGGTTTTTTGGCATTTTCTCGAGATTTC ATCATTAGTTTTTTCTGATTTTTAGCACAAAGATGCGTATTAACAATGTC TAAAACATGGCCTAGTCCGATTTTTGAGAAAAATTCTATTCCGGCTGAAA ATGCCGGAAATATGCCGGAAAAACCGGTTTTTTGGCATTTTCTCGAGATT TCATCATTAGTTTTTTCTGATTTTTAGCACAAAGATGCGTATTAACAATG TCTAAAACATGGCCTAGTCCGATTTTTGAGAAAAATTCTATTCCGGCTGA AAATGCCGGAAATATGCCGGAAAAACCGGTTTTTTGGCATTTTCTCGAGA TTTCATCATTAGTTTTTTCTGATTTTTAGCACAAAGATGCGTATTAACAA TGTCTAAAACATGGCCTAGTCCGATTTTTGAGAAAAATTCTATTCCGGCT GAAAATGCCGGAAATATGCCGGAAAAACCGGTTTTTTGGCATTTTCTCGA GATTTCATCATTAGTTTTTTCTGATTTTTTGCAGAAAGATGCGTATTTGC AATGCTCAAAACATGGCCGAGTTCGATTTTGAGAAAAATTTTACCGGTTG AAAATGCCGGAAATCGTCTTTGCAGATTTTCATTATATGTTTTCCTTGTA TTTCTATGTTCTTCACACAAAACATTATTGATAACAATGCTCACCATCAA CAATCAGTGATGAATTTATTGCGTTATACATTTTCGCTAAACGATATATT TTCTGACTGATTTTTTTCTCCTCGCATTGCTATCTAACTTTCATCATCAG GTAGGTCCATTCAGCATCTAGCTTGTTTAGTCTGGAATATATCGCATGCG TTGGCACTATTTAAAAAAGAGCGAATGGGCTCTTCCTGAAAATTTTTGTA CACGGGGGGGGGGGATAGAAATAGAAATTACCACTCGGAAAAGCATCAGT TGACCCCTGGACATTCAAAATTACCCCTAAACAGAGCAAGTTTGCCCAAA GAACACGGCAAGTTTTGAAGATTTTCACAACCTCCTGGACAATACATCCA ATATATCCTCCACCCCCAAAAATTTTCTGGAAGAGCTCAATAACGTTAAA ACTCGTGATTACGGTATATAAATGAACAATATGGTTGTAAATGTAGGACA CACCTTACTGTTTGTTTATAATTTCATCTTCTTGTTATAATTGTTGGTTT CCCACCTGGTATTGAAGCCACCGTACCGTGAATTGCTTATTTCAACAAAA ACAAATTTTTGATAGCATCGATAGCTTTACAAAGCACCTTTGGATCTGGT GTATTGAAAAAAATACTAAAAATACTCAAAGTAAAGTCACCAAAGTGGCA TGAAACTGCCAGTAGAAGAATAAAAAAGTGTCTTTTCTTCTTGACTGACT AAAAAAATAGTTACTTGAATTCTTACTATATTTTTAGCTTGTCGGTGAAA AAGCTGCCAAAATAAGTTTAGTCGATTTAGCTGGCAGTGAGCGTGCATCG AAAACGAACGCGTCCGGAGACCGTCTAAAAGAAGGAAGTAACATTAACAA ATCACTCACAACACTTGGTCTTGTCATCTCTGCTCTTGCTGATCAGGTTA GTTTTGTTAAAAAGGTTTGATTCTGAAGGATTGCTGATTTGTCTGCACCG TAAACCAGAGCCATGAGGTTTGAGTCTCCCTTGCATTCTTACTGTCCAAC TTACAGATAGTGTACGGGAGGGTGTTAGTGATTTATAGTATATGAAAACC ATTCTAAATTCTGTCCAAGTTAACTAGATTAAATGTTTTTTTATTTGTTC ATGTATTTTTTTTCTTTGTTCTTGCCATCCCGGGGATTGGGTCCAAGTCT ACAAGTCCAAGTTCAGAATCTAAATACGTCAAATATCAGATAATTTTGCA TTTCCCTGTCAGCAGCCTTATGATGAGCAAACCAATCCTTATTTTTATTT TTACAGGCGAGCGGTAAATCAAAGAAGTCCAATTTTGTACCGTACAGAGA TTCAGTTTTGACATGGATATTGAAAGATAATCTCGGTGGAAACTCCAAAA CTGTCATGGTTGCCACAATCAGTCCCGCAGGTTGGTTTGTATTCATTATT ATTTAATTTTCCTAGATAGTATGTTATTGTACATCAGGGATACAGCCGCC TCTCCATAATTCAAACACCAAGGGGGGTAGTAATCGGAAAGAATAGTTCA TTTTTAATAAAGAGACGAAGTAACCAGAGGTAACCTAAACCTCTGGCGAT GAACCAGAAGCTGATCTCTGCAGTCTCGAGAATCGATTTATAGAGTGAGT TGAGTGAGGCCTCTCTTCTAAAGAATTTCTTTTTCGATGATTTTCCTTTA TACAATTTTTTGAAGTGTCGTTGTGTTGGTCGCACGGTTCTGATCACTCA AAAACGAATTATGTAATGTTTTTTTCAGGTTCAGCACCTCTGCAATGTCT TCTGACCTTAAGTTTTGCATATTTGCATAGGTATTGGCTAGAAAAAATAT TTAAAGTAAAAAATAATTTGATAGTTAAGTCTTTGCAATGGTCCATATAA TGACTTAGTTCAAAGACGATAGCTACAAAACGTTATCCAATAAAATGGCT TCATTTGGTTTCAGTACGATACGGGACACAGGAATTTGTAATCGTTATCT GAATTCTTCATTTGCATCTCAACTTTCTTAGGTGACAACTACGAAGAGAC TCTTTCAACATTACGTTACGCCGATCGTGCCAAACGTATTGAGAATCATG CTGTCATCAACGAAGACCCCAATGCAACTGTAAGACACTGGCTCTGGTTT AGACGGCGCACTTTTCGCCTTACCTATTCATGATATGCACCACTGGAGAG TCTTCTGAGGATTTTTGAAATATCCCACCCAATACGTCACTTTAACAATA GAAAAAGTGACGTATTGGGTGGAACGAAAACAGAAAAGTTGCATAATTTC NCTTAAACAATAGAAAAAGTGATTTGGTGGAACAAAAAAAGAAAAGTTGC ATAATTTTGTGAAGTCATTGCAGTGGTGCATATCATGAATTCTAATTGTG AATCAAAGTAGGCATAAAGTTAGCTGTTTTTTAAACTCAATGCGTTGCCC TCTTTTGACGTCAATGCAATGACTTCTTTCAATCTTTTTCAAGCAAAGAT TTTAACTGCCGACTACCGTCCCACTTTTTTTCTACTCTAACAATTAGGTC TTCCAAACCTTTTCAAAACTTTCATCATTTTAAGTAGCGTGTCCTTTTCC CTACACGCGATTTTTTTATCACTATTGCGTCAAGGGAAAAGCCGTGGTCG TCTGGTACAGGCCACTTTTTTAGATGCTTGGGTTTGAATTGACGTCAAAA GTTAATGCATTCTCAGGTAAAGTTGACTCTCGGTAATTCGAACTCGAACG GGGGCTCCAATTTGTTCCAGAAAGATTCGAATTAAAGAAAGTATTCCACG AAGTTTTCCTTGTGACGGGAGCTGAGAATTAGTTCGAATTACTTATCGAA AGATTTGAACGATAGAAGTGAGCGAGAGTCAGTTGTACAGACATTTTGCT TTGTTACTTCTTTCGCTTACAACATTAAGTTAAATTCAAGGCACTGTATT CTAGGTATTTTATCAACGCTTGTGGTGTGAAATCTAGCTTGTAAGCTGTA GCTGGCGCTCTCTAATTCGATTTCAAGGGGATTTCGTCGAATAAGGGAGT GTAGTCGAATAGTACAGCGTAGTCGAATAGTACAGTGTAGTTTATATGGT GATATTCAATTATTATCAAATAGTGCATCGGAGCTAATCGAACAGTAGAA CGTCGAATTAGAGAGCATCCACTGTATCTAAAAAAATAAACTTAACATAT ATTTTTCTTTTCCATAGCTGATCAGAGAGCTGCGTGGAGAAGTGGAGAAA CTGAGAGCGCAACTTTTGAAGCACGGTATAGCACAAGATACAGAATCATT ACAAGAAGCTCTTGATCAGAACGAAAAATTGATGGAAGAAGCCTCGCTGA CGTGGGAACAAAAAGAAAAACAAACTGAACGCATTCACCAGGTAAAAGAG TTGACAGACTCTCTCTTATTCGATCACTATATAAGGGCTTAGAAGACTTT TTTTTTAGTTCGAACTTCAATAGATCAATGATATTCCTGTAATATCTAAA CATGATCGGAGTTTTTTGAAAAGTGGTACCCTAATGGCGGCAATACTCAA TAGCGGTGTAAATGCATTGAGAGCGCTAGATCTACCTTCCCTCAAAAACT TTTGATGATGAAGCGCCGTTAGACGATAATTTTCAACACTGCAATGGCTT CTTTACGGGTAACAATTCAAAAAAAACTTCGATCAAAGATGACAGATATA GCTTGATCCAGGGATATATAAAGGTTAGTGACCTCTCCCAGCTCCCGGAC TATAAACTGTATCTAATAACTGACCATTGCTACATTCCAGGAACGGCACA AGATCTTGAAAGAGATGGGTATCAGCGTGCAAGATGCCGGTATCGCCGTT GAGAAGGGACGATATTATCTGGTTAACCTGAATGCAGATCCTTCGCTCAA TGAGATGTTGGTTTATTACCTGAAGGTATGTGTTGTCTAATCAATTCTGA TTAACGCCTAATCTTTTTTTGGATTTTCGAGGGTGTAAACACAGTTTTTT TACAAGCATACAAAGATTTAAAAGTTGGCTCTTAGATGCAAGTCTGAAAA TGCTTATATCATAAGCAAAATTATAGCAAAATTTCCGAAAATCTCTAACA TCCCAGCCACAAACAGCCAAAATCAGAAAATACATTTTTCGTAGGCTCAA GGTAATACTTAGCACGTGCTCACATTTTTGTCAAATATGAGCCTAGAGAA GAGAAGGTAAGTGAGAAAGAAGTGAACCCTCCGAATCATCCGGAATGGGC CCTATCCCTGGATAGATACCTACCCTAGGATAGGGAAATTACCACGCTTA CCAGACACTGCTATCCCTGCGCTCGTGACGCGGCAGAATTATTGGTGTAT AGGCGATGATACTCTGAGTGGGATACTTCTTTTCGAGGTCTAAATGTGGA TGAGCGTGTTGCCCTTCTTTCTGAATATATATTAAACATTGTTTCCAATT TCGTTCCCAATAAAATAAATACAATCAGGGATAAGGATGCGTTGTGGATG ACTCCTGAGCGTAAACAAATGCTCCTCGACAAAGCTAAAATTTATCGCCG GTGGAAAAAGCGGGGGGATCCCTTGGATGAACAGGCACTCGATGATATCT CCAGAAGATCTAGACTGGCTATCAAAGAAGCCAAGGAAAACTATTTTACT CGTCTTGGCAATTCTCTCAACGATCCGTACATCGGAAGTAAGAAATACTG GTCTACCCTTAAACAATTCTTAGGCATGCGCAAAACACCAAAAATCCCAC CCATACGTGATAACAGAGACATCCTCGTNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNTTGACGAAGATAAGATTGAGTCTTTAATAAAATCT TTAAACATAAACAAGGCTCATGGATGGGACGATATTTCTACACGTATGGT TAGGATTTGCGGTAAATTTCTAGTCAAACCTTTGTGCAGTATTTTCAATC TTTCAATTCACTTAGGTATCTTCCCTTCCCAGTGGAAGAAAGGAAATGTT GTTCCTGTTTATAAAAAGGGGGACAAAAGCATTGCTAAAAACTACGGACC AGTGTCTCTTCTTCCAGTGTTTAGCAAATTATTTGAAAAGTGCATTTATG ATGTACTTTACAAGTTTTTTTGCAAGCAACAATCTTTTTACTTCGTGCCA GTCAGGTTTTCGGGAGGGTGATTCTTGTGTCTCTCAGTTGTTGTCCATAA CGCATGACATCTTTACAGGGTTTGACACTGATCCACCTTCGGACACGAGG GGAGCGTTTCTTGATATCTCAAAGGCATTTGATTGAGTCTGGCATGAGGG TTTAATTTACAAACTCCAATCCTACGGGGTAACTGGTCCCTTACTTTCCC TTTTGAGAAATTTTCTATTAGGTAGGTATCAGAAGGGAAGGCAGGAGTTC CTCAAGGCTCAATTCTTGGTCCTTTGTTTTTTCTAATCTACATCAACGAC ATTCCTAACAATCTCGAGACCAAGGCTAAAATCTTCGCTGATGACACGTC TTTATTTTCATTAGTGATTGACCAACTTTTGAGCAGTGAGGAATTAAACA GAGATCTTGCAAGAATAAGTGAGTGGGCTCGTCAATGGAAGATGTCTTTT AATCCTGATCCTACAAAACAAGCTGTGGAAGTTTACTTTTCTAAAAAGGC TCTTACCAGCTAATGCTCCTGTTTTATTTTTCAATAATACTGACATAAAA ACTAGTGAATGTCAGAAGCATCTAGGTCTTATCTTGGATTCCAAACTCTC ATTCAGTCACCATTTAGACGAAAAAATAAAAAAGGCCAACAAAGGTATTN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNTTGGCCTCATTAACAGACTTCGCAAACA TGTACCAAGAAAATCTCTGCTTACTTTATACAAATCTTACATTAGACCAC ATTTAGACTATGGGGATATTATATATACGACCATCCTGGAAATTCGACTT TTGTTCGTAAGCATGAATCCGTCCAATATAATGCCTGCCTTGTTATAACA GGCTGCTTTCGTGGAACGTCTCAAGAAAAACTTTGTTCTGAACTTGGTTT CGAGAGTCTTGCTGATCGTCGATTTAGTAGAAGAATGACCTTCTTTTACA AAATTTTAACCAATTTAGCCCCCTCTTATTTACGTAACTACTTACCAGCA AGACTTGCGGCACCGGGTAATCTAAGAACAAGAAATCCTATTTATCAACT TAATATTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTCTGGCTGGTCGTAT AGGAGATATGCCTTCAGTATCTACCTTCAAAAAAGCAATCCTCGAGTTTC TAAGGCCCAAACCTTCTCCTGTTTTTGGAGCTCATGACAACCAGGGTGTG ATCCTTCTCTATCGTCTTCGAGTAGGATTTAGTCACCTCAATGAACATAA ATTTAGACACGGTTTTCGTGACACCTTAGATCCATTTTGTGCGTGTAGAA CAAATTCCATCGAAAACTCTCAACACTTTCTTTTGCACTGCTCTATTTAC TCTCAGGCAAGACATCTTTTGTTCAACAGACTTCTGAACCAAGACATAAA TATTCATCCACTAAGCCCTCCTAAGCTCTTCAACCTTTTGTTGTACGGTG ATCCAGAATTACCTTTCAACATAAATAACATAATAATTAATCTTGTCATT GTTTATTCTCGACTCTGAAAGGTTTAGTGTTGCTTTATTTTAGTTTAATG ATCTCCTTACACAGCTCTAATACTTTTTTTTAACATTTGTGTTTATCCTT TTAGTGATGGTTTTCCCTTTACATTTTTTCTTTTATTCAATAGCTTAGTA CCCTTGGCGATATCACTTAGTGTCTTGCGGGGGGAGGAGCTATTAATTTT TTCTGTGTTTGTTTTTGTAAGTAGTATATGTTCGTAAGTGTAATGTAGCT TCTCAAGTCATATATATAAAAGAAAAAAAAATACTCGAACTACACGGGAG GACATATATCTTCGCAGGTGTTGAACCTATGAGTATCGTCACCACGCCAC ATGCAATGCCTAGCACAGTCTCCATACTCTTTTACCTTTTACCCAGTTCC CCTCACAAGGCATGGGTTGACCCAGGCGAAGGTACACTCACTTGCCAAGT GAATCACAGCACCGAGTGAGAATCCTAGATGTACTTATAATTAATTACAA TGCTTATAAAAAATGTAGAACGTTTTGTTGTTTGAAATTCCAGTCTCAAT AAGTTTTTCCGGATATCTAAATTTTGCTTTCTTACTGAAATTATTATTTT CTTTAACCAGACCATCCATCCCCCCTTATTTCTTAGGACCATACAAAAAT TGGTAAAAGCGACGCATCTGACCCTCAGGTAAGCATACCTTGTTAAACAA AGTTAAATATTAATGATATGACCGGCTAGTAAAGTTTGAAGAACATCAGA GAGTTAATGTATTTTCACTTATGAATAACGCTTAGTTTTGATCCCAAAAA TCGAGGACGGTAAATGAGCTTCTTTACCATCGTCATCAGTCGATCAGGAT CTAGACAAATCAGAACCTAACCTTCTCCATCGCAGAAAAAACACATGCAT CGCTATTATAACACTGAAGGGTTTCACAACTTATTCACTTTTGTAATAAG TCAATAGTAAGACATAGTGGAATAATAATTTTATTTTCAATTTCAATTTC AATTTCAATTTCAATTTTTAATTTTAATTTTAATTTTAATTTTAATTTTA ATTTTAATTTTAATTTTAATTTTAATTTTAATTTTAATTTTAATTTTAAT TTTAATTTTAATTTTTGTTTTTATTTTCACTTTTAATTTCTTCTGAACAG GACATCCAACTAAACGGTTTGGGTTTACAACCACAACATTGCGTGATCGA TATTGATAACGAAGAAGATACATCCTATATCGTCCCTTTTGAAGGGGCTA GGTAAGTTAAGTGTGAACTAACTTTTTCTCCTACTTTGCTCTTGAATGGT TTTGATTTGACATAGTTTGAAGGGGTTAGGTATGCTAAATGCGGACTCTA CTTTTAACAAAACTTCTTTTCTCCTACATGGTTTTTATAAGAACAAACTA TTCATGATATGCACCATTGCAATGTCTTCCGTTCCACCCAATAGCTGATT GGTTGAAAGTGATGTATTGACTGATTTTACGTCACTTCCAACCAATCAGC TATTGGTTCTGTGACGTAATGTCAGAAGACATTGCAGTGGTGCATATCAT GAATATCAGGACATAAGGCTGCGTTGGCCAAAATATTAAAAACAGTTTAA GTTTTTGTACAGTGTCAACAAGAAAATGCTTCAAATTAGTACACTCATAC CTGTGATTTAAAATTAATTAGTAAGCATGCAATTACAACCTGTTTAATCA AACAAAACTTATAATTTTCTCTCTTTATAGAACATGCGTGAACGGTCAAG TGATCACGGAACGCACGCAACTACGACACGGTGACCGTATTCTGTGGGGA AACAATCATTTCTTCAGAATCAATTGTCCCCACTCTCCTCCACCACCAGG TTAAAAAGGCCATAATTTTTAAATTCAAATCAATGGAAATCACACGGGAA ATGTTTCAGTTACTTATTTTCCTATTTATCTTTAAGTCTAAATCAATAAA CCTTTTCAAAATATTGCTATATTGCTTATAAGACTCAAGGGATTAAATCA CTTTGATAATGGCTCCGAAACGAGGCAGTCATTGCACTCAAAGTGATTTA TGAAAATGCCTTGATAGAAATCAAACGGGCAATATTTCAATTACTTATTT TCTTGAAAAAAAGCCTTGTGTCTTGAGATAGTTTAATGTATAGTTTTGTC TTGCTACTGCAATCGGAGACGACCCCAAAGCGCCTCTAAAGCGCCTCTTT CGACCCGAAATGTGCCACTCTTTCCTCCTTGAATTGCTCCACTTATTCGT TTTTTTTAGTTGCAGTATCAAACAGAGAGGCAATAAATGATTTTTTTAAA AATAAGTTTAGAGTTTTTGGTAAAACCTTGTCAGGGGTTGAGCCCACTGC CCTGCGCACCATATTAGGATGCTCTACCTTATCCGCCCGACGAAGCTGTA GCTTTTAGTAGCCAAACAAGTTTTAATCTTTCTACTTTCTTCTATAGGAA CGCAATCAGAAGAAAAATTGGATTTCGATTTCGCACAAAATGAATTGATG CTGAACGAATTTGATTCGCTTGGAGGTATTTAAATTATTCTTTCTTAGAA ATCTTGTGTTCTTTCTGTATTTGAACATCACTCAATTGATAACTTAGACA AAACACACACGTGATGAAAAATCTTCAACAATTATATTACTTTTTGAACA GAATAGCTCAAGCAGCAGTAAGAAGGGGTCTTTTGTTGCTTATAATTTAG CATCAATGTTTTAAAGGATAGCATTTAAATTTATCTACTATCGTTTGCTG ACAGGGCATTTTTAAACAAAAGAAAGAACTTCTTTCACTCCCTCCAATGC CTCGTCAGCACAAAATGTTGTGAAATTCTTCATGCTGCTTTTTCACCATA AGAGGCGTGCTTCATTTCTTTATGTATCATTTCTTTTAAAACTTCGTAAG ATGAAGCCCAAGAACAAAATTCCGTATCGTTAAAAAATTACAAAATCAAC CAAAATATCTGCAAATTATAATAAACCAAAATACACTACAGAAGAAATCG TCAGCGATTGGGTATCAACAGTAGATAATTAATGATTCATTTTGTAAAAC TGGCAGTCGAACTATTAGTTTTAAAATTAGTACAGATTTGTACACATTTT TCGACTATATACATTAACATTTAACCTTTCGTTTTTATTTCACATTTTTA GAACCACTCCAGAATATTATCCAACAACTTGAAAACCAACATGAAAAAGA AAAACAAGGTTTGCATTTCATTTCTAGAGATACAGAGATCCAATATAGGT CCTCATGAGAGTATACTATTTGTTAAATGAATCAAAAGAGGAAATGATAG CTCCCGATAGCTTCTTTTTGTGTTTTCATCCTGTGCAAAAAAAAATTTTG AAATGTGATTGTTGCTCTGACAATGGCCTTGTGATTTAAATTTAAGTGTT TTTAAAACGGAACCTATGTATGGCTGTTCGACGAAAGGCGGTAAAAAAGC CCTTTATTTTGGCTTCGGTTAACGTTATTCGCTTTCTAAGGGTTACTAGC GAGTGCCCCGCAAAGATATCAGCTTTTCTTTTAGAAGAATTTCCGCTCGA CTTTTTTTCTAGAAGCAAAGCTCATATACTGCGCGGGATAAGTCTAGCTT GCTGTCCCCCTTAGCCTGTAGAAAAGCTCCATAGCGCGAATGAAGACTAA AGAAAATTCCTCCTCTGTCGTCGTGATTTATCTATACTTAACCTCATTAT TGTTCTAAAAGATAACCTAAATACATTGACTCTATCTTTCCAGGTGCTCT CGACCAGCAGAAGGAGATGTACGAGCAAAAGCTAGAAGAACTACGGCGCG AGCGAACGCCTGACACAACAAGCGGCCGCACGNCGAGCAAAAGCTAGAAG AACTACGGCGCGAGCGAACGCCTGACACAACAAGTGGCCGCACGAGTTCA GGGTACAATTCAGAAGATCGGGTTTTGAACTCAACGCCGACCTCCTTTTA TGACAGGTAAGATATTTATTACCATGAATTTTTAATTTCACAGAAATCTA TGCTTTACCTTCATCAAAATAGTTTGGAATAATAATTTCAGTTTCAATTA ATCAAAGGTTAAGTTCATATAAAGTAAGAATCATTGTCATTGTCAGATGC GGTATTTTAGAATTGTGAATTTTCCATATGTAAAATGTTTTAGTTTTGGG CTTAACTTTAATAGGGGAAACACTTCTTTACTTCAATTCTATTCTTTCAC AGCCAACTTTTGTATGAAGAGAGTTTACGTCGCCTGCGTGAAGAAGTGAT CCGCGCAAACGTTTTGGTGCGCGAGGCCAATCAGTTGAGCTCTGAAATGA AAAAGGACGCTGATTTCGCTGTCACGCTTCAGGTAAGATTTTGATTTTAA TTCTTATTGTTTGTCAATATTGTGTATCCTTTCTCCACCTTACACTTATT TACTTGCTTAGATGCTCAGGCCTGCAGGCCCCTTGCTCTTCATGACCAGG GCTTTCCAATCATGACGGTCCATGGTAGGTTCTTCTAGTTGAGCCAGTGC AGAACCAGTATCAACATTCATTTGGTCTTTCCATTATTTTGGAGGTCTTC CATGCGGTCTGGGGTTTGTGAAGTTGTCTTTGAATGCAATTTTGAAAGGA TTATCCAGGTCTCTGCGGATGATATGGCCAGAGCAGGAGAGACGTCTCTT TCTAACGATGTCAACGACGGGGGTGGTGACTCCAAGCCGCCTTACACTAA AAGCTGTATAACAATTACATATACATGGCTCTAAACATAACTCGAACCGT AATAAATAACGCTCAAAATGATTTTCCAGAGTAAGCAAGTTAGTAGGCTG CGTCATATCTTCCTTCGTTTCGAGCGTAAAACTCCTACTCTTCGGCATAT GCTCACTGCTCTTGTTCGCATACGCACTGAGGTTTTGATAAAACAATAGA GAGTTTCGAAACCTAAGCCAATCAGCTGTGTTTTAAACATTCTTTTGTTA AATAAAAACTTCTATCATGTTTAATCCTATTGATAGGTGAATTCCCGGTG GGGGTCACGAGTGGTGGCCGCCTATAGACCAAGAGTAAGGCCTAAAAGCC TACTGCTTTCTATAGACGATATCGGCTTTACATGAAAACTCAGATTTAAC CCCCGAGAATTGCCCACAATGCTTTGCTTCGAAAAAAGTTTACGATGAAA TTCTTTCCACGCAAAGCATTGTGGGTAATTCTGGTATACTTTCCCTTTTT ATTAATTGACGCTCGTGAATTACTTGAATGACTTGGTTTTCTGTAACTTA CATTTCATCTTCAAACGCTAAATATTTTATTAAAAAGTGGTTGATTTCAT TCTTTTCCTAGATCCCAACAGCTACACTATCACAAGCCGCCAGTCAAGGG CCGTTGACAAGCGAAGTAGCGGTCGTAGTGAAACACAAAACGCGTGGCAC ACAAGGTCGGTAGTAATTCTCGCCAAAATAATTTTCACATTTTTTTTAAA AGTTATAATGCTAACATTTAATTTTGATCTAAAAGGAAGCTTATCTGGCA CCCGATGCAGAAATTTTCATTCGACACGCTAAAGCTCTTAAGGTCAAAAA AGTTTTCAAGATCTGGAAGGTTTAGATTACGGAATTTCGCGACCGCGCGT TAAGTAATTTGCAGCGGGAGGTCTGGTAACCCAGCCTTCGTTTTCGGGGA TTGGCGGGTCCAACTGAAATATTTTTAGCTTCATGCACAAGGGTAGTTGA ACCCGACTGGGGATGAGGCACATCAAAGGCTGACTATCATTCCTCTCCTC TCCGGCAAATTGGCTAGCTCCTTGAACGTGGGTGGCTGCCAATCCGCCAT CGGAATATCAGGCAAATTTCCCCTCGTAGAGGAATGATAGTAGATCTAAG GTTACGCATCCCTTGTCGAGTTCAAATGCTATTATCATGAAAGTATTTCG GTTGGATCCGCCAATCACACCAAAAACGTGGGTTGGTTCTGGCAAAATTC TGTAATCCAAATCTTTCAAATGTTGAATACTTCCCTGACATTCAGAGCTT TTGTTTTTAACAAGAGTCTTTTTAGTGATATTTACTACCACACCCTTGTA CTCAAGTTCAAAAGATATGACAATCCATTTGTATTGGAAATTGCTTTAAT TTCTGTAATTCTTTTTTCGACAGTTTGGTCTGTGGACAAGCTTGGTAATA AAATTTATGACATGCGAGATGCTTATCAAACCATCACAGAAAACCCACTA GAGGCTAACCTGGTAAGTTTACTTGTCTGTCGTGTCTTCATAATTCGATT CCAAACCCCTCAGTTTTTCATTATGATTATTTATAAGGGGAGGGGAAGGT TATATCAACTTGTCATACAATGTGTCCCGAAAAAAGTGAACAAATTTTTA TATAAAGTATAATGCAAAATTTTTTGACTTAATTAAGTTACATATTAAAG CTTAATATACTTAATATTTTAATTTTAAAAACTTATTCAATCATCTTGAC AAATGGTGTATTGGACTGTCCCATTAAAAATTCATACGGGGTAGACGAAC CTCATCAATCGAGAAAAGAAATCTTGGTAATGTGTGGATACCCTGGAAAA TCTTTTCATACCTTTAGAATATTGATCACCGATATATTGTGTAAGTAGCC CATAATATTTTAGGCAATACTTTAGTTCGAATTACAGAAAAATTTACAAA AACACAATCATCAACTCTTTAGGACGATACTGATGATGACGGTTTATTTT TCGAAGTGGAATGTCACACTTTGATTGGCGTCGCCACAGTCTGGTTGGAA TGTCTGTATCAAAACGTCCCCTTGGATTATTCAGCTCCGGTCATTAGTCA GCAGGGTGAAGTCTGTGGACGCATGTCTGTTGAGATTAGGAGGATACAAG GTAAGCCAGGCTTCAGGTAGATATTCTTAGGTTCTTGACCTAATAAATTC TGAGGGGGTGGGAAATTTTTCAAAAAGAGAGTAGAGTCGATATTTTACGT GGATGGCCAAGTAACCCAGGACTTTTAGATAGTCTTTAGATTGTCCGGGT GTGGCCGGGTAGCTCAGTCTGTAGAGCATTCGTCTTACAATCCAAGGTTT GTGGGTTCGATCCCCGGTCACCGCCAACTCAGCGGATGGGTAGCTTAGAT TGGGTAATCTTATCTAGGGTAATCTAGGCGGTAAGTTACTAGGAGCTGAG AGAGAGTATGTGTGGCGCTCTACCTCAGCATTCGATCTCCCAGGTCTAGC GCAAATAGAAAAGGGTATAGACTCCCTCACTCCCGGCTCCGCCGACAGCC ACCAGATGAATATACTTACTACTTACTTAGATTGTTTCCACTGAGACCGC CTTTAAAAAAAGTTTGCGTACGTTCTCGAAAAAGTTTTTTTCTGCTTCTT GTTACAGACGAGACGACATCTTTATCACTTGATGGGGACAGTGTCAGCGA TGAAGATGATATCGAAGGATTGGCCATGGGAAGCTCTGTCAAAGTACAGG TAATGAATTTAATTATGTAACTTTCTACAATCATGGACAAAATATTTGAG ACAAAAGGGATTTCCCCGCGAAAATCTTAAACACCACAAATGATTTTTAA AGGCCTTAAACTACAGTTGGAAAGTATGTAGAGTTTAACTCTGAGTGTTA AAATGAGACTTAATATAAGACTTAAGACCTTAGGATCTCAGGATTTAAAA GCTCAAGTTTGCTCCAATAAGGTTTGGAATATAGCCTAGAAGCCACCAAA CCCATTTCGACCATGATTGTAGGTCATATTCACATAAGTTAAAACCACTC ATTTTTCGCACTTGACAGGCTAAATTTCCCATGAGAGTGTGTACAGTTTT GAAGTGGACTAGAGTACGCCATGTTGTTTTCTGATTTTTCATTTTCAAAC CATTCTNAGTGTGTACAGTTTTGAAGTGGACTAGAGTACGCCATGTTGTT TTCTGATTTTTCATCAGTTTTTCGAGCATTCATTTTCAAACCATTCTGAT TCCATGGAAATGAAAAACAACAATGGCAGACTAGTTAAGTCGAATGTGTA ATCTTAACCTGACCTGTTCAGCCAAAAACATTGGAAACCGCGTTGCTTTT TCCTTAAGAATGAAAGTGAAATTCACCCGAAATCTGGATGGAAAACGTTA AAGTGCCCAGCAAACATGGGCAGATTCTCTTACAGGCCTTTAAAGTGCAT ACGTGATAGCGCAGAGTAATCAGAATCTGCTCGGAGATCAGCATGTTATA GTTGTATAATAAAAATATTTTGAATATATTATACTCCTTGGTGCTTTGGT GGTGTTAAAAAGGCAATAAAACCGGTCAATTTTGTTTGCTATTTTCTAGA TTACAATCAAAGAAGCTCATGGTTTACCTCTCTCCCTCTGCAATTACGTG TTTGGTCAATACACTTTTTTCGATCAAGAACTGTCCGTCATCCCGCCCTT GAACGCGGCCGCCTCGCCCGTTACCGCCTCGAAATCTAACTCAATGACCT TTAACAACACAAAAGTAAGTGAACTGTACTGTCAGTGTCTTTCGAATTCA TCGATTTCTTTCTTAGTAGAAATGTCTGTCGTATGTCTAATAATCATGAA GTTAGAGAAATTGAAAATCGGGATAAGACCTACCGTACTACAATATAAAC TACCATAATAATACAAAAGCTTTATCTTTTAAAATTTTTTCCCTCGAAAA TCAAATGAAAATAATTCCGCTAAAAATTAAAGTTTCCGAACGACGAACCA AGCTGGCTGGCCGGCCGAAAATGACTATGCGAGAAATCTTTAGTAACTTA TCGGCCCTTTTTACACCGGCCCTTATTGGCGTTATTTTTGGGCTTGTGGC GTAATAAGGGCCGGCGTAAAAAGGGCCGGCGTAAAAAGGGCCGATAAGGT AGATAAATTACCGGCTTAGTTTTGTCTTTTTTCTAAAGTGGCTGTACCGC AGCACTATTCGAATTTTTGTCATTTTGGCGCGTTTGATTGTTCAGGTAGG TTTTCATTTTTTTCCTGGGATAGAAATTTCAGAACCCAAACAATCTATTT TATTTCCTTTTTCCTTTCCTCTCAGACATTCACTGTCGAAGTTGACGAAG ATTTTTTAGATTACGTCACTGACGGTTCATTGGCTATTGAAGTTTACGGT AACCGAAGTAGAGGATATGACACCAAACCAGCTCCGTTGCAATTGCCTCA GGAAATGGATAATAGTAAATCACTTGTCGACAGGTTAGTATCCTACAAAT GGGCTTTTCCAGAAAAAAAATTTACCTTCATTGTTGAGGATATTGATTTT TCGAAGTATCGAACCCCCTGGATATCCTACTTTATTAGTAAAGTCCCCCA CCCACCCCCAGATATCCACTCTTAAAAACATACTCAACCCCCTTGATATC CTCTCTAATAAAGATGCTTTTTCCACTTTTGAACAAAAATCGTTAACCCC TTGGATATCCGATATCCTCAACAGGGGGGGGGGGGGCACGGACTATTTCT GGAAAAGCCCAATGCACGTTCATTTTATAGACCCTGTTTTTCGCTCCTGT GGATAAATAGATAGAGATAGGTAAAGTCGATATTTCGTGGATAGCCCGGT AATCTAGGACTTTTAGCCAGCCTTTCGATTGTTTTCACGGAGTCCACGGC CAGTCGGTTCGGCTCTCTATGAACTGAACGGAACATTGGATGGAGCGGGA ATTCGAACCGCAAACCCCTGGTTTGTAACGCTGACGCCTTTGACCACTTA GCTGTCAGCCCCTTAAAAAAACTAGAAACTTTGAGATTTTCAAATATGCT TTTTACAATTTACTTGTTATTTTCGTTTTTATGTTAAAATGTGTCTGTCC TTTCGTATGTTATAAACGCACATATACATATTGGTATACGTTGATGGGCC TTTTAAAACGTACAACATCTGCTAGCTAGGATAGAACCATAAAACTTGTT GCAACGAACGGCTTTAAGGCCGGTCTCTGCTTGTGCGCGCTGCAATCGCA CCTTTTGGCTTAAATCCTTTTTGGTTGGAAAAAAGATTACGTAATAAACA TGTAGCGCGCGCTCGAAAAAAAAAGTTGAACACATTTCAACTTTTTTCAA CCGTTACGTCAGATCGCGCCATTGGACTTGCTTCATTTTTCTTTTGACCA ATAGCGTGGAAGTATTGCTCGAAAAAGCGCGATCGAAGCGCGTGCAAGTG GAGACCGGCCTTTATCAAACGTTGAAATGGTTATTCCCCTAAAACTAAAA TGTTACTGCCGCAAATACCTTCCTTCACTGCAGTAGTACCTCCCCTTAAA GCATCACGCCATTCTAACTTGGTGAAACCTGTTTTCAAGATTAAGGTTGA CTAGATAGTCTTGGTCCCGATAACGTAGAGTTGAGGCTGCTCTTATATCT AGAACTTTAAGACCCCCCTTTCGATTGTTTTCACGGCCAGCTGACTTGAC TTTTTATGAACGGAACAGAACATTGGAACGGGCAGGGATTCAAACCAAGA ACCCCGTGATAGGCGAAAATAATTTCGTTATGATGAACCATATAGATGAA CCCATAGTCTGCGGCCGCGTCAGAAAAAGTTTTTTTTTCACCCGGCCGGT TTCCGGAAACACTACATTTTTTTAATTTTCGCCTAAGGTCATAAATTTGT TAAAATAATATTATTAACACTGGGCCAGGTTTCATTGTTCATTTTGAACT GACTATTTTTGTTTTTCTTTTTTTTTACAATATAGTGAAATGCTTGACCG GGTTAACCAGTACAGAACCAGGTAAAAGATCCGCCAAAAAAACAAGAGAC TAACTTATCATCAAAAACTAAAGAAACATGCTATCAAAAACTAAAAAGAA CTTACTTTAACTAAAGCAAACCAAACTACCATTAAAGATTTAATATTAAT TTCATTCTAAATACTAACAGAATCTTTTTCTCACTAAAAACGAAAAGAGT TTCTTATACCTAGTGAATTTTCAGACATGGTTTGCTGAACTTTAAGTGAT AAATCATAGTCTTGGAGTCCCTTAATAAACATCTTGAAACCAATATCACA AGAATTGAGAAATTTGGAAATTTTCAGGGTGTTACAAAGAAATTTTTGAA AATACGATTTTACAAGTTGTTTCGATAAGAACACAAATATAGAATCACAC GCTTTTTTTATCAGAACCAGTAAATTTTGTCTCAGGCTGGACAGCTCTTA ATTTTTTGAAATTTTCCGGCTTAAATGTTCTTACGATGATGCTCTACGTA GTACTATCTTAATATTTCTAAAATCTGAGGCTTAAAATTGTTTTACCACT TTTCAGCTTCGTGTTCTTATAAAATAGTTCTCATAAAAAAAACTTGTACC TAATAACTTAAGTCAAACTGACTTTCTCGACTAATTTGAACACTTGCTTT TAAACACTGATAAATCACTGACACTAACACAAACACATTTAACATCCACT TTAACATTTATTTCCGCTATGTATTATCCTCCATCTACCTTTACTTTAAT TTTCTGTTTTTTCTTATTCTGTATGTTCTTTGCATGTTCGTATATTCTTA TCTTGGAAATCATTTTTCTGTTACTGCTTCAACCAGATTAATTTTCACGA GATTTTATTTCGCGAGCCAAAAAAATCGCTAAATTTTTTGAATTTTATTT TCGTGAAACAGCACTTTGAAGGGTTTTGCGTGATTTAGCTAAAGATCAGT CGATTTAAGTCACAAGGGTATATAAGCAGGGTTTTTAAGCCGAACATCGT AATTTGATAATTTGGTGTATTTCGCGAGTTAGCAATCTCGCACTATATCG CGTTTTTAATTTTCGCGAAAATGGGAAAAAAATAATGCGAAAATAAATCT CGAGAAGAATAATTCAATTAAAGTATATTACACTGCGCTTTCGAGTCTCA GAGAATTTAGGATGTTATGGTTAGCATGTGTTGTTTTTTCATGACTTACG TGTATAGACCTTTTCATAAATTACGTCACGAACATCGTTTGCCTCGTTTT GAAACTATTCACTGGATTTTATTTAAAACTACTTTCTATATATAAAAAAA TTATTTAATGTCTCAAGAGACGTAATTACCATGGTAACTTTTTGAATACG AGGCACGTGATGTTCGTGACGTAATTTATGAAGAGTTTTATTATTTGCAC GGCTTAACTACGTAAATGTGACAACAGAACGATTTTTAGCATACTGAAAA GTTGTCGTTTGAAAGTTCCCGCATCCATCGTACTCCTTGCCCAGTCTAGA TTTATTCTTCGTTCTAATTTAGATGGAGAGAGTTATCGCGGCAACTCGAA TTATGGGTCGAAATCCACGAGTTGAATGAACAAGGTTTTTACTCGCCTGT CGAGTTACTCCAACGTGAGGGACAAGAGGCCGGCGGTGTGTTTATGTTAC GTCAAGGGTATTCACGCCGTGTCGTGACACAAGTCGTCGTCCCCAAACAT AACAGTCAAGGATCGCAAGGACTTTTGCCAGTTGTTATCGAGTCCATTTC GAACGTTGCTGTTGGAAGTGTCACCGTCCGAAATAAAACACAAAAGGGAC TTGACAGTTATCAAGAACGAGATTTACAGACGTAAGCAATTTGTTTTTTC ATAGACCAGTGGTGCATATCGTATTTCATTAAATAAGCGCCAAGATAGCG TTTTTAATGTTCGATAATATGTGGTACTTAAAGGGTTACTAACTACAACC TTGTCGGATGATCTTTAAGAAAACTAAACTCTTCACAATATTATGGGCTT TTAAAATGGGTGTTACAAAGTTTTGCATTTGCAACGAACCATCCAAGCAG TTGATTGTCTAGTGTATTATGATGTATTATAAAGCTTTTTTCACATGTGC GTAAAATTTTATTTAAGACCTTGAAGGGTGGGGAATTTCCCTAAGCTTAC GTAGTGTTTTAAGGCCTTATGTGGAGTTTTCTTACGTTCAAAAAGTTTTG AACGGAAAGATAAGTCACGTAAAACCCTCTTAATCAACAAAAACTCTACA TAATGTCAGGGAAATTCCTTAAAGACAGCCTTACGAACGATTTTCCGTAA GGTCTTAAATAAAATTTTACGTACATGTTAAAAAAGCTAAAAGCCAACAT GACTTGAATTTTAAGAATCTTCAGTTTTCCATTTGATACAATTTCGATTT GTCATTTTTATTTCATTGATTTCCTATTCTCTACTTTTCAGCTTGCGAGA TCGTTTTTCGAATTCAGTGATGAAAAAGCGAGAATATTTGGATCAACAAA TCCAAGAGATGATAAATAAACCAAGTAATTTCTTTTGTTTTTCGTTTGTT TGTCTCTTCTATTGTTTCTTGCTTGTCCAGAGTTTAATAAGTGATTATAA TTTTCCACTGCTGTGATTGACAATTTTCAGTAGATGATCTAAAAGTGTCA GGCCTAAGCAGCGCGGTTGCTTATGAAAAAATGTTTACTTAATAATAACC TTTCCTCTTCTCTATTATTCTATCAGACAAATCCCAAGAGGACAAAGAAC ACGAGGGAATGTTGATCGACCAATGGGTGTCCTTAACTGAAGAACGAAAC GCCATCTTGTGTCCGAATACTGGAAGTGGCGTGCCTGGTGCTACCAGTGA ATGGTGTGTAACATGTGTCTTTCTCTTCCTATCAGCTCTATCGAGAGCTA TTGGTTTTTGTTGAGTGTATCGAATACCGCGTGATTTGATCTTTTTTCCG AATAATAGTCATTTTCACAAAATTTCGTCTTTGCAAACATTTTAAAATAC CAAAACTTTTTGGTAAAACAAACAAAATAAGCTAAAGAGAGGTCGATTCG CAAAAAAACAAAAAATTGCAAAAAAAAAGGACACTAAGATTTATTAACTT TCGTTAATTTTCCATTTTTAGTTTTGCAATGTTATTGTTATCTAAGTCGA AATATTAATAATTTTCTAGCAAGGATAAATTATGATTAATAAATTCTCTT CATCATGTCTCGATCTTGCTTTCATGAATTATTTCCGAAACAGTAGATTG TTTGATCCTTTCAATTATTTTTCAATTTTCGTTGCCATAGGAACCCGTTA CCGGGAATGGAAACGCACATCCCTGTCATCTTTTTGGACCTGGACGGTAA GTTTGCTGCTTATATCTCCTTATGGTGTCTTTTTACAATTCGTCTGGGAA AGTCCCTCAACAAATTCATGGTTTATACAGCGGAGTCTCTATATCTCGAA CACTCACGAGGAATATTGATTTACTCAAGTTAGGGAAATTTCGAGTTATG GAGTAAGGTTTATAAGATATTGTTAGCTGAAAGGACCATAAAACTTATTC GAGTTAAGGACACATTTGAGTTTTAGAGGTTTGAGTTATGGTGACTCCGC TATTTATCGAGCGGCCATGACGAACATCTCATTACTCAAGTGAATGATCA TATCATTTTGTTTGTTTAATGATTCCCAGAAAATCAACACACCGTATCCT CCGTAATGAACCATATTCACGATATGCATCACTGCAATGTCTTCCGACAT TACATTACGGACCCTCCAACAGCTGATTGGTTGTAACTGACGTCAAATCA GTCAATACTTTCAACCAATCAGCTGTTGGATCCATGAAATATCATGAAAT AGAATGTTATTTTAGCCTCGATATTGAGGAGGTCCTGTTTTCCATACAGG AAGATGCTGGCGCCTGTTGGCCTCAGAAAAGCTGGAAAATCAAGCGAGGG TCAAAGAAATCTTGTGTAAAAGTCCAGTAGATCTCTTAATAATAAAACCA TTATAAATCGGTTATCGATCGTAGATATAATAACTTTTTCCGTCTTTTTT TTCTAGACAACGCATTGAGCGGTTGCNTATAAATCGGTTACCGATTAACT TTTTCCGTCTTTTCTTTTCTAGACAATGCATTGAGCGGGTGTGGAGACAT TGATGCTGAACCAGCCGGTCATCATTCCTTCCTCTCTTTCGAACAATCCG ACTCAATCATTGGTCTCCCGATTATGAAATACGATCAGAAACGGGTCACA GCAACTGCTTCTTGGGATTCGTCTATCCACGATTCTGTATATTTGAACCG GGTGACACAGAATACGGAACGGGTCTACATTATTTTGAAGGTATATTTTG AATAACTTGATTTCGTCGTTTTGCACAAGGTGCCACTTCCTGTACAAAGA TTCTCCTGACTTTTCCGGGGGATCTTTCCACTATTTACCCGGGATAACCG GCATGATTTTGGAAAGGTTTTTTTTCTAAAGGTATGGAAATCTTGTGTTT ACTTGCGAAACTGCCTAAATTTCCGAAGCTCACTTTTCAACTACCCGAAG TCCTGGTCTTCTACCAATGTAAAGTTTTCCGTCGAATCTTAGTGCGGGGA GAGGAATTTTATGCAAAACAACGTTACAGAGAGGGAGGGTTGACTGAAAT GTGTTCGAATTAATCCATTAAGTGTCATTTATCCGTAACTTCAAATGTTC ATATATGTTCTGATTTCGAATGCGCGTAGACACCCCAACTGAGAATGACA ATATGGACCGATTTGTACGTCGCTGAGGCACTCGACCTAATGTTTGATTT GTTTCACACGCACAATATAGATTGATCTTTTTACACTTCCGAAATTTATT CATAATATCGTTATGTAATGTTTTCTACGCGAACACTCCGGCTTTTGGCA ATAGACCTTATCGGAGTTTTTGATTTTCCTAAAAAAGCGATGCATTGTGG GATTGTTTCGAGTGTATTACAATAGAAATCTCTTAGGAATTCCTCGAGGG AATTATATTGTAATACACTCGAAACAATCCCACAATGCATCGCTTTTTTA GAAAAATCAAAAACTCCGATAAGGTCTATAGTGGCAAATTTTGAATAATT TTTCTCTAGCTTGATTTGCCACTATTGGCAAAAACCAGAGCTGTGTTTCC GTAGAAAATATTACGTCATGAATATCATGATGACCTTTTGAAGGAGAAAG ATTAGGCCTCGTATGACTTTTTAGCTTTTTGGACCTACCTAAGGTAGTCC TTTAAATTAACCCTTGTCCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTT CGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCG TCTGTTGCCAGCTTTTCTCGGGATCGGCTCTTTAGTTTTTTCTAATTTTT TGCACAATGATGCAAAATGGCAATGCCCAAAATGTGATGGAGCCCAATTT TCGAAAAAAAATTTTTTCCGGCCGANNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTCTGATTTTTTGC TCAAAGATGCGTATTAACAATGCCCAAAACATGGCCGAGTCCGATTTTTG AGAAAAAAATTTTTCCGGCCGAAAATGCCTGAAATATGCCTGAAATCGCC GTTTTCTGGATTTTCATTGGACTTTTCCATATAATTGGTTGTTATTTCAT TCAAAAACATTATTAATAGCAATGCCCACCATCAAGCATGTTTAAATTTT CAATAAAATTGATTTTTGAAGCCGGAACTTTCTAAAAATCGCCGGAGCAG CCGATTTTTGCCGGAAAAACGGTATTTCTTGAATTTTTTGAGCTGTACTT TATATTTTTTCATGAAATTTTGCACACTGATGCAAAATGTCAATACCTAA ATTGTGACGGAGTGCGATTTTCGAAAAAAAATTATTTCCGGCCGAAAATG CCGCAAATATGCCGGAAAAACTGTTTTTTTGGCATTTTCTCGAGATTTTA TCATTAGTTTTTTCTGATTTTTTGCTCAAAGATGTGTATAAACAATGCCC AAAACATGGCCGAGTCCGATTTTTGAGAAAAAATTTTTTCCGGCGGAAAA TGCCTGAAATATGCCGGAAATCANNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNCCTTATAATTGGTTGTTTTTTCATTCAAAAATATTATTAA TAGCAATGCCCACCATCAAGCATGTTTCAATTTTCAATAAAATTGATTTT TAAAGCCGGAACTATTTCAAAAGTCGCCGGAACAACCTATTTTCGCCGGA AAGACAGTATTTCTTGAATTTCTCGAGCTGTACTTTATATATTTTTTATG AAATTCTGTACACTGATACAATATGACAATACCTTAAATGTGACGGAGCC CGATTTTCGAAAAACATTTTCTTCTGGCCAAAAATGCCGGAAATATGTCG GAAAAACCGGTTTTTTGACTTTTTCTCGAATTTTTAGTTTAAGTTTTTTC TGATTTTTTGCAGAAAGATGCTTATTCGCAATGCTCTAAAAATGGCCGAG TTCGATTTTTGAGAAAAAAATTTTTCCGGTTGAAAATGCCGGAAATCGCC GTTTTTGCAGATTTTCATTGGAATTTTTCCTTATATTTCTNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNTTTTCCTTATATTTCTATGTTTTTCACACGAAAACATTATTGA TAACAATGCTCACCATCAAGCATGATTCAATTGTCAATAAAACTGATTTT TGCGACCACAACTTCCTATTTATTTTTTCCCTACAACCCTTCCCCCCCTA TCAACAATCAATGATGAATTTATTGTGTTGTGTATTTTCGCTAAACGCTA TATTTTCTGACTGATTTTTTTCATTTTTCTTTTCGCATTGCTATCTAACT TTCATCATCAGGTAGGTCCATTCAGCATGTTGCTTGTTACATGTGAAAAA AAAAAACAGTTAAAACGTACACTGTTTTAACCAATGATGTTTCTGATCAA GATCATGACCATGAACTCACTAGTCTGAATTTCTTTCGTACTCATTTATT TAAAGTTATCAGCTGATAATGGTTACTGTTTTCTTTAGCCAATCATATCT TACCATTTATCCCATTTAGTTAACACTACGATTGAGCAGCCCGGCTTTGG TGAACATTGTATTACGGAAACGTATCTGTGTCCGTATGTACAAACGCCCA AGTTTGAAGGACTCCTTAAGGCGGAAGTTTTGGCGTCAAACCAATGTGCC CACCCGTTGTGGCGTACGTTTCGAATTGATCTCGCACATACCAAGGGTAA AGATTTAAATTCAATTCTGAATAATTTTTTTTTGAAATGCTTGAAATCAT TGCTGGTCTTATTTTTCGATGTTTTCTAGATACTAAACGTCATTAACGTC TGTTCGATGTTCGATTATGAACTTGCTTCAAAATTGGAAAAGACCTCGAA CTTTTGTGGAACTAAAAAATTTTTTCGAGTTACAGCGACTTATGTTTATA AATAAGGTTTCTTAAGGGACCAGAAAACTTGTTCGATTTAAACCTTTGAG TTTAAGGGGGATTGAGTTATCGAGACTACTGTATTTTTATGAGAACAAAC TATATAAAGAACAAGTTAAGAACATTTTAAGGCTTTATGAACTCTAAAGC ACCCGATTTTTTAGGAAATTGAACAACAATACTCACAAAATTGTGAAATT AAGAACATTTTTAGGCTTAGAACTTAAAAAGTCAAGAACATCCGAAGGCT TCAAAATTTTTTTATATACTTAAAAAATCGTAAATGGAAATATTACGGTA GCCGATATTCATTTTCTTCTTTTTGTAGCAATCGGGAGAACAGACGGAAG AACGTGAATCACTGGCGCAAAAAGCAGCAGAAGCAATGCATGTCGGGACA GATGGGGAAGAACTCATGGATGGTGAAGCTATCGATAAATATAATAAAGG TATGGTTAGAAAGATGTTATTGTTTAATCATGTCCCAATGTGTTGAGACA GGGAGAGTGTTCAAGTCTTAATTTTAAAGGGGTCTCTACAAAAGTCTTGA TAAAAATCTATTTGAAATATCATAGTGCAACTTATTTCATCAAGAAATTA TTTGGCGACCGCAAAGTTTAATATAATTGCTTCACTGTTGATCCGTAAAA AGAAATTTCTCATCAAAATTAACTTCTTCAGGATCTGTATTGATCTTTTC ATAATTATCTTCTAAAAGATTTTGCATTGTTTTCTTTTTCAGGCAAAATT TAGTAGCCCCATGATCCAACCAAATAGGTTTTACGCCAAAAATCTAAAAA CTGCGTTCCTTGCAAAGTTAGTTCCCTTCAGGCAATTTTACTTATGCTGG AAAATCATGTCCCTTCCAAAAAATACCTAAAATCTATTCTCTAATCTTTT TTCTTCTGATAGGGATTTCACACGTCGAGAATATTTTGAATCTTCACAAA CTTCGTCAAGAAGTCTTGGTCAAAGAGAAGCTGGCAGCTGTTGGAAGGTC CAGTAAATCACTGACCAATCGGAACATGAGAAAATACGCAAGCACACCTA ATCTTTTCAACGCTGTATGAATTTCTGTTTTTCTTACAATTTTCCTTCCG TAAATTTCGAAATTTCGTCTTAAGACGAATACACAGGTTGCAAAATAAAA AGTCTGAGGACAAATCACGCTTTTATATGAAGTTTTTATGTGCTTGTTAC ATGACATTTGTTTCTGATCGGTTCGAATTTATTGACACTAATTAAGTTAT CAGCTGTAAGTTGTAAAGCAAGTAACATGGGAATAAAATCACGTGAACTG TTTGAGTAATCACGTGTTTTGACTGCATTGATATAATTTTGCAGCCCGTG AATTCAGCTAAATTTAGATTCGACTCACCTCCAATAAGTGGACGAATCTA AATGAAGAGATCACGAGAAAGTTCTTCTTTAAATTTGGTAGAGACAGGCT CTACCTTCAAATACCTTCAAATTTTTTTTGACGTCGATCAAATCTATCTA TTTCACAATATCATTCTTTTTTCAGCCGAGTATGTCAAATTTATGGCGAT CACAAGCGTATCCAGTAAGTTGTATTTTTCCATCCACTGCTCATTAAGTG ACATCGTGGAATGTCATAGCAACATCAGCTCTCGGATGTCGGTTATTACA TCTGTCATGAATATCTTCCCTACAAAACAGTTTTTTCATTTCTCGGTGTA ACCTTAAGGGCTGCATATACTACACAATATATTGTCGGGCAATATATTGA GAATATATTGCTGAATGCTGGCAATATATTGAAAGGTGCCCGCAATATAT TGTCAGCTCATTTTGCAATATTCCAACAATATAGGGGGATTGTTTACAGA AAGAAAACTCCTTTTTATAATAGAGCACCTGTTGTTTACTTTGTATGCTA CGGTCCGCAAGCAATATCGTTGAATATGGATCACCAATATATTGTGTAGT CTAAGTAGCTCTTTAGCTTTCCACTGTTGTCATAGTTATAACAAATGCTT CATCTTTCTCTAACTTTTAGTCGAATAGTGATTTGAACAACAGTGAACTT GCACCGTCCAGTGGTCTCAATGGAATGAACGGAGAACTAAACAAGGTATG TATGTTAATGATATACAGTTGAACCTCTCTAATTCGACATACGCTCCACA ATTCGATGATATTGAAAGTCACCGTCAAAAAGAAACTGTCACAAATGACG TTCTATTATTCGATATGCTCCCTTATTCGATAATATTGTATTTGGTGATC ATCTAGCATCTTTTCCATTTTTTCCTCATTTAGAACCGAAGCTCCAGTCG TGCAAGTTCGGCGGGCGATTATTTGCGCGCGCGGCAAACAAACCAACGAG CCAAATCACAAAACAATCGGTATAGCGTCGGCGCATTCAACAGTCCCTCC CAATCCCCGCGTATGGCTTTACGACAATACGATATTGATATTGACGGCGA ATCGGCGGGTCGCACGACACCTCCGCGTGACCGCTTGGTCCCGCGTAATA ACACCACACCTGTGTTACCATCTTTAGTGGAAAGCTCTCCGACAACGACT GAGCCACCACAGATGGAACTATTAACCGCGAAACAGAATTTGAGCCGAAC GAATTCCAAATCGAGTAATGCCGACACTGATGACGATGAGAAACCGACCA TCATTGTCGGTGACGAAGAAATCCCGAGCCCTCGATTAAAAGTCGGTGAT GTTGTCAAGATTACCGAAAACTTGGAAGGGCAAGTCCGATTCTACGGGAA AACTCAATTCGCTGATGGCACTTGGGTCGGAATCGCCTTAACTGTACCCG AAGGTAAGACTATGGTCTATCATTTTCCTAAGAGAGAATTAATGAAATCT TCGAATTTTTACTTATTGGTTCTTTGGTCGATTTTCTACGTTCCTTTTTC CAAAAGACCAGCACCTTCGTTCGTACTTATGATTTTAACACGTACATTAA TAACATCAAAAAGAAAGATGTCGCAGGGTACTAACCTTGATTTTCCGGAA AACTTTGTCTCAGGTACCACAACCCTTTATCAAATTTAGACACCGCCACC CGGCTATGGGTCAGGAAAGTAGCCTGCAACTATCCCCTGTTCAAATCGGC CGTTCCTGAGAAAGGGGTACGTTGCGTCACACTCATTTTTGACTGGGTAC CGCCAGTGTGGACCTATGAGCTCCGCGATCAAAGCAGCATTTGATAGCAC GCATAGAGACGGTTCAATCAGGCATAGACTACGATCTCCGATCGTGGTTG ACAATTTCTCCGGATGGCCCAAACGGGGAAACTAATGATTAAATGTTATT GTTATCTTTTCGTTTTAGGTAAAAACAACGGTACAGTTCAAGGAGTTAGT TATTTCAATTGCGATCCAAATCATGGGTTATTCATACGCGCTGAAAAATT ACTCAAAAGTTGATGACCAAAATGTTATTATGATGATATTGTTGTCTGTC GGTACGTCGCCGTACGTCGCCAATGCTGGAGAAGGTATATAACGGGAATA CGTCGTGACGGTACTCCCGTCGCTAGCCGTTATTTTACAAATTCTTTCCC TTATGACGTTTGTAAAAGAGATATTTTCGATTCCAATTAAATTTCACTTT ATAACTAATTATGTGACTCTATGATGGATATTTAAATCATGATTTTAAAA ATTCTATCGTTGCATTGTTGGAGTATAAATAATAATGTTTTAGGTGCTTT TAAATTGTAAAGAAATGGTTCATCTACCATTTTGATGACGTCATTATTTC TTGGTTTTGTGACGTCATCATTGACAATGTCTCTTATTGGTTAGTTGGTC GTATTAAAATAATACGCGCTTCAAGAGAGAGAGAATAATTTTATTTCTGT ACTGTATAATGTAGTGTTGTTTTATTTTTAAACGAATTTGTTTCATTTTA CTACGATACTTACGTAAGAGACAAATATATATGAATAGGCTAACAAATTT GAATCGGAAGGCGTAAAATCAAGA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000098XLOC_000098Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000166-exon-sc0000001-1575043694:590757..591162TCONS_00000166-exon-sc0000001-1575043694:590757..591162Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:580847..580922TCONS_00000166-exon-sc0000001-1575043694:580847..580922Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:579638..579698TCONS_00000166-exon-sc0000001-1575043694:579638..579698Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:578496..578588TCONS_00000166-exon-sc0000001-1575043694:578496..578588Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:577307..577493TCONS_00000166-exon-sc0000001-1575043694:577307..577493Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:577001..577088TCONS_00000166-exon-sc0000001-1575043694:577001..577088Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:576268..576402TCONS_00000166-exon-sc0000001-1575043694:576268..576402Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:573417..573575TCONS_00000166-exon-sc0000001-1575043694:573417..573575Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:572933..573056TCONS_00000166-exon-sc0000001-1575043694:572933..573056Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:572234..572331TCONS_00000166-exon-sc0000001-1575043694:572234..572331Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:570972..571145TCONS_00000166-exon-sc0000001-1575043694:570972..571145Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:570438..570572TCONS_00000166-exon-sc0000001-1575043694:570438..570572Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:566535..566576TCONS_00000166-exon-sc0000001-1575043694:566535..566576Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:565962..566062TCONS_00000166-exon-sc0000001-1575043694:565962..566062Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:565364..565482TCONS_00000166-exon-sc0000001-1575043694:565364..565482Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:564688..564765TCONS_00000166-exon-sc0000001-1575043694:564688..564765Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:564005..564061TCONS_00000166-exon-sc0000001-1575043694:564005..564061Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:563257..563469TCONS_00000166-exon-sc0000001-1575043694:563257..563469Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:562881..563010TCONS_00000166-exon-sc0000001-1575043694:562881..563010Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:561808..561901TCONS_00000166-exon-sc0000001-1575043694:561808..561901Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:561001..561089TCONS_00000166-exon-sc0000001-1575043694:561001..561089Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:560363..560540TCONS_00000166-exon-sc0000001-1575043694:560363..560540Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:559764..559855TCONS_00000166-exon-sc0000001-1575043694:559764..559855Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:558749..558913TCONS_00000166-exon-sc0000001-1575043694:558749..558913Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:558030..558187TCONS_00000166-exon-sc0000001-1575043694:558030..558187Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:554682..554990TCONS_00000166-exon-sc0000001-1575043694:554682..554990Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:553989..554071TCONS_00000166-exon-sc0000001-1575043694:553989..554071Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:553660..553786TCONS_00000166-exon-sc0000001-1575043694:553660..553786Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:553167..553222TCONS_00000166-exon-sc0000001-1575043694:553167..553222Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:552173..552390TCONS_00000166-exon-sc0000001-1575043694:552173..552390Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:548967..549143TCONS_00000166-exon-sc0000001-1575043694:548967..549143Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:548314..548434TCONS_00000166-exon-sc0000001-1575043694:548314..548434Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:547699..547850TCONS_00000166-exon-sc0000001-1575043694:547699..547850Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:547199..547237TCONS_00000166-exon-sc0000001-1575043694:547199..547237Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:546668..546742TCONS_00000166-exon-sc0000001-1575043694:546668..546742Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:545960..546479TCONS_00000166-exon-sc0000001-1575043694:545960..546479Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1575043694:544789..545444TCONS_00000166-exon-sc0000001-1575043694:544789..545444Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:590757..591162TCONS_00000166-exon-sc0000001-1510915933:590757..591162Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:580847..580922TCONS_00000166-exon-sc0000001-1510915933:580847..580922Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:579638..579698TCONS_00000166-exon-sc0000001-1510915933:579638..579698Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:578496..578588TCONS_00000166-exon-sc0000001-1510915933:578496..578588Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:577307..577493TCONS_00000166-exon-sc0000001-1510915933:577307..577493Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:577001..577088TCONS_00000166-exon-sc0000001-1510915933:577001..577088Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:576268..576402TCONS_00000166-exon-sc0000001-1510915933:576268..576402Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:573417..573575TCONS_00000166-exon-sc0000001-1510915933:573417..573575Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:572933..573056TCONS_00000166-exon-sc0000001-1510915933:572933..573056Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:572234..572331TCONS_00000166-exon-sc0000001-1510915933:572234..572331Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:570972..571145TCONS_00000166-exon-sc0000001-1510915933:570972..571145Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:570438..570572TCONS_00000166-exon-sc0000001-1510915933:570438..570572Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:566535..566576TCONS_00000166-exon-sc0000001-1510915933:566535..566576Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:565962..566062TCONS_00000166-exon-sc0000001-1510915933:565962..566062Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:565364..565482TCONS_00000166-exon-sc0000001-1510915933:565364..565482Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:564688..564765TCONS_00000166-exon-sc0000001-1510915933:564688..564765Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:564005..564061TCONS_00000166-exon-sc0000001-1510915933:564005..564061Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:563257..563469TCONS_00000166-exon-sc0000001-1510915933:563257..563469Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:562881..563010TCONS_00000166-exon-sc0000001-1510915933:562881..563010Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:561808..561901TCONS_00000166-exon-sc0000001-1510915933:561808..561901Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:561001..561089TCONS_00000166-exon-sc0000001-1510915933:561001..561089Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:560363..560540TCONS_00000166-exon-sc0000001-1510915933:560363..560540Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:559764..559855TCONS_00000166-exon-sc0000001-1510915933:559764..559855Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:558749..558913TCONS_00000166-exon-sc0000001-1510915933:558749..558913Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:558030..558187TCONS_00000166-exon-sc0000001-1510915933:558030..558187Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:554682..554990TCONS_00000166-exon-sc0000001-1510915933:554682..554990Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:553989..554071TCONS_00000166-exon-sc0000001-1510915933:553989..554071Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:553660..553786TCONS_00000166-exon-sc0000001-1510915933:553660..553786Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:553167..553222TCONS_00000166-exon-sc0000001-1510915933:553167..553222Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:552173..552390TCONS_00000166-exon-sc0000001-1510915933:552173..552390Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:548967..549143TCONS_00000166-exon-sc0000001-1510915933:548967..549143Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:548314..548434TCONS_00000166-exon-sc0000001-1510915933:548314..548434Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:547699..547850TCONS_00000166-exon-sc0000001-1510915933:547699..547850Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:547199..547237TCONS_00000166-exon-sc0000001-1510915933:547199..547237Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:546668..546742TCONS_00000166-exon-sc0000001-1510915933:546668..546742Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:545960..546479TCONS_00000166-exon-sc0000001-1510915933:545960..546479Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1510915933:544789..545444TCONS_00000166-exon-sc0000001-1510915933:544789..545444Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:590757..591162TCONS_00000166-exon-sc0000001-1491911889:590757..591162Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:580847..580922TCONS_00000166-exon-sc0000001-1491911889:580847..580922Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:579638..579698TCONS_00000166-exon-sc0000001-1491911889:579638..579698Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:578496..578588TCONS_00000166-exon-sc0000001-1491911889:578496..578588Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:577307..577493TCONS_00000166-exon-sc0000001-1491911889:577307..577493Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:577001..577088TCONS_00000166-exon-sc0000001-1491911889:577001..577088Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:576268..576402TCONS_00000166-exon-sc0000001-1491911889:576268..576402Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:573417..573575TCONS_00000166-exon-sc0000001-1491911889:573417..573575Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:572933..573056TCONS_00000166-exon-sc0000001-1491911889:572933..573056Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:572234..572331TCONS_00000166-exon-sc0000001-1491911889:572234..572331Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:570972..571145TCONS_00000166-exon-sc0000001-1491911889:570972..571145Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:570438..570572TCONS_00000166-exon-sc0000001-1491911889:570438..570572Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:566535..566576TCONS_00000166-exon-sc0000001-1491911889:566535..566576Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:565962..566062TCONS_00000166-exon-sc0000001-1491911889:565962..566062Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:565364..565482TCONS_00000166-exon-sc0000001-1491911889:565364..565482Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:564688..564765TCONS_00000166-exon-sc0000001-1491911889:564688..564765Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:564005..564061TCONS_00000166-exon-sc0000001-1491911889:564005..564061Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:563257..563469TCONS_00000166-exon-sc0000001-1491911889:563257..563469Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:562881..563010TCONS_00000166-exon-sc0000001-1491911889:562881..563010Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:561808..561901TCONS_00000166-exon-sc0000001-1491911889:561808..561901Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:561001..561089TCONS_00000166-exon-sc0000001-1491911889:561001..561089Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:560363..560540TCONS_00000166-exon-sc0000001-1491911889:560363..560540Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:559764..559855TCONS_00000166-exon-sc0000001-1491911889:559764..559855Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:558749..558913TCONS_00000166-exon-sc0000001-1491911889:558749..558913Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:558030..558187TCONS_00000166-exon-sc0000001-1491911889:558030..558187Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:554682..554990TCONS_00000166-exon-sc0000001-1491911889:554682..554990Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:553989..554071TCONS_00000166-exon-sc0000001-1491911889:553989..554071Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:553660..553786TCONS_00000166-exon-sc0000001-1491911889:553660..553786Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:553167..553222TCONS_00000166-exon-sc0000001-1491911889:553167..553222Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:552173..552390TCONS_00000166-exon-sc0000001-1491911889:552173..552390Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:548967..549143TCONS_00000166-exon-sc0000001-1491911889:548967..549143Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:548314..548434TCONS_00000166-exon-sc0000001-1491911889:548314..548434Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:547699..547850TCONS_00000166-exon-sc0000001-1491911889:547699..547850Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:547199..547237TCONS_00000166-exon-sc0000001-1491911889:547199..547237Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:546668..546742TCONS_00000166-exon-sc0000001-1491911889:546668..546742Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:545960..546479TCONS_00000166-exon-sc0000001-1491911889:545960..546479Clytia hemisphaericaexon
TCONS_00000166-exon-sc0000001-1491911889:544789..545444TCONS_00000166-exon-sc0000001-1491911889:544789..545444Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:544789..591162 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
6.42618 5.57716 3.47904 2.23725 61.9125 47.5282 31.4317 36.5064 20.0974 24.3423 21.3102 20.8979 12.8081 12.0958 10.3101 12.3629 15.1826 15.8958 12.319 10.1032 18.7975 14.6476 14.3569 15.6601 22.5931 21.2644 28.7027 21.6432 4.6804 6.30178
Blast
BLAST of TCONS_00000166 vs. Swiss-Prot (Human)
Match: KI13A (Kinesin-like protein KIF13A OS=Homo sapiens GN=KIF13A PE=1 SV=2)

HSP 1 Score: 721.85 bits (1862), Expect = 0.000e+0
Identity = 366/595 (61.51%), Postives = 460/595 (77.31%), Query Frame = 3
Query:  480 KTFAYDHCFWSMDPNNKEKFSSQEYVFSCLGNDVLDNAFNGYNACIFAYGQTGSGKSYTMMGAPGQKGLIPRICDTLFDKISAAVEKDKSTTFKVEVSYMEIYNEKVRDLLCPKSDKHNLKVREHKILGTYVDGLSKLLVHGYNDIENLMSEGNKSRTIAATSMNAESSRSHAVFSVVMTQSQSDEATGLVGEKAAKISLVDLAGSERASKTNASGDRLKEGSNINKSLTTLGLVISALADQASGKSKKSNFVPYRDSVLTWILKDNLGGNSKTVMVATISPAGDNYEETLSTLRYADRAKRIENHAVINEDPNATLIRELRGEVEKLRAQLLKHGIAQDTESLQEALDQNEKLMEEASLTWEQKEKQTERIHQERHKILKEMGISVQDAGIAVEKGRYYLVNLNADPSLNEMLVYYLKDHTKIGKSDASDPQDIQLNGLGLQPQHCVIDIDNEEDTSYIVPFEGARTCVNGQVITERTQLRHGDRILWGNNHFFRINCP-------------HSPPP-------PGTQSEEKLDFDFAQNELMLNEFDSLGEPLQNIIQQLENQHEKEKQGALDQQKEMYEQKLEELRRERTPD 2204
            K FA+D+CFWSMD +N  K++ QE VF CLG  +L+ AF GYNACIFAYGQTGSGKS++MMG   Q GLIPR+C  LF +IS  +E+++S TFKVEVSYMEIYNEKVRDLL PK  + +LKVREHK+LG YVDGLS+L V  + DIE+LMSEGNKSRT+AAT+MN ESSRSHAVF++++TQ+  D  +G  GEK +K+SLVDLAGSER SKT A+G+RLKEGSNINKSLTTLGLVIS+LADQA+GK  KS FVPYRDSVLTW+LKDNLGGNS+T M+ATISPA DNYEETLSTLRYADRAKRI NHAV+NEDPNA +IRELR EVEKLR Q L    A     L+E L+++EKL++E ++TWE+K ++TE I QER + L+ MGIS++ +GI V   + YLVNLNADP+LNE+LVYYLKDHT++G   A   QDIQL G+G+QPQHC IDI ++ D + + P E AR+CVNG ++   TQL HGDRILWGNNHFFRIN P              + PP           SE   +++FAQ E+++   +S  +P+QN++Q LE Q+ +EK+ AL++Q+ MYE++LE+LR++ +PD
Sbjct:   53 KVFAFDYCFWSMDESNTTKYAGQEVVFKCLGEGILEKAFQGYNACIFAYGQTGSGKSFSMMGHAEQLGLIPRLCCALFKRIS--LEQNESQTFKVEVSYMEIYNEKVRDLLDPKGSRQSLKVREHKVLGPYVDGLSQLAVTSFEDIESLMSEGNKSRTVAATNMNEESSRSHAVFNIIITQTLYDLQSGNSGEKVSKVSLVDLAGSERVSKTGAAGERLKEGSNINKSLTTLGLVISSLADQAAGKG-KSKFVPYRDSVLTWLLKDNLGGNSQTSMIATISPAADNYEETLSTLRYADRAKRIVNHAVVNEDPNAKVIRELREEVEKLREQ-LSQAEAMKAPELKEKLEESEKLIKELTVTWEEKLRKTEEIAQERQRQLESMGISLEMSGIKVGDDKCYLVNLNADPALNELLVYYLKDHTRVG---ADTSQDIQLFGIGIQPQHCEIDIASDGDVT-LTPKENARSCVNGTLVCSTTQLWHGDRILWGNNHFFRINLPKRKRRDWLKDFEKETGPPEHDLDAASEASSEPDYNYEFAQMEVIMKTLNS-NDPVQNVVQVLEKQYLEEKRSALEEQRLMYERELEQLRQQLSPD 638          

HSP 2 Score: 565.844 bits (1457), Expect = 1.123e-168
Identity = 321/732 (43.85%), Postives = 457/732 (62.43%), Query Frame = 2
Query: 2399 ANVLVREANQLSSEMKKDADFAVTLQIPTATLSQAASQGPLTSEVAVVVKHKTRGTQVWSVDKLGNKIYDMRDAYQTITENPLEAN-LDDTDDDGLFFEVECHTLIGVATVWLECLYQNVPLDYSAPVISQQGEVCGRMSVEIRRI-----------QDETTSLSLDGDSVSDEDDIEGLAMGSSVKVQITIKEAHGLPLSLCNYVFGQYTFFDQ-ELSVIPPL--NAAASPVTASKSNSMTFNNTKTFTVEVDEDFLDYVTDGSLAIEVYGNRSRGYDTKPAPLQLPQEMDNSKSLVDRWRELSRQLELWVEIHELNEQGFYSPVELLQREGQEAGGVFMLRQGYSRRVVTQVVVPKHNSQGSQGLLPVVIESISNVAVGSVTVRN-KTQKGLDSYQ-------------ERDLQTLRDRFSNSVMKKREYLDQQIQEMINKPNKSQEDKEHEGMLIDQWVSLTEERNAILCPNTGSGVPGATSEWNPLPGMETHIPVIFLDLDDNALSGCGD-IDAEPAGHHSFLSFEQSDSIIGLPIMKYDQKRVTATASWDSSIHDSVYLNRVTQNTERVYIILKLTLRLSSPALVNIVLRKRICVRMYKRPSLKDSLRRKFWRQTNVPTRCGVRFELISHIPRQSGEQTEERESLAQKAAEAMHVGTDGEELMDGEA-IDKYNKGISHVENILNLHKLRQEVLVKEKLAAVGRSSKSLTNRNMRKYASTPNLFNAPS 4501
            AN LVREAN L+ EM K  D+ VTLQIP A LS    +G + SE A+ V+ K + TQVW+++KL NK+ DMRD YQ   E   EA  L     D  +   E H LIGVA V+LECL+ +V L Y+ P+ISQQGEV GR+ VE+ R+                S       V D    E +     +  ++ IKEA GLPL+L N+VF QYTF+DQ E +V  P+      SP +     ++TF++ K + V V E+FL++++DG+LAIEV+G+R  G  +  +  ++      +++L DRW E++R++E+W+ I ELNE G Y+ VEL Q +    GG+F LRQG+SRRV   V   +H+     G LP+++E+I +V++G VT R+ K Q+GLDSYQ             E DL  +R+R+S++++K+REYLD+QI+++ NK  K+++D E E  L++QWV LTEERNA+L P  GSG+PGA ++W P PGMETHIPV+FLDL+ + LS     +    +G +S L  E       LPI+K+    V+ATASWDSS+HDSV+LNRVT   ER+Y+I+K T++LS PA + +VLRKRI   +Y + S   SL+R+   + N+   CGV +E++S+IP+ + E+ E+RE+LA  AA + + GT      DGE  I+KY +G+  VENIL+L +LRQ V VKE L        S   R++R+  STPN+ N  S
Sbjct:  685 ANTLVREANFLAEEMSKLTDYQVTLQIPAANLSANRKRGAIVSEPAIQVRRKGKSTQVWTIEKLENKLIDMRDLYQEWKEKVPEAKRLYGKRGDPFYEAQENHNLIGVANVFLECLFCDVKLQYAVPIISQQGEVAGRLHVEVMRVTGAVPERVVEDDSSENSSESGSLEVVDSSG-EIIHRVKKLTCRVKIKEATGLPLNLSNFVFCQYTFWDQCESTVAAPVVDPEVPSPQSKDAQYTVTFSHCKDYVVNVTEEFLEFISDGALAIEVWGHRCAGNGS--SIWEVDSLHAKTRTLHDRWNEVTRRIEMWISILELNELGEYAAVELHQAKDVNTGGIFQLRQGHSRRVQVTVKPVQHS-----GTLPLMVEAILSVSIGCVTARSTKLQRGLDSYQRDDEDGDDMDSYQEEDLNCVRERWSDALIKRREYLDEQIKKVSNKTEKTEDDVEREAQLVEQWVGLTEERNAVLVPAPGSGIPGAPADWIPPPGMETHIPVLFLDLNADDLSANEQLVGPHASGVNSILPKEHGSQFFYLPIIKHSDDEVSATASWDSSVHDSVHLNRVTPQNERIYLIVKTTVQLSHPAAMELVLRKRIAANIYNKQSFTQSLKRRISLK-NIFYSCGVTYEIVSNIPKAT-EEIEDRETLALLAARSENEGTS-----DGETYIEKYTRGVLQVENILSLERLRQAVTVKEAL--------STKARHIRRSLSTPNVHNVSS 1393          
The following BLAST results are available for this feature:
BLAST of TCONS_00000166 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
KI13A1.123e-16861.51Kinesin-like protein KIF13A OS=Homo sapiens GN=KIF... [more]
back to top