Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000148 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000148
Unique NameTCONS_00000148
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1770

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000148 ID=TCONS_00000148|Name=TCONS_00000148|organism=Clytia hemisphaerica|type=transcript|length=1770bp
AACAAGTTGATTCTGGGTGATACTCAAGatttacTCAAATTATGTTCATA
CAATCCAATAATGTAACCTAGAACCACTACAATCTCCTTTTGAACCTGAA
ATACCGTAGCTAAAGCGCCATTATGGATTCAACACTTGCTAACTGTTCTG
TTACTATCGATTTGCCTAGCAACGAACGCTCTTGGTATGTTTATATCTTA
GCTTCATTAGCCATTTATGTATCTGGTTTCATCtgcattctgattggtcg
aaTCTTTTGGaaagtcattaaaaaatggcaatTTAAATTACCGGAAGACG
AAAAAGATTCACGGAAGCCGATGGAAGAGTATAAAGCATGGTATTTGCAA
CTGAAAGAGTTCGCTGTCAATCTCGATACCGGTAAAAGTGTACTTGGAAA
ATGTCTGGTGGTGACGTCATTTGTCTTGAACATGGCGGCGTTCATTTCAT
ATCTATTTATTTCATACGAATTCCCTATAGAGTATTGCGACAAGCACGAT
TTCGCACACGGAATTCACACGCAGATCTGGCTATTGGAATTATGTCTATA
CAGTTTCTTTGCTTTCCATTTCCTTCTCAGGTTTATCATAGCGACAGACA
AATTGGCGTTTTGGGGGTTAAACATTTACACGTTAGTCGATATATTGACC
ATTCCAATCGTCATCATTCAAGCATTGCAACAAAAAGCATGGCTTGGATT
GAGATTTCTACGTGTAGTATACATACGAAAATTGCCAGATATTCTCATCT
ACTTAAATTTATTAGAAACGGgGAAATTTATAGAAATTGGGACGGTCGTT
GTGAATTTCATGACAGTAGTTCTTTCGTCGACCGGTATGATACATTTGGT
TGAGAATACAGGTGATTTTTGGGCACCACACAATTATTCGAATAGTAATC
CACtcaattattttgaatgtcTGTACTTCATGATAgTGACATTTTCGACG
GTGGGTTACGGTGACTATTCATGTAAAACAATCATGGGACGCATCTTCTG
CATGATTTTCATCATCTGTGGACTGGGTGTATTTGCATCTTCTATACCGG
CCATATTTGGCTTCATCTCATCGTACACAAAATATGACAGAAAATTCAAA
AGTACACCTGGAAAAAAGCATGTCATTGTAACAGGTCATATAACAGACGA
ATCTGTCAGTTCatttattcaagattttttacatCCTGACCGGCAATGTG
AAAGCAATGTTACTGTTGTCTTCCTTGCACCGAACTATCCGAGTACACTA
ATTGAAGGAATCATCCAAAAACATCCTTCTTCAGTTTTCTTCTTCAATGG
AACTGTATATAATCTTAAAGATTGTCATCGAGTTAAAATGAGTGAAGCAG
ACGCTGTCATTGTTTTGTGTGATAAAAAATCACATAATCCTGAGTCAGAG
GATGCTGCTAATATCACAAGAGTTGTTTCAATGAAGAAATATTTCAGTAA
ATATCACATCCGATGTATCGTACAACTTATGCGTCGAGATAATAAGGCAT
TACTAGAAAATACGACGCATTGGCGAAAAGGCGAAGGTGACACCATCGTT
TGCATCGATGAGCTGAAGTATGGCTTCATGGCGCAATGTTGTTATTCACC
TGGTTTTTCAACGCTACTTGCAAATCTCTTTGTTATGAGATCAAGCGAAA
AAAACAAAGGAAAGAAATCAAACACATGGCGAAATGAATATGTTCATGGA
GTTTCGTGTGAAATTTACTCCACCACATTGTCGGATTATTTTGAGAATAT
GTCGTTCCCAAAAGCTGCAG
Run BLAST on NCBI

transcript from alignment at sc0000001:224278..260797-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000148 ID=TCONS_00000148|Name=TCONS_00000148|organism=Clytia hemisphaerica|type=transcript|length=36520bp|location=Sequence derived from alignment at sc0000001:224278..260797- (Clytia hemisphaerica)
AACAAGTTGATTCTGGGTGATACTCAAGGTACGCGTATGCGCGTTGGTTG TTAAACTAGAAGAGAAGGTCACTCTAATTGTATAAAAGTGAGAGTATCAA AAATTATAGGGTACACATTTGTATGTTTTGGTTCATTACGGTCTCTGAAA ATCCATGAAAAATCTAAAAGAAAACAACAAGAAAGAAGAAAAATAACAAT ACACACATCATTAACCCGAATATTAGTCGACATACCCGTAGGGAAATAAT GCAAACATTTCCTCATACTAATAATAACACAATGAAGTATAAGCCTGAAG GGCTAGAATTTAATCTCCTCGGTAGGATTTGAAGCCTATCAAATCCTACC AAAGATGCTCGGCCTAGCGCGGTTCGCCTCGATTTTACACAAATGACAGA TTGAAACTAAAATTTACACTAAAAACCACAGTAAAAAAGTACATAGTTTA AAATAATTAGGATTACTATAAAGTTTTTAAAAAAATAAGGGAGATACACG TTTTTTTTTTATAAGAACAAACTATATAAGAACCTAAGGCTTCGATGACC AAAATGTTTAGAGCAAGTTAAGAACATTTTGAGGCTTTGCAGATTCTAAA ACACCCAATTTCTTACAAAAATGGATAAAAATTCTCAAAAAATTGTGAAA ATAAGAACGAATATGTTAAGAACATTTTTAGGCTTAAAACTTAAGAAATT AAGAACATTCAAAGTTTCCAAAATATTGGATGTTCTTATTTAAAAAATCG TGTATTTGCTAAGAATCAGAGCCTGAGAAATAAAGTTTCCTTTCCAATCG AATAATTGATACCTGCTGGCATTTCAAAATTGATTATCAATATACAGGCT CAATTATTTTTATCCGATGGGATTACCAATTAAATTGGGAAATTTGTGAT ACTCTCATTTTCTTAGCGTTGAGAAGTATCTGTAGATATCATTGGTTTAG TAAAATGATTGATTGCAAGTTATTACTGTTGAATGGACGTTGTGAGCATT AGATAAACGCTCAAACAATGTTGTACATAAGCTATTCTGTTTTTTTTAAC ACCCCTGTCTCACAGCCCCGGTGGTAAAAATTCCTATTGAAACCCCGATG AGGATAGAAATTCTATTGTTCCATAATCAAGTTGGGATGGTATTAGAGTA CAATTCTTTAACATCTATTTTTGAGTGGGGGTGATGAAATCAAAATCAGT TTCCTACAGTTGGGCTAAAATTCCAGGGTATTTTCCCACTGGGGGTGAAT GTTTTGACAAATTTTCCAGTGGGGCTGGGGTCCTAGCCTGTCTGTGACAC AGGGGTGTTAAAAAAAATGGTTAGGAGATTTCTAGAAAGCGTAAAGTTAA CGCCGTTACATGTTTTCTTTTTTAAGAACAAACTATAGAAAAACGTCAGG CTGGAAGGCTAAAATATTAAGATCGAGTTAAGAACATTGTAAGGCTTAGG ATTTAATTGACAAAATTATACTAACAAAAAGGTGAAAATATGAACATTTT TAAGCTTTAAATTCAAATAGTTAAGAACAACTGAAAGCTTCAGAAATTTT GGATGTTTTATATAAAAAACTTTAATCACTCAGATAGAATTGGCTGCAAC GACGTGCCCCTAGCCTAGGCCCCGTTTTCAAGCTACGTGACAGGGTTACA AATTTACATTTTTTGTAATTGTCACCTTTGGTGACAAAAAGATTAGCCAT ATACCAATTTTATAACAATAAATTTTGCGCCGGAAGATGTTAAATTAAAA ACTCTTTTAATATGGTGCCCTATTTACAAACACAATCATCCAACTTATGC TGTCATTCCAAGTCTTAGTGGTTCACGGTCCATATACGAAATATTAAGAT AGCTTAGTCGCCAGATTGTTTGTTTTCACGCGTCCCTTTAGATTTTCTTC GTGGTGTACAGAAAACAATGACAATCTGATCTCAGGTTAACTTTCGATCA ATCAAACCAATTTTTAAATATCAATTTTTGCCTTTGTCAGGGTCCAAATT ACGTTCTCTGCTAAGGTTAAATTTTTGCGTAGGTCTGTATCCCCAAAAAA CACTGTCTCAAAAGTGATCAGAATTTTATAGGGGTGGGGTTATTTTTTTT TCCAGTTTCAAATTTTATTCAACCTGAGCTACTGTGTCCAAATTTGGAAA AATGATTAATTTTTTAGGAAAAATCTTCCTACAGTTTATGCTTTCCCCGA TAAAGACCAAGCTTCCCCGATTCCGATTATAAAGAAAATATACACGTTTT TTTATAAAGAACATCCAAAATTTTTGAAGCCTTCGGAGGTTCTTCTTAAC TTTTTGATTTTTAAGCCTAAAAATGTTCTCAACATATTCTTATTTACACC TGTGTGTATTTTTGTCCAATTTTCTAAAAAAGGAATGATTGCTTTAAGGT CTGCAAAGCCCTTCTTAATTTGTTCTTAATATTTTGGCTATCAAAACCTT ATGTTCTTATATAGTTTGTTCTTATATTAAAAAGACAAATTTTGAAACAT TTGAATTCTGATACTATCTCTGTTTTGACATTTGTTGAAACGGATATCAA TATTTTTTGTGTTTTGAAATATGAGAAATAAAGTTTCTTTTGGATTTAGA TCAGTTGAGGATTGAAAATAAAGTTTGTTTTGAAAGAATTCAAACGATTG GTTAACTTTTAAGATCTGAGATAGAGATCTTAATGTTTGACAGGCGAAGT TTGGCTTTTTTGGATATTTTTTTATTTTTTATTTGATTTTTCGAGTAGAT TAAATTACTTAGATTTCATCTTTTTAGGCCACATATGTCATAGTTTTGGA TTAGATATCAGGTAAATTTGAATTCTAAGGCTTTCATCATAAACATCAGA GCTTGTTGTAGTAGAATATGATATTAGTCCACATATGCTGTCATTTGAAT CTTTTGCAAAGGCGTCGACCAATATTGAGAAAAATATGACAATATTTCAA GAACGTTACAAGAGCGAATGCGAACACCAAAACTTTGTGACATTTCTTCC TATGTTACTTTTTAGGGCACAAAAGCAAATGGGAGTCGAAATTAGCAATC AGAGGTGCTTTTTACTCCCCTGGTATTTCTTTTGGCGCCCTAAAAAACAC CGGCTGCTATGNCTTAGTATTAAAGGTTTTGTCTTTAAAAAATAAGAGTG AAATCGTTTGCTTACTCCTCGATTATAATTTACAAGCTTTTTCATAATGG ATTGACACGAATGTGGAGTAAGATTGGTCAGAAAGAGGAAAAGAAAAACA TTTTTATGCTTGTATTAGCATAATATGCTGGTATACTATTTTGTTTTGAT TATCTGTTTTCTTGGCTTTGTAAAATTTACTTCTGACTGGGTTTAGATTC CGCGACATTAAACTTGTATTTAACGCAACTATCATGATACTCTGGTTTGG GGTGTATGAGCCTGTGAGGGAATCGAAATTTTGAAATTTCGTAATTTTGG GACCCTGTCAGAGACTCGATTGCTCTTTTATGGTTTTTCTACTCCTGAGA TGACGAGTGGTGTTAAAAAGTTGATTCTGGGTGATACTCAAGATCGCGTC CGACCGCGCGTTTGTTGTTAGAACTAGAAGAGAAGGCCACTCTAATTGTA TAAAAGTGAAAGTATCAAAAATTATAGGGTACACATTTGTATGTTTTGGT TCATTACGGTCTCTGAAAATCCATGAAGAATCTGAAAGAAAACAACAAGA AAGAATAAAAATAACAATACACATCATTGACCCGAGTATTAGTCGACATA CCCGTAGGACGTAGGGAAATATATTGCAAACATTACCTAATACTAATAAT AACACAATGAAGTATAAGCCCGAAAGGCTAGAACCGAATCTCCTTGGTAG GATTTGAAGCCAACAAATCCTACCAAAGTTGCACAGCCTAGCGCGGTTCG CCTCGATTTTACACAAATGACAGATTGAAACTAAAATTTTAACCTAAATT TCGAAAAAGATATCACTCAAATACAAAGGAATCGCTAGATTGAATCCGTC GTCAAAATACGGTGCATATTTTAAGCATAGTCTTCATTTTTTCTTGACTG AGAAAAGATTCGATTCTAGCCCTTCGGGCTTATGCTTATACTTCAACGTA AAAACATGATTCAGCATCATTCACATTTTTTAGAAAATTATAGACCCCAG TCTACTAAAAACCACACTAAAAAGAACATAGTTTAAAATAATTAGGATTA CTAAAAAGTCGTTTTTTTTATAAGAACAAACTTTATGAGAACCTAAGGCT TCGATGGCCAAAATGTTAAGAACAAGTTAAGAACATTTTGAGGCTTTGCA GATTCTAAAACACCCAATTTCTTACAAAAATGGATAAAAATTCTCAAAAA ATTGTGAAAATAAGGACGAATATGTTAAAAACATTTCTAGGCTTAAAACT TAAGAAATTAAGAACATTCCAAGTTTCAAGAATTTTGGATGTTCTTATTT TAAAAAAACGTGTATTTGCTAAGAAGCAGAGCCTGAGAAATAAAGTTTCC TTTCCAATCGAATGATTGATACCTGCTGGCATTTCAAAATTGATTATCAA TATGTAGGCTCAATTATATTTATCCGATGGGATTACCAATTAAATTGGGA AATTTGTGATACTCTCATTTTCTCAGCGTTGAGAAGTATTTGTAGATATC ATTAATTCGGTGAAATATTGGATTGCAAGTTTTATTACTGTTCGGCAGAC TAACGTTGTCTTGACGTTATGTGAACGATTCGAATCAATTTTGCTATGTT GTTTTGCGTCGGAAAAATGCTGTTTCCTCAGATCTTTCGTTTGTTTTCAG TTTCAGCGTGGTGTGCAGAAAGCAACGAGGATCTGATTTCAGGCTGACTT ATGGTCAATCAAACCAATTTTTAGATAATGTCGTATATCCCCTGCTTGGA TAGACGTAGTTCTATGGTGCTTTTTGAAAATGTGTTCGAAATATGCAAAT ATATAGACAATAACAATTTTTGCCTTTATTGTCCGAGTCCAAATTTCGTT TTCTGCAAAGGTTAAAGTTTTTTGCGTAGGTCTTTACCCCCAAAACACTG TCTCAAGTGATCAGAATTTTAAAGGGGTGTGGTTGTTCATTCCAGTTCAA AATTTTACTGAAGCTGAGCTGTGTCCAAATTTGGAAAAATGACCTAATTG ATTTTTCAGGCAAAACTTTTATACAATTAATCCTTAACCTTGAGATGCTC CCCGATAAAGACCGAGTTTCCCCGATAAAAACCGAGTTTCCCCGATAAAG ACCGAGTTTCCCCGATTATTATTCAAAATTTTTGAAGCCTTCGGATGTTC TTAACTTCTTTATTTTTAAGCCTAAAAATGTTCTCAGCATATTCTTATTT CCACCATTTTGTGTGTATTTTTGTCCAATTTCCTATAAACAAATGAGTGT TTTAAGGTTCGCAAAGCCCTTCTTAACTTGTTCTTAATATTTTGGCCATC GAAATCTTATGTTCTTATAAATTACACCCCCTTCTCACAGACCCAGTGAG ATATTTTCAGGCAATGGGGGTAAAAATAACGGACCATACTCGATGGGGAT TGATATTCCTATGTTTTTTACGCCCGGGGATTTGAATTCTATTGTTTTTG AGCCAGAAAATTCAGTGGAGATGGAAAAATAGCACACCATTTTGCATTGA GGATTTGCTTATCTGATTATTTTCAGTTGGGACAAAAAGTAGAGTATAAT TTTCCACTGGGGACAATATTTTGGCCAGTTTTTCTTTCAAGTGGGAAGGG GTCCCAGTGGGTCTGTGAGAAATGAGAGGGGTGTATAGTTTGTTCTTATA TTAAAAAAGAACGTGTACAAGACAAATTTTGAAACATTTGAATTCTGATA CTATCTCTGTTTTGATATTTGTTGAAACGGATATCAATAATTTTTGTGTT TTGAAATATGAGAAATAAAGTTTCTCTTGGATTCAGATCAGTTGAGGATT GAAAATAAAGTTTGTTTTGAAAGAATTCAAACGATTGGTTTTAATTTGAG TTAACTTTTAATATCTGAGATAGAGATCTTAATGTTTGACAGGCGAAGTT TGGCTTTTTTGGATATTTTCTATTTTTTATTTGATTTTTCGAGTAGATTA AACTACTCAGATTTCATCTTTTTAGGCGACATATGTCATAGCTTTGGATT ACATATCAGGCAAATTTGAATTCTAAGGCTTTCATCATAAACATCAGAGC TTGTTGTAGTAGAATATGATATTAGTCGATGTAGTCCACATATGCTGTGT CATCTGATCTTTTGCGAAGGTGTCAACCAATATTGAGAAAAATATGATAA TATTTCAAGAACGTTACAAGAGCGAATGTGAAAACTTGATATTTCTTCCT CTGTTACTTTTTAGGGCGCAAAAGCAAATGGGAGTCGAAATTAGCAATCA GAGGTGCTTTTTACTCCCCTGGTATTTCTTTTGGCGCCCTAAAAAACACC GGCTGCTATGTTAACCCCATGCTGCCAAGCTGATGTGTCTTAATCAAAAT AATCTCTAAAGATATTCTTCCTTCCAGCTTAGATATTTAGTGGAGTAAAA GGAGATAACGGGTGTTGTAGACTTTTCGGTCCCGTAAAAAGTGTCGTCCC TGCTAAACAGAACGAGTGGAACAAGCAAATGAATAAGTTGTATACTCGAT TCNACGTCAAATAAAAAGTGGAGAGTTTCTAGTAAAATATACAGTAAAAA CAAAAAATTTCTTTAAAAAATCAAAAAATCTGTATTTTTTCACCTAAACT AGAGCTCTAATCCACTATTCCTCAACATTTCCGGATGGACGAGGACACTA CAGCCGACACCTCCATAGACGATCACCCTAGTCAAAATTTTGACGAGCTG CGATGCTCCCAGACGAAATGTTACGGTTTGGAAGAAAATATCCTTGTTTG TATGGTATGCAACCGCTTCGTGCATTTTAGATGTTCCCAGCTCCAACCGT ACCAAATTCAGGCCTTCCTGAACACCAAGACAAAAAGAAACGGAAGATGG AACTTTTGCTGTATCAACTGCGTGGAGGTACCCCAAGACCTTTATGCACT GTGTGATGTAGTAGAAGACGAAGTAACTGAACTCAAGAACGACATCTCGG AACGAGACCGAATCATCGAAGTTTTCGATGGTAACGAGAAGAAATTAATC AAGTCTGTCCAATCACTGAAGTCGCATAATGCGAAACTCAAAGATAAGTC AATCGAGAGATGTTCCGTAGACGAGATGAATCAAAAGATCCAAAAAGAGA TCACTGAGCTTGGTGCAACCATGAAAGCGTCTATTATTGACGAGATCAAA GCGACACTCTTGAGCGTTGAAAACCAAATGACTGTGGTAAAACAGTCTTA TGCTAAAGCAGTTAAAGACCCTTTATTAGACGACTCTAACACCTCCATCA AGGAGGTTATTAGAGAAGCTCTACGAGAAGAAGATGCAGAAGAAACAAAT AAACAAAAACGTGTCTCCAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA AAAAAAGGAGATAACGGGTGTTGTAGACTTTTCGGTCCCGTAAAAAGTGT CGTCCCTGCTAAACAGAACGAGTGGAACAAGCAAATGAATAAGTTGTATA CTCGATTCAGAGTTATTATATCGATAAAACCATTGAGAAGTTTTACCATT GGTGGGTATTAGAGGCTACTTTTTCACACCTACAGATTATAATTAAAGGA ATTTTACTTTATTTGCCAATTTTCCAGCAGAGAGGGGGCCCGGTTGCGGG AGAAGAGAAAGGAGAATGAACTCCATGCCTACAAACTTTTTTTTATCACA TAATTCCTTATAAACCTACACAGCCACGAAATGAAATTTCTTTGTTTTGA AACTTTTGCGGTTTTTCTTAATCTCCCTATTCATAGAGAATGTTGATATT CGGAAAAATTGGATTAAATGAAAATCCCATTCTCTTTTGTTCTGTGTCTA ATCTTGTTCCAAAAAAAATATGTCTTAATCCATATTTGTTTTTTTGCTCC CGTTTTTCTTACTTGCTAGGCTGTTTTTGGGAATATTCTATCAAAGTATC AAACAGAGGATAATATTTGCTGTAGATAATTATTTTCTTGGACGTTTTCT TTTTTTAATATCAACAATTTCGACCGATGGTTTCTCTGAAAATTATGTAA TAGGGTTATATGGTGTAGTTGCTGATCTGGGGTTTAGCCTTATTGTTTTG CCTTAACTTTCTTGAAAACCTCTGTACAGCGTTGACTTTGGGGGATTCGG TAAGCGGCGTGAGAAAAATCAAAACAAAACAACCGAAAAGAACTGACTTT GGGAGAAACTGACTTCCCAGCTGGCACACAACGTTGTTTTAACGTTCAAA TAACGTTATTTGGACGTTATGAATGTCACATGAACGTTGTTTTGACGTTG TGTGCTGTCTGGGTTGGGATTCATGGGGAAAAACGCAACAAAATATTTTC AAATAAACTTTTTCTTTGGAGTTCTTCCATAAAAGACACTAAAATCAAAC TCATAAAATATTTCTTGAATTGCACTCGAAGTCATGTGATAACTAGTACT TATTGCCGACCCAAAAAAATATCATTGTTTTGATTGGTCGGCAATAATTA ATCTTAAAAAAGAGTAAAGACCAAATAAACTGGTTGTTTTCAGCCTTTAT TTAGAGTTTGTTGGTAGTTTATAAGAAACAATCACCATCCGCTCCGTTGT GTTGTGGGTAATTAACAGTGAAGTTAAAATATCGGTGTCTTGGTTACGTG GACTGTACAAGTCTGAGACAAGATTCTCTCTGAAAGTTAAACCAACAATT CTATTGTAGCAGCATAGAAATCTCTGGTAGCAGCAAGGCTTGTAAAACAG TACGCTGATGTTTATATACCCTGGAATAGAATTTTCTTCGTGTCTCTCAC GGTAAACGGAGGGGTTTTCGTCTTCCGTTATTCATCACTGACCTTAATAT ACCCTGGACCAAGCTTCTCAATCCCGGCCAAGTAAAACCTTTGATCGGAG TTTTTTGAAAAGTGGTACCCTAATGGCGGCACTACTCAATAGCGGTGTAA ATGCATGGAGAGCGATAGGTCCCCTCAAATACTTTTGACAATGTAGCGCC GTTTGACGTTAATTTTTGCCACCGGAATGGCTTCTTTACGGGTATCCCTT TAAAAATAAACTTCGATCAAAGATGGTGGATATAGCTTGGTCCAGGGATA TATAAAGGTCAGTGATGAATAACGGAAGACGAAAACCCCTACGTTTACCG TGAGAGACACGAAGAAAATTCTATTCAGCATTCATCCAAGATCTTTGGTT ACTCAAGGTACTGGTGCAATGGTGTCACGAGTAGTCAAACAGTACTTTAA TTTCAACTGAAGTGCAAATTTTACATTGAATATCGAATGGGGTTGAAATT GTATGGTATTTTGTTTCCTGATGGGGACCAAATTTTTTGCAAAATTTTCT AGTTGGGCTGGGGTCCCCGGGTCTGTGACACAGGGCTGTACAAACAATCC AGCTATTTCAGGCATCGCGATTGAAACGATTAATTCCAATTTAATCTCTT GATCTTATTAAAGACTTAAAACTAAGTAACAAATTAAAAGGCAATTTAGC TTTTAAAAAGATTGAAATACCACAGATGATTGGCAATGAATAGGTTTAAT ATTGAGGTTTACATACATGTCCATATATGACAGATTCTTTGTCAAAAAAT CCCTCCTTTCTGTTATTCTTTATGGATCTACTATCTATAGAAATGATACT ATCTTGTTTCTTTTATTAAGGGTACAGTAATAGACGACACCTCAATATTA AATTTTGTGGTTACATTTCGTGTTTCAGTCTCAAGTTTCAGACTTTGAAT TACATTGGGTTTAAACTTCGTTGAAGTAACGTAGTAAAAACTATTGCTTT TCGTTGGATCTTAGATCTTAGAAGCCATTTAGATAGGTTTAGCCAAATCA AACATTGATTACTCTAAGGTCCCGAATAATAGGGGGGTCTGAACAAAAGG GGGGATCCGAAATTTTTGCAAAATATAATAAACGGGAGGGTCTGAATGAA CGGGGAGGCCTGAAAATATTCCATACACTTTCCTTTAGAACTTTCCTTTA TATTAACGTTCGAAATAGATTAAGCCTGATTTACACTTCAACTCAAAAAC AAAAAAACTGGAAGGTTAATAAACGGTAGGGGGGTCCTAATAAGAACGGG GGGGGGGGCCCAAAAATTTTCGAAAATTAATAAGCGGGGGGGGACGTCTA TTCGGGACCTTAGAGTACTAACGAAAGGGCTCAAAAAGTCAGGTGGGGCT GTTGAGAGTAGATCTAACATTGAATCTACAATCAGTATCGAAATATATTG GCAATTTTGGGTATTTTAACGTTTCTCAGAATTTAAAGCTCGGGTGAGAA TTGCAATTTCAAAACTTCCACTTTGTTTCAGGAGATTCTTCGATTTGAAG GGGCTAAGTGGCTTCCAGGCTATGTTCTCAGCCATATTGGAAAATTAGCT TTTAAATCTTGTGATCTTGTGATCCCAGTACCGTTAAAACTCAGAGTTTT ACTTTCTAACCGTACTTTAAAACACTTAATAATCACTTGCAGTTTTAAAG TTTTGAGGGAATTTTTGTGCCAAATATTTCAGCGCCGATTGTAGTTAGTT AAATGTTAAAATGTTTATGATAGCAAAGTATTTTATTTACTTCAATTGCC TTGGTGAACTTCTAAGAAATATTTTGGTGCTTCAAAGAATGAATAAAGCT TGAGTAGAGGCGATCAGTCTTGTCCAGTATCACGTAGCATTTTACCGAAC AACTACCGGTATGGTCGGTGTACGTAATTCCATTTACCGGTACTTGTCGG GAAGGTGAACCGTTATTTAAGGTTTACGTTTCCGGTATGCCGATATTTGA CAAATGGATTATTAGGCTACTGACAACCATTGACGGATTCATGCTCCTTA TAGTCTGAATCACAGACCTCTACAAAACCGCAGCACGAATCTTTTAGCGG ATACTAGCCCGGGGTCTACTTACAGCTTTTTTATAGACTGGATGGCGTGA TTCGGTGGCCCAGTATCATATGGTGATATGCTTTTGCTTACAGTCTGCCA GATTTTAGGCGTTTTTAGAAGATAAAATTAGGATGAAGCAATGTTTTTAT TTGAAAATAAGGGATTTGAAATCTGTTATTGATTTTTTTTTTCTCATTCA GAATTATATTTTTCAACTCCAAGTAGTTTTTTTGTTATTTTGATTTTTAA CATTTTCTTTTAAAAATGGCGACTTCTTCAAGTACTTCACTGGACTCGAC GTCATCAAAAATTATCAAAAAGCAAAGTTCAGACAGAAGTAGACTCTAGT CTAAGTAGCATTGTCAACGATACCAAAAGGATTTACGTTGTTTACGTCAT GATTTTTTACAGATTTCAAACACAAACAAGCCATAAACATGCTACACGTT TTTTTTATAAGAGCATCCAAAATCTTTGAAGTGTTTGGATTTTCTAGACC TGTTGAGCTTTTTTAAGCTAAAAGTGTTCTCATCGTGTATTTTTAGTTTT CTGTCCATTCGCGTGTTTTAGAGTCCGAAAAGTCACGAAATGTTCTTAAC CCTTTGAGTGCCAGGGTCCTTTTTTCTAAGTTTTTTTTAAAAAATCGCTA GTTCAAACTTTAAGGACTTATATCTCCTGATCTAGAAGGAATTAGAAGCT CGTCTATAGCTCGTTGGATAGCTTAGAGTCTCTTCTTTCTTTTGGGTGCC TTCGGCGCCGCCCGATTTAGGAAGGGCGTGGTGGGCGGCGGCCAAGGGGG GGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNATTTTTTTTTGCTTGACCATAAAGG ACAATCTAATTCCTACGAGTTCGACCAAAAATAACGATTTCTAACTCAAA CTGGGCATTACAGGAGGGCTTCGCCCTCCTTTATAGCCCATGTCGTATAT ATACGACATCGGCACTTAAAGGGTTAATGTGTTCTTCATATCAAGAAACT TAAATAAAACTTCCTTGTTTATATTTTGGCCATCGAAATCTTATGTTCTT ATATAGTTTGTTCTTACATAAAAAAATGTGTAGCAGATATCGACGTAACA AAAATACTGTTAAAAGGTTAAAGAGAAGTGATGCTATCTATGTCTAAATA ACTGTTCATTAAGTGTGATTTAAAACGGTCCTTAACCTTTACCATTTAGA TACTTTAAGTTTTTCAGAAGTTTTTCTTAATATTATGTCAACCGATTACT TTGAATCGATGACGAATCTTAACTTTGATTACGGCGCTAATTCATTTAAG AATCGAATATCTCTGCCCAGCTGGCACACAACGTCGTTTCAACGTTTATC TAACGTTCACAACGTCCATATAACGTTAGATGAACGTTGAAACAATAACG TTATGTGCCAGCTGGGTGTAATTCGAACAAATTATATTTCCCGTTTGGGT TTGAATTGGCGAGAGTCACAGCAATTGAAACTTTAGTATGAGAACTTTGG TTTATGTTTTGGATATGAATTTTAGACTATCAGGAGGCCAGTCAACCTTG GGACGATATCACGCAGGAAAAGTGAGCGTAGTAGTTAGGTACGCGTAGAA GGAAAATTTTTACGACGGGTGGTAGGGGCTGAAGGTTTTGCTTTTATTTC CTCATGATCACTTTCTTTTATCGTTAATTCTTTACAATAATCAAATTTTT TACTATGTTCTATCAAAAGTTTCATATCAAAGAAAATTTATGAAAATTTC CGGATAGACATTTTCGTTTAGGATCGGTATTTCTCGTTACCTTGTTTAAT TCCTAAGAAAAAAACGAGGTAATCTTAGCTAATGAAAAATCTGGTAAGTG TACGATATTAGTCCATTTCTATCTATTCTTTTCCGAATCTAGACTGACAC GCCAGTNGATATATGTCCATTTCTATCTATTCTTTTCCGAATCTAGACTG GCACGCCAGTCGGGCTGGAGTAGTATGACGCGGGAAAAGTGAGCGTAGGA GTTAGGTAAGCATTTTTTATTTAGGTAAGAAGTTTTTTCGGCAGCAAGGG CTGAGAATTAATCAGCAGCCTTTCATTAATTCCTTATCAGTGTGACTGTT GAGTGATGAGTAGCTTAAACCTAGCCTAGTGGGGAATCCAAAAATGCGTT TTTGATGATAGTCGAAATACCCGAAAATAGTGATAAGATACCCTAAACAT AAACAAGGGGAAACAATGAAAAGGAGACAAATGTATAATTGTGAAATGAG ATATCTTGACTATAAAATGAAACGTAAGAAAGTGTGTTGGTTTTGGCGTG ACATTTGGGGATGCATCGAGAGATGAATCTTCTTAAAGCCTATAACCGCG GACGGTTGTGAAGACCGCAACGAGAGCCGGAGGCGTGACGTGGGTCTGAG CCTGATCTGATCTTATGTAATAGAGCTAGATGGGGTTTACGTAGTAACCC GCACCCCCCCCCTTTAAACTGTAAGTGCTAAAGGTTCTAGCCCTCAAACT GTAAGTACTAAAAAGTTCTAGCCCTCAAACTGTAAGTGCTAAAAAGTTCT AGCCCTTAAACTGTAAGTACTAAAAAGTTCTAGCCCTTAAATTGCAAGTA CTAAAAAGTTCTAGCCCTTAAATTGCAAGTACTAAAAAGTTCTAGCCCTT AAATTGTAAGTACTAAAAGGTCCTAGCCTAGAAATAAAAAACTTAAGCCT TACAACAAGAGCCGGAGCTGTGATATGTTGTTTAACCCCAAAGAGTGCAA CGAGAGCCGGAGGCCGTGACGCTGTTCTAAGAGGAGTAATCAAAGAAAAA AGATAAAAAAAATAGAAACCTTAGCCTATAACGAGAGCCGGAGCCTCCCG TGTGACGTTGCTGAAAGGAGTAAAAGAAAAAAAGAACAAAAGCCTACAAC AAGAGCCGGAGCTGTGATATGTTGTTTAACCCCAAAGAGTGCAACGAGAG CCGGAAGCCGTGACGCTGTTCTAAGAGGAGTAATCAAAGAAAAAAGANNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNATCGGTCTCGGCATTCCTGCTGAACCGCTCTT CCGATCTAAAATAGAAGAGAAAAAAAAAACAGCGAAAGGAAATAAGTACA AGTAAAAGGCGCATAGGAATAAATAAGGGTGTCAGGGAGGGTGGGAGGCA AAAATATTTGTGTTGAATGCATGAGATGATGAGGTGAACTGAATGACTGA ACTCAAACGCTACAAGTCGGAGTCCATGGGACTGGGACGAGTAGGAGTGG GCGTGCAGTTTTAGCCCGCCATATGATGCCGGGCGTTTGACTTGCTGATT GCGGAATTAACATGAGCTAAAATTTAGCTCTAACCAAATTTTGCTCGTTC TCCTACGCAGCTCCTATTCTAGCAGACGCTCGCCACCTTTATGTTCTCGC CCTCTGATATTATTAATTAACAAACTAGTTTGCTAATTTATTGCGAATCT AAAGATTGACATTCTTATTTTATTTTTCAGATTTACTCAAATTATGTTCA TACAATCCAATAATGTAACCTAGAACCACTACAATCTCCTTTTGAACCTG AAATACCGTAGCTAAAGCGCCATTATGGATTCAACACTTGCTAACTGTTC TGTTACTATCGATTTGCCTAGCAACGAACGCTCTTGGTATGTTTATATCT TAGCTTCATTAGCCATTTATGTATCTGGTTTCATCTGCATTCTGATTGGT CGAATCTTTTGGAAAGTCATTAAAAAATGGCAATTTAAATTACCGGAAGA CGAAAAAGATTCACGGAAGCCGATGGAAGAGTATAAAGCATGGTATTTGC AACTGAAAGAGTTCGCTGTCAATCTCGATACCGGTAAAAGTGTACTTGGA AAATGTCTGGTAAGAATCCTTTCTTTTTAAAAGTTTTACTTTTACATAAG TGTCCCCGTTTCATATCAGACACATATTTCATATCAGGACAGTGTCTTGC TATTTTTATTTTATGCTGATATAAACAAAAAATCTTTTTCTTTTCCTCTT TCTGATCAATCTTGCTCCACATCCGTGCCAATCAAACGTGAAAAAGCTTG TGCATTAAAATTGATGAGTATAAGCAAACGATATCACTCTTATTTAAGAA CAAAATCTTTAAATCCACACAATTTTTTTAATAAGAACATCCAAAATTTT GAAATCTTTGGATTATCTTTAAGTTTTTGAGTTTTAAGCCTAAAAAAATT CTTAACGCTGTTCTTCATTTTACAATTTTTAGAGTATTTTTATGCGATTT TCTAAGAAATCTGGTGTTTTAGAGTTTGCGAAACCTTAAAGCTGTTCTTA AATTGTTCTCGATATTTTGGCCATGGAAGCCTTGTGTTCTTATATAATTT GTTCTTTTAAAGACGTGTTAGACCGTTTAAAACGTCGATACTAGAGTCCC CAAATCCTATTTTTCGTAGCCTTGTAACAGATCATCCTCATATACTACCA GCGAGAAACTCTGCCCTAAAGATATGCGGTAAATGTAATGATCAGACCTG CTTCTTGACCAAATATATTCGAAAAACCGAATTTACTTTTGACTGGATTA AAAAGTAACAGTTCCTCTAATAGATCTAATCGGAGTTTTTGATTTTTCTA GAAAAGCGATGTATTGTGGGATTATTTCGGGGGTATTGCAATAGAAATCT ATTAAGAATTCCTGGAGGGAATTCTATTGTAATACCCCCGAAACAATCCC ACAATGCATCGCTGTTTTAGAAAAATCAAAAACTCCGATAAGGTCTATTT TCATACGCTTGCTTTACCTCTACCAATAGACCTTTTCATGAATTACGTCA CGAACATCACTTGCCTCGTTTTGAAATTATTGCCATGGTGATTAACTCCC AGCAGATTCTATTACAACTACATTCTATTTTTAAAAATTTTTTTTAATCT CACAGGGGAAATTGTTTGAATACGAGGCAAAATAGTGATGTTTGTGACGT AATTTATGAAAAGGTCTATTAACGCGCTCAAAAGCTTTGGAGTTTGCGCA GTAGTCAGGATCAACTCAGAATCCTTACCTTTGTTTTGTTATAGGTGGTG ACGTCATTTGTCTTGAACATGGCGGCGTTCATTTCATATCTATTTATTTC ATACGAATTGTAAGTATCTTTTAATCCAGTGCCCGTGAGTCCCAGGCTTA ATCTACTATAATAACGCATTCATTAACATTATTAAACATCCAAAAACTCA AAAGTGCGGAAATCGCCATTCTCGCCCAAACTTTACGTTTTGAAAAACGA CGAAATAGTACTCAGAAATGCCAATAATAGACTAGGACGCTAGTCGCGCT GAGATGATACCACATAGAAAAGAGCGCATAGAAGCTAGGTAAGCGTGGGA GGAAAATTTCTCAGCAGAGAGGCTTGAAAGTACCTTCTCGCCAACTTTTC CTTGTTCTCCTAGGTACCTCCTATTTTAGCAAACGCCCTCTACCTTCATG TTACCGCCCACTAACATGATTAGTTAGTTTGCTATAGTTTAGCCTTTGTC GTTGACCCTGATTGAAAAGTATTTCGTATTCTTTTTAGCCCTATAGAGTA TTGCGACAAGCACGATTTCGCACACGGAATTCACACGCAGATCTGGCTAT TGGAATTATGTCTATACAGTTTCTTTGCTTTCCATTTCCTTCTCAGGGTA AGTCTCTATTATCAGGGTTGCTAGGTCTGCAAGAAATGTCTGGAATTAGG TGAAAGTTGGGAAATGTCTGGAAAGTCTGTAAAAAATCTGGAATAATTGA CATACCTGTCTAGAAAAGTCTAGAATTGGCATACTTGTCTGGAAAAAGTA TGGAATTTGAAGGAAACAGTCCTGAAAGAAGTCTGGTAGACTTTCTGGAA ATAGGAAAATTTCATCTTGGCTTTTGGAATCACCAAAAATTTGTGCTTGC TTTACTCGCAACCAAACCTTTGAATCATGGTCATTCTGATATTTCTCATT CTTTTGTATTCATCAATTTGGCCTTTCAAATAACCATTAAGGAATATCTG AAATCTTTCTACTCAAAATCATGTTCGAACTCGATACTTTTTTTCCGGAC ACTCTGTGTGTCATTGAATGAATACACGCTTTCTTTTTATAAGAATACAC TTTATAAGAATGTCCATGATGAAAATGGCCAAAAAATTAAGATTATGGTA AGAATATCACCATCATAGAATTTAGCAACTGAACCTAAGAATGCCTTTTT TAATGCATTTTAACCTGTAGATTGCCAATTTCGATCTTAACCTAAGAATA CTGTAAGAATATTTATGGATGATTTTTGCCAAAACGTTAAGAATATCCAT GATGAAATGAAAAAACACCATTCTTACAAAAAAAAAGCGCGTAGTTCAAT TATATATTCTTCTTTCATAGTTTATCATAGCGACAGACAAATTGGCGTTT TGGGGGTTAAACATTTACACGTTAGTCGATATATTGACCATTCCAATCGT CATCATTCAAGCATTGCAACAAAAAGCATGGCTTGGTAAGCATGTTAAAA TTCTATCGGAGAAGGGAACTTAGTCGTGCAAAATTTTCGTCGAGACAAAA TTTGGTCACTTTTTGACAGGAAAATTTTGTCATTTTTAATAACTATTCCC CACTAATATTTTGTCTTTGTTGTTAATATTTAGGACACTCTTATTATATC ATTACTTTTTACGAGCCCCCTCCCCCTCCCCCCAACGGATTTAGTGATTA CATGATTTAAGATTTTAAAGTGCGTGATTGCGTGATCCAAGAGGAGCCAA CGTGATCGTGATAGAAAGGAAATTTATATTGTGATGTGTGATTTGAAAAT TTTTTACTTTGCATGATTGCGTGATTTATATTTGGTCCTCTTTTACTATA AAGAAAATTAATCATGTGCGTGAAAGTTTGATTAATTTGACGTCCGATAT GATGCGGCATAACCAACATTCATTAATCTTTGATAAACTTAATGGTGGAA TCTCCATAACTCGAACACGCACGAGGGAATACAAAAATTGTTCGAGTTAA GGAAATTTCGAGTTATAGAGTAAGGCTTATGAAGCGACAATAAATCTTGT TCGAGCAAGGAAATATAAGTTATAGAAGTTATAGAAAATTTTTAGGAGTT TGAGCTAAAGAGATTTCATTGTACTTTTTTTCGTTTTTTTATTCTGCACA GGATTGAGATTTCTACGTGTAGTATACATACGAAAATTGCCAGATATTCT CATCTACTTAAATTTATTAGAAACGGGGTAAGTTTTTGTTTTTACCCTAA ATTTGCTGGTTGAAGACGAAACATTGATATTTGCTTGATTAATTTATGTG TGATGCCTCATTTTAGAAGTATATGTAGCAAGAATTGGGCACTATTTGTA TTTCAAGGATACTTTTAGCATAACAAAGAAATGGTGATACACCTTTTCGA CCGTAGCCACCAATTGCTGCGCGGGCATTTTTTGTCCTACTAAAACCATC CCAGTCCTTTTTTCGCACCAAAAGACAATAGAAAAATGCGTCAAAAGAGG ATTTAATGGGATGAAGCGGACTAAAAATGCCCACGCAATTACCGTCGAAA AGGTGTATAAAGATACCCTCTTGTTAACTAAAACCTAAACACATATAAGC AACATGCATTCCTGAAATATTTTTGCACTTAGTTCAACCTATTAAAAAGA GCGCCACTACAGCTTTGTATTAGATTTTCTCTGATCGCCTACCTTATCGG CCCTTATCGGTGAAATTATATTGTTTCAGTTACAATTAAATGGTCTGAAA AAAAATGAAATTAATTTTCAAGAAACCATTTTTTTGTCCTAAATTATTTA TAAATTAGTTCAAATTTTCAAAATGAAAATTAGTAACATTGATGAAAGCA GGGCATGATAGGGTGGATAAGAAATTATAGCCTCAAATATTCTTCCTTTG AATTTTCAGGAAATTTATAGAAATTGGGACGGTCGTTGTGAATTTCATGA CAGTAGTTCTTTCGTCGACCGGTATGATACATTTGGTGAGTATAAAATAT ATGTACACTTTAATACACCTTTTCGACCGTAAGTCGCGTGGTCAGGTGCG TGTCACTTAATTATTCGATAATTACTCGATCCAATCCTTTTTTAACACAT TTTGGTATTATCTATAGGTGCGGACAAAACGCTACTACCGATAAAGCGGA TAAAAAAATGCCCGCGCGGCGATTGGCGCCTACGGTAGAAAAGGTGTATT CCATTCACTTTAAGCAATCTATTGTCGTACCATGTTAAAGCCGTTCCATA ATAGAATTAATCTAATACGACATGGTTTCCACGCGAAAAAAAAACACCCT TCAAACGAATGGACTAAACTCGTAAACTTTTAAAATTGCTTCATTCTGTT TGAAGGAGTGAGTAATTACTGAGTAATTACCCTCTAGATGACTGGTCTAT AAAATCGGACCCTTGCAGTGTAGAGGAAATTTAGCCAAATTTGGGTAAAT TTGGGCGAAAATTCAGTCCTTACGATTAGCTTTTTAAAATCCTAAAAATC CACCATTAAGAGCAGCACCTACAGTCGTTTGGTTGCTTGCCTCCCTCCTA TGACGTCAGCACCAAAAAAAACTCACATTATCGGACCTTTGCAGTGTAGG CAAAATTTAGTAAAATTTGGGCAAATTTGGGCGAAAATCAATCTTACAGT CAGCCTTTACAAAATTAAACCTGAAAAACTTCGTTGTTCCCACTTTTTAC ACCCTTACAGAGCACTTTCTCTTATTTCGACCCATACAGTGCATTTTGGG AAGCTTAAAAAACGCGCATCATTAAAGACAGCACCAATGGTCATTTGCTA GCCTCATCCCTCATATGACGTCAGCGTCAAAAAAAAACTCACATTATCGC CAAGACATTTCCATTATGGAAAGACAATATATTACATTTTAAAGAGTCGG TAATTTTTTATGCAAACCACTTGTTTACGTCTATACCTAATGATATCCAA ACGGTATGGTGGTATAACAATAATATTATGACTTTCCGTTTTAGGTTGAG AATACAGGTGATTTTTGGGCACCACACAATTATTCGAATAGTAATCCACT CAATTATTTTGAATGTCTGTACTTCATGATAGTAAGTCACTTTTGCTTCC AAATTTCCAATACCCATCTATCCCCAAATTCTTTAGCTACACGTTTTTTT TTATAAGAACAAACTATATAAGAACATAAGGCTTCGAGGCCCAAAAATTT AAGAACATTCTAAGAACATACTAAGGCTTTGGAGACTTANNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAAAACATGCAATTTCT TAAGAAATTACATCAAAATACTCAAAAAATGCTGAAAATAAGAACATTTT AAGAACATTTTTAGGCTTCAAATCAAAAAAACTAAGAATATCCGAAGGCT TCAAAAAATTTTGACGTTCTTATAACAAAAACGTGTAGTCATCATTGTTG CGCATACCGGTGGCATGAAACTTTGAGTACCAAAATCTGTTTCATTCTTA ACAACTAAAACTACTCTGAAATATCATCGAGCCCTTTGTTGACACTAAGA AAAAGTGAATTAGAATTGTGTTAGTCTAAATCGCAGACCTCTACCAAACC CCAGGTAGTATAGGGGCTATAAGGAGCAGGAATCTGCTAGTGGATGTCAG CAGCCTAGTATTGTGTTAGTCTAAATCGCAGACCTCTACCAAACCCCAGG TAGTATAGGGGCTATAAGGAGCAGGAATCTGCTAGTGGATATCAGCAGCC TAGTATTGTGTTAGTCTAAATTGCAGACCTCTACCAAACCCCAGGTGGTA TAGGGGCTATAAGGAGCAGGAATCTGCTAGTGGATGTCAGCAGCCTAGTA TTGTGTTAGTCTAAATCGCAGACCTCTACCAAACCCCAGGTAGTATAGGG GCTATAAGGAGCAGGAATCTGCTAGTGGATATCAGCAGCCTAGTATTGTG TTAGTCTAAATCGCAGACCTCTACCAAACCCCAGGTAGTATAGGGGCTAT AAGGAGCAGGAATCTGCTAGTGGATATCAGCAGCCTAGTATTGTGTTAGT CTAAATCGCAGACCTCTACCAAACCCCAGGTAGTATAGGGGCTATAAGGA GCAGGAATCTGCTAGTGGATATTAGCAGCCTAGTATTGTGTTAGTCTAAA TCGCAGACCTCTACCAAACCCCAGGTAGTATAGGGGCTATAAGGAGCAGG AATCTGCTAGTGGATATTAGCAGCCTAGTATTGTGTTAGTCTAAATCGCA GACCTCTACCAAACCCCAGGTAGTATAGGGGCTATAAGGAGCAGGAATCT GCTAGTGGATATCAGCAGCCTAGTATTGTGTTAGACTAACCACCTTTTAA TCATTTTTGTGTATTTTAGGTGACATTTTCGACGGTGGGTTACGGTGACT ATTCATGTAAAACAATCATGGGACGCATCTTCTGCATGATTTTCATCATC TGTGGACTGGTAAGGTTTCTTCATACACTTCCATGTACCTTGCTAGTAAA ACGTCGTTCATTTTGAACGTCGGCTACCGGTTACCTATCCTTTATATAAC CTCTAAATCGTTTTATTTTAAACCACACATCACTATATTTCTCTTACCTT ATCTGTGGCACCAACTCAATACCGTGTGGTTGCTTCATACCAGAAGAGAT CACCACCCTCTGGATAACGGCCGTAAAAGCGGTCCCGATCAGCATCCGTC CAATACAAATTATCAGCTACCCAATCGATGGCCAAACCATCTGGTGCTTG TAATCCTGTAGGAAAGAAATACAATACACGGGTTGCAAAATAAGTCTACA CGGTTTTACATTCATTTTTAGGGTGTATTTGCATCTTCTATACCGGCCAT ATTTGGCTTCATCTCATCGTACACAAAATATGACAGAAAATTCAAAAGTA CACCTGGAAAAAAGTAAGTATTAAAGGGGAGAATCTTGTTGACGGTGGCA ATGACGATGGTAAAATATTATTTTGGCGAAAGACTCCTGCTCGATATTCT CAAATAAATATATCCCTTAGGGTTGACGGTTATTAGGGTTCATCTTTGTG AGGGCATGTAAAATTGACAAAAGTTGGAATATTTTGTCTGGGAAACCCTC CCTGTTGAATCCCGAAAGTGTATCTTTATTACAAAAAGATAACATCCTCA ATTATAGTAATCTTTCTTTTCAAGAAAAACTCGATCAAAAAGTGCATAAC ATAGGAAAAATATATCGGTGGTAATGGAAATGGAATCATGAACATGATGG AATCAATGAGAAAATTTTCTGGGTGGGAATTCTCCGGGAATTTTGGAATA TGGCCGTATCAGGATCTGATACAGTGGAGTCTCCATAACTCGAAAACGCA CGAGAAACACAAATTTGTTCGAGTTAAAGAAATTTTAATGGAGTACTATA AGGTTTATAAGGCATTGTTAGCTGAAAGGAACCATACAGGCTCCACTGTA GATTTACAAAATGATTTTAAAATGATTTTAATTCTCTTTTTTCACAGGCA TGTCATTGTAACAGGTCATATAACAGACGAATCTGTCAGTTCATTTATTC AAGATTTTTTACATCCTGACCGGCAATGTGAAAGCAATGTTACTGTTGTC TTCCTTGCACCGTAAGTATTCGAAAACTACCAGGGTCCACGTCATGATCT CTAAAGTAGAGGGAAAAATACACTGATTAAGTAGGCAGAAGAAAATTTCT ATTTGACCCCCTAATATACTGTAAATTGAGCCAATTTCAGACTGATATTT GAATAAGACAAGACGCTAATGAAAGTCGTAATATTTTGAAGAAAACTTTT TATGTTATATAGGGGGTCGTGGCATCCCTGTCCTCCCTCCCCCATCTCCT GATGATGTTGTTCCTAAAATAAATCTTTCATTAAAATTGTGGCAGAAAGT ATACAATGATATCATTCGTTAAAAGGGTAGTGAACCTGAAAAATGATCAC TTCAATGAGACAGGGTTTACAAAGGTGTAGACGGGAGCTGGATTCTTACC ACATAGCTACATAGTAGGTAGCGATCGTAGTGTAGTGGTAGAGCACTCGG CTACGGTGCGCAAGGTTGTGGGGTCAATCCCCAGCCGGGTCATACCAAAG ATTTCCAAAATGGAACTTGATGCCTCTGTGCTTGATACTCAGCAATTAAG AAAAGGATTAAGGGTAAGTGGAGCAATCCAGGGGGAGGAGTGGCGCCCTC CCCTACCTTCGGGTAGATAGCTATCGAATGAGGAGCCTTCGCGTCGCCTC CGACTGCGGTCACAGACTTAATACTACTTACTTAGTAGGTGCAAATTGCT CTGTATACAGGCATATGATAGATTAAATATAAAAACGTGTGCAAAATTGT AAGCTTGATAGCTCTTCCTTACTTTTTGATTGGCCAATTAGCTTTAAATC CACTCAATCTCGCACAAATTTGGTGTTCTTTGTAGGTAGATATTGAATTG GATCTAGACTAATAGAGTATTGTACTTTTTTTTCAGGAACTATCCGAGTA CACTAATTGAAGGAATCATCCAAAAACATCCTTCTTCAGTTTTCTTCTTC AATGGAACTGTATATAATCTTAAAGATTGTCATCGAGTTAAAGTAAGCAG ACAATATCGTACCAAGATTTTACTGGTGGATGTTGGTACAATCGTCATAA AACAGCAAACTAAGGGACTGAGTTCGATTTTGAGCAGGAACTTAATCTGA AAGTACTTTCTTTTGAATCTCAGAAGAGATTACGAGTGATTCTACCTTCA GAGAAATTTGGATCTTAAAGGTTTTATTTTTACATAAGTGTTTCCGATTC ATATCAGACACATATTTCATATCAGGACAGTGTCTTACTACTGTTATATT ATGCTGATGTAAGCAAAAAAGTGTTTTCTTCTCCTATTTCTGATAAATCT TGCTCCACATCCGTGTCAATCCAATGTGAAAAAGCTTGTGAATTAAGCAA ACAATATCACTCTTATTTAAAAACAAAACCTTTAAATCCAGATCTTTTTG GATGCTAAATCTGATATCTTATCAAAACCTACCCCAAAAGAAGTAAAAAT AACCAACAAAAGCAGACCCTGCCAGTAGATATACCTATCAAAATTTGGTT TATTACCGAGCTTGTCAGACATATTTTGATACCCTCAAAAAGGGACTTTA AACTATGTACGTCCTCCTTGTCTTTCGACGCCGCCAAGAATTTGCTACTG GGGGAGCTGCTCTCTCCCACCACCACAATACTATACATAATTCAATCCTG CCTGAATGTCTTGTCCAGGACTTTTTCAATTTCGAATAATTTAAAAAGAG AATGTTGTCGCTATTTCGTTTTAGATGAGTGAAGCAGACGCTGTCATTGT TTTGTGTGATAAAAAATCACATAATCCTGAGTCAGAGGATGCTGCTAATA TCACAAGGTAAGATCTTTAGCATTTGATTGGTTTATTATTAAACCCACGT GATTCACGTTAAGAAAATAAGCCAATCAGCGCCAAAATTTAGGGTCCAAC GTTTTTTCAGCCGAATGGATTTTTCCGAAAGCTTTAAAAGTGCATTAGCA GAAGACTGATTTTCTCAAATTAGAGAAACTCAATACAGAACATGAAATCT TTCAACGAATTTAAGTTTTTATCCATTTTGATTTTAAATTCTATTTTCAT ATTTTTGTACCCAGAGTTGTTTCAATGAAGAAATATTTCAGTAAATATCA CATCCGATGTATCGTACAACTTATGCGTCGAGATAATAAGGTGAGATCTT AACTATACTATCAAAAATGGGCTATTCCGGAAAAGATTTTATGTTGAGGA GATCTATTTTTAAAAAGGTGGCCCCTTGATTTTTTCCAATTTTTCAGGAC CCCTTTGGATTTTTTATTTTCAAGACCACCCTGGACATCACATCTCCTCA ATATAGGGGGTACAGACTTTTTCTGGAATAGCCCAATGGTGGACATTTCA CCGACGGATTTTTCCCGATAAATATTTCTCCCCAATCGAAAAATCTCCGA ACAAAGTTTCCCCAATGGTCATTCTCTCCGGACGTTTCAATGAACAGACA ATTGCCCGGCGTGCTTTTCCCCGACTGTATTGGGAGTTTCGCCGATCATG GATGTTTCCCTGACATTTAGGAAATATCCCTGAATAAAAATCATCCTTAG GAAAAACTTCCCTCATAGAAAAATCCGTCGGGAAAAAGTACTCATTTAGT TTCAAGATCTTCTTCCTGCAGTTGGAAGCTTACAAATTCCTATAATCCCG TCATAGTAAACCACAAAACATATTCAAGCTCTTGATAGTCATTGGAAGAT GAATTAGCTTGTGCAACACAGTAATTTTTCGAAGATTTTCCTGGTGGTTA ATCCTCAAAGAGACCTTAAGGGTCCTAGTTCAGGGCCCACGCCACTGGGG AGAGACAGGAGGCTAACTCAGGAGGCCGTGCCGGCCCCTCCCACTTTTTT ACAGAGTAAAATTTCTTTGGCTGGGCCTCGTTAGACTCTATATTCGTTGG TCCTCCCAATTTCATGGCGTGGGCTCTGTGGTAAAAAGATGTTTTCAATA TTTACAGGCATTACTAGAAAATACGACGCATTGGCGAAAAGGCGAAGGTG ACACCATCGTTTGCATCGATGAGGTAAGGATGGTTTTTAATTATAACAAG AAGCCCAGAGGGCATGAAGGCCCAGCGAATAAAAGTATGAACTGAACAAG ACTTGTGTAGCAGAGGGGATTTGAACCTGGAGTCGCTTATACNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCCAAC TGTGTTCGGTATTCGAAAAAATCAAAACAAAAAAAAAGAGGCGGGAGAAA GAAACTGAGATTCCAAGAAATGATATCTTTCTTTTTGAATACCCCCTCCC TTTTATTCCTTTTATATTTTCTTACAACTACAATTACTTTTCTTAGAATA ACAAATTTTTATGAGCAGTCATTTCTTTAATAAGTTTGTAATTTCTTTGC AACAAGGATATCTATCTAAACTTTCACCTTACAAATTTCTTAAAAAACAT CATATCATGTAAAGTTTGTTTGTTTGTTGTTGTTGTTTTTTGCCTGAGGA TTATATCCTTATACACTCATTTTGTTTTATAAGCATACGGTAAATTTCGG CTGAAGCTCACTATGCTTAAGTAAAGCTCAATTTTGAGCCTCGACTATGC TTAACCCTATGCTTGGTAAAAAAATTATGAAGGGGTGGTAAAAATTTTCG CACATTTTCCCCTATCTTTAATCTTGAGAGAAATGAAGACATTCTATTGT TTTCGAATGTTTACCATATGATTTCTTCTGTAATTTTCTGAAGTTTTGGA AATTATGATTCTAAAATTTCTTTGGCTGAGCCTCAAGGTATGCTTAGCAT ATGCTTAATTTTTCTGGAAATTTGAGCTTCAGTATGCTTATAAACGTTAT GCTTATAAAACAAAATGAGTGTATTTACCCCTTTTATATATTAAAGTCCA TGTAAATAAAAAGCTATAGTATATTCTCCCCACCACCATTTTGCTCAAAG ACAGTTTTATAAATACTTGCAATTTCGAATTTGTGACTTTCCTGTTTTGT TTGATAAAATTTTTTACAGTAGTGGATGAAAAATCTTATGATAACTTTTG CAGGGAAAAAGTAAAGAGTTCCAGCTTGTAAGCTTTGCAGTATGTTGATC TTGCTTTGATTTNATAAAAAAGTTCCAGCTTGTAAGCTTTGCAGTATGTT GATCTTGCTTTGATTTGAGTTTGAAATGTTTTCTACCCAAAAAGAGACAT TAAAAATGAGAATGAAATAGGAGAAAAGTTAGGAAATCCCCAGAAATTAG CTTAAAATGGAAAAGTACCGATTAGTAAAAACCTTGAGGCAGATTTAAAT GACATTAAATTTCTTATTTACAAAAACTGATAAATAGGTAATTCAATCAT GATAAACAACAAATGATTCTAAACTGTCTTCCGACAATCCTGTATTACAG TCTTGACTAATTCCAGAAGGCTGATGTAAATTTTTCCAAGTCATAATCTC AAATTATCAAATTGCATATCATGATGACATATTTCAGTAACAGTCTCAAT TTATACCAGGGCGTTGGTGAAATATTCCAAGTCATAATCTCAAATTGTAC GCAGGACGTCANNNNNNNNNNNGAAAAATTGCATATCATGATGACATATT TCAGTAACAGTCTCAATTTATACCAGGGCGTTGGTGAAATATTCCAAGTC ATAATCTCAAATTGTACGCAGGGCGTCAAGTGAAATAAGTTATAATTTCA AATTAAACCAGGACGTCAAGTGAAATATTCCAAGTTATAATCCCAAATTA AACCACGACGTGAAGTGAAATATTCCAAGTTATAATCCCAAATTAAACCA GGACGTCAAGTGAAATATTCCAAGTTATAATCCCAAATTAAACCACAACG TGAAGTGAAATATTCCGAGTTATAATCTCAATTTAAACCAGGACGTCAAG TGAAATATTCCAAGTTATAATCCCAAATTAAACCACGACGTGAAGTGAAA TATTCCAAGTTATAATCCCAAATTAAACCACGACGTGAAGTGAAATATTC CAAGTTATAATCTCAAATTGTACCAGGACGTCAAGTGAAATAAGTTATGT TTTCAAATTAAACCAGGACGTCAAGTGAAATATTGCAAGTTATAATCTCA AATTGTACCAGGACATCAAGTGAAATATTCCAACTTATAATCCCAAATTA AACCACGACGTGAAGTGAAATATTCCAAGTTATAATCTCAAATTGTACCA GAACGTCAAGTGAAATAATTCCAACTTATAATCCCAAATTAAACCACGAC GTGAAGTGAAATATTGCAATTTATAATCTCAATAATAAACCAGGATGCTG TGCCAAATATTTCATTTCTGTATTGTGCTCTCTGCAAATTACTGCCATAT TTTCCCATGCATCATATTTCTGAATTTCTGATTCTTACCTAGAAAATTTA GAATAATAATCTGATAATTTTTACAGGTACAACTAGGTAACTGAACTTCT AGACAATTCAAATCAAAATGAGAAAATGTGAAAGTTTTCGAACAAGAAGT ATATTAAAAGCAGTCTTTTAAAGTCAACAATTGACAATAAGTACTTTGTT TGACATTTTTCAAAGTTGTCAAAGAACTGCTAACACCAGATGAAAATAAC TTTTTAAGAGTGGAGATATGAGGGTATTCNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNGAGACAATAATTTCACAGCTGTTTTAAAACGCATGC GTAAACATTTTGTTTTTTACTACAACGATTTTGATAGTGAAATAAGTGTC CTGAATTGAAATTGCATGGCCGTAGTGACAAAAACACGATAAAGTAGGTT TTAAAGAGGTAAGGTTCACTCGACCATTTTACTCGACTTTATAATATCGT CTAGCTGCACTAATCTTGCCATAATTTATCAGAGACAGATCCGCATCGCA GGGTGTAAAGTAATAAACCTTGCCTTCTACGACTAAACAAATAAATGGAC AAAGTGAAAATTAATTTCTTAGTGAACACTACAGAAGGTTCTTTCTCCGA TGATTTTGTTGGAAATAAGCGATCGCCAACAGTGTGTTTGAAACACGCTG ACCTAGTCTTGTAGTCTCAATAAAACAAATGAACCAAGAAGAAAGAATCC ATAATGAGCTGGATTTTCACAGAAAAACCATAGATCCATCTTGTCCTTGT GTCTCTTCCCAGTGACCAGCGTGTTTTGATCGTTTGAACCGAGCTCGGCC TTTAAACTTAGGCGGTTTTTACCACGGAGCGACTAACCAGTCTCACTGGT TAGTCCAAGCAAAACCGCAATTTTTTTTTTATGCCAAAGAGTTATCGTCC GTTTGTTACGGTTTGTTACATTGTTTTTCTTAAAACACACTACATCTGTT ATGTTCTTATAGTTATAGTTTTAATAGTTAATTGTATTTTCTCCTTTTAT GTTTTTAACCAATAAAGACGATTTCAATTGTTTTTTATTCTGTCAATCAT GTTCTAACAGCCAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATATGAAAACGCGTATC GCCTAGTAAATTGTTACACACTGACACCGGGCAGAATGCTAATGAAAGGC CCAGTACGCTAAAGCTAGCTGGGCCAAAAATAATTGTAATTGTAAATTTA ATAAAACTTATTTAATGCATTCTTATTTTCTAAAAATTTACAATAGCGTT TATAATGTTTATTAAGGTACGATTTACATTCGAGGGAAAGAAAGGGCGGA GCAGGGAAGAAAAGGGGTGTTTTGTTGCCACCGTGTCTTTTGAAATGTGA GGCCGTTAGGACTTACGATCCTTTCACTTTAGTTTAGGGGTTTTTAAAGT GTCTTATATTTAAAGTGACACTATTATGTACATGGTATTTGGTCTGTTAC ATGCACAGTACTAGTGACTGGAAAATGCTAAGCGCTTTTGAATATAAGGA GGTTTTACAAAAAGCAAGATCCATTTCTCAATTTAGAGAGCTCGTACCAT CATTCTTTCTTCTTCTTTTTTTCACAGCTGAAGTATGGCTTCATGGCGCA ATGTTGTTATTCACCTGGTTTTTCAACGCTACTTGCAAATCTCTTTGTTA TGAGATCAAGCGAAGTAAGTGCGATCAATTTGTATTAAAACCAACGAGCT TTACAGTCAACTTTTTCATATTGAAATCCTCTATAATTCGAATCTTTCAG TAATGCGAACTAGAACTTAAGCGCCTCAATCCCCTTGAATATTTTTCAAT ATTTTCTCAATGGATCAAAATTGAAATAAAAATGAGAGACTGTGACTCGG CAGCCAGAGTCCCATTTCAAGGATATCAAAATATTTGATATGGTCGTAAA TTAACAGGATTTTCATAAGTTTATCTGACAGAATCCATTTTCGATTCAGA AAAACAAAGGAAAGAAATCAAACACATGGCGAAATGAATATGTTCATGGA GTTTCGTGTGAAATTTACTCCACCACATTGTCGGATTATTTTGAGAATAT GTCGTTCCCAAAAGCTGCAG
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000084XLOC_000084Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000148-exon-sc0000001-1575043694:260770..260797TCONS_00000148-exon-sc0000001-1575043694:260770..260797Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:240389..240767TCONS_00000148-exon-sc0000001-1575043694:240389..240767Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:239139..239203TCONS_00000148-exon-sc0000001-1575043694:239139..239203Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:238601..238709TCONS_00000148-exon-sc0000001-1575043694:238601..238709Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:237763..237877TCONS_00000148-exon-sc0000001-1575043694:237763..237877Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:237021..237096TCONS_00000148-exon-sc0000001-1575043694:237021..237096Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:236263..236338TCONS_00000148-exon-sc0000001-1575043694:236263..236338Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:235167..235253TCONS_00000148-exon-sc0000001-1575043694:235167..235253Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:233689..233778TCONS_00000148-exon-sc0000001-1575043694:233689..233778Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:233235..233326TCONS_00000148-exon-sc0000001-1575043694:233235..233326Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:232537..232650TCONS_00000148-exon-sc0000001-1575043694:232537..232650Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:231556..231661TCONS_00000148-exon-sc0000001-1575043694:231556..231661Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:230741..230823TCONS_00000148-exon-sc0000001-1575043694:230741..230823Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:230408..230483TCONS_00000148-exon-sc0000001-1575043694:230408..230483Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:229525..229590TCONS_00000148-exon-sc0000001-1575043694:229525..229590Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:224684..224770TCONS_00000148-exon-sc0000001-1575043694:224684..224770Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1575043694:224278..224398TCONS_00000148-exon-sc0000001-1575043694:224278..224398Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:260770..260797TCONS_00000148-exon-sc0000001-1510915933:260770..260797Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:240389..240767TCONS_00000148-exon-sc0000001-1510915933:240389..240767Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:239139..239203TCONS_00000148-exon-sc0000001-1510915933:239139..239203Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:238601..238709TCONS_00000148-exon-sc0000001-1510915933:238601..238709Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:237763..237877TCONS_00000148-exon-sc0000001-1510915933:237763..237877Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:237021..237096TCONS_00000148-exon-sc0000001-1510915933:237021..237096Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:236263..236338TCONS_00000148-exon-sc0000001-1510915933:236263..236338Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:235167..235253TCONS_00000148-exon-sc0000001-1510915933:235167..235253Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:233689..233778TCONS_00000148-exon-sc0000001-1510915933:233689..233778Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:233235..233326TCONS_00000148-exon-sc0000001-1510915933:233235..233326Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:232537..232650TCONS_00000148-exon-sc0000001-1510915933:232537..232650Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:231556..231661TCONS_00000148-exon-sc0000001-1510915933:231556..231661Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:230741..230823TCONS_00000148-exon-sc0000001-1510915933:230741..230823Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:230408..230483TCONS_00000148-exon-sc0000001-1510915933:230408..230483Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:229525..229590TCONS_00000148-exon-sc0000001-1510915933:229525..229590Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:224684..224770TCONS_00000148-exon-sc0000001-1510915933:224684..224770Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1510915933:224278..224398TCONS_00000148-exon-sc0000001-1510915933:224278..224398Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:260770..260797TCONS_00000148-exon-sc0000001-1491911889:260770..260797Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:240389..240767TCONS_00000148-exon-sc0000001-1491911889:240389..240767Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:239139..239203TCONS_00000148-exon-sc0000001-1491911889:239139..239203Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:238601..238709TCONS_00000148-exon-sc0000001-1491911889:238601..238709Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:237763..237877TCONS_00000148-exon-sc0000001-1491911889:237763..237877Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:237021..237096TCONS_00000148-exon-sc0000001-1491911889:237021..237096Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:236263..236338TCONS_00000148-exon-sc0000001-1491911889:236263..236338Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:235167..235253TCONS_00000148-exon-sc0000001-1491911889:235167..235253Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:233689..233778TCONS_00000148-exon-sc0000001-1491911889:233689..233778Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:233235..233326TCONS_00000148-exon-sc0000001-1491911889:233235..233326Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:232537..232650TCONS_00000148-exon-sc0000001-1491911889:232537..232650Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:231556..231661TCONS_00000148-exon-sc0000001-1491911889:231556..231661Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:230741..230823TCONS_00000148-exon-sc0000001-1491911889:230741..230823Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:230408..230483TCONS_00000148-exon-sc0000001-1491911889:230408..230483Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:229525..229590TCONS_00000148-exon-sc0000001-1491911889:229525..229590Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:224684..224770TCONS_00000148-exon-sc0000001-1491911889:224684..224770Clytia hemisphaericaexon
TCONS_00000148-exon-sc0000001-1491911889:224278..224398TCONS_00000148-exon-sc0000001-1491911889:224278..224398Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:224278..260797 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0 2.48269 1.30816 8.30062 11.1026 7.99719 11.9962 8.22388 9.991 4.84485 5.74673 2.03979 2.95507 3.10813 3.10714 5.6075 6.22553 4.42425 5.67536 2.38454 3.75331 7.57913 6.77364 0.570348 0 0.0887379 1.15032
Blast
BLAST of TCONS_00000148 vs. Swiss-Prot (Human)
Match: KCMA1 (Calcium-activated potassium channel subunit alpha-1 OS=Homo sapiens GN=KCNMA1 PE=1 SV=2)

HSP 1 Score: 381.333 bits (978), Expect = 7.313e-118
Identity = 218/559 (39.00%), Postives = 330/559 (59.03%), Query Frame = 3
Query:  150 VTIDLPSN---ERSWYVYILASLAIYVSGFICILIGRIF---WKVIKKWQFKLPEDEK---------DSRKPMEEYK-------AWYLQLKEFAVNLDTGKSVLGKCLVVTSFVLNMAAFISYLFISYEFPIEYCDKHDFAHGIHTQIWLLELCLYSFFAFHFLLRFIIATDKLAFWGLNIYTLVDILTIPIVIIQALQQKAWLGLRFLRVVYIRKLPDILIYLNLLETGKFIEIGTVVVNFMTVVLSSTGMIHLVENTGDFWAPHNYSNSNPLNYFECLYFMIVTFSTVGYGDYSCKTIMGRIFCMIFIICGLGVFASSIPAIFGFISSYTKYDRKFKSTPGKKHVIVTGHITDESVSSFIQDFLHPDRQCESNVTVVFLAPNYPSTLIEGIIQKHPSSVFFFNGTVYNLKDCHRVKMSEADAVIVLCDKKSHNPESEDAANITRVVSMKKYFSKYHIRCIVQLMRRDNKALLENTTHWRKGEGDTIVCIDELKYGFMAQCCYSPGFSTLLANLFVMRSSEKNKGKKSNTWRNEYVHGVSCEIYSTTLSDYFENMSFP 1760
            VT+++P +   +R W+ ++ +S+  +  G   IL+ R     W V      K  E +K          + KP++E +        W   +K++A  + + +++ G+ LVV  F L++ A + Y FI    PIE C   +F      QI   ++    FF  +F LRFI A DKL FW L + ++VD  T+P V +     ++WLGLRFLR + + +  +IL +LN+L+T   I++  ++  F++  L++ G IHLVEN+GD W   N+ N+  L Y+EC+Y ++VT STVGYGD   KT +GR+F + FI+ GL +FAS +P I   I +  KY   + +  G+KH++V GHIT ESVS+F++DFLH DR  + NV +VFL    P+  +E + ++H + V F+ G+V N  D  RVK+  ADA ++L +K   +P++EDA+NI RV+S+K Y  K  IR I Q+++  NKA L N   W   EGD  +C+ ELK GF+AQ C + G ST+LANLF MRS  K    + +TW+  Y+ GVS E+Y+  LS  F  +SFP
Sbjct:   73 VTMEVPCDSRGQRMWWAFLASSMVTFFGGLFIILLWRTLKYLWTVCCHCGGKTKEAQKINNGSSQADGTLKPVDEKEEAVAAEVGWMTSVKDWAGVMISAQTLTGRVLVVLVFALSIGALVIY-FIDSSNPIESC--QNFYKDFTLQI---DMAFNVFFLLYFGLRFIAANDKLWFW-LEVNSVVDFFTVPPVFVSVYLNRSWLGLRFLRALRLIQFSEILQFLNILKTSNSIKLVNLLSIFISTWLTAAGFIHLVENSGDPW--ENFQNNQALTYWECVYLLMVTMSTVGYGDVYAKTTLGRLFMVFFILGGLAMFASYVPEIIELIGNRKKYGGSYSAVSGRKHIVVCGHITLESVSNFLKDFLHKDRD-DVNVEIVFLHNISPNLELEALFKRHFTQVEFYQGSVLNPHDLARVKIESADACLILANKYCADPDAEDASNIMRVISIKNYHPK--IRIITQMLQYHNKAHLLNIPSWNWKEGDDAICLAELKLGFIAQSCLAQGLSTMLANLFSMRSFIK---IEEDTWQKYYLEGVSNEMYTEYLSSAFVGLSFP 616          
The following BLAST results are available for this feature:
BLAST of TCONS_00000148 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
KCMA17.313e-11839.00Calcium-activated potassium channel subunit alpha-... [more]
back to top