TCONS_00000114 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000114
Unique NameTCONS_00000114
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length581

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000114 ID=TCONS_00000114|Name=TCONS_00000114|organism=Clytia hemisphaerica|type=transcript|length=581bp
TGAACAACGGAAAATATTATATATTCTGGGCAATTGATAACCAATTACAA
AACGATGTTGAAGTACCAGGATGGGGGACTGTTTACACCGACATCCAAGT
TTTGGTTACCGCTAAAGGATCGAATGTAGTGTCTGGTAAAATGAAAGAAC
TTAAGTTCCAACCTTCAAAAGGAATTACTTATAACAGtggattgttacaa
gaaatcaTTCCAAAATGGGGAAAATCATGGCTCATAAAAGTCTCATTCAA
AGTTGTAAAGCAACCAATAGAGAAATGgaattgtatttttcatttcgtaA
AAGATGGAGGCTACTTTAACCGTCTACCGACAATGTACTTCAAATCTGAC
ACAAACGAAGTACAATTTGTACTTTGCCAAGACCCTACAAATCGTAATCT
TTGCCTAAATACCTTCCTACCGTCATTTGTTTTAAATACAAAATATGATT
TCGAAATCAAACATCAATTGGAAGGAAATGGATATTATATGTCTGTTTAC
ATCAATGGCGTACTAGAAAAACGTGACGTTACTTTTACCAACCCGGGAGT
TTACGAGAATGTTGAAGTGTATATTGGACCA
Run BLAST on NCBI

transcript from alignment at sc0000001:2150344..2156560+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000114 ID=TCONS_00000114|Name=TCONS_00000114|organism=Clytia hemisphaerica|type=transcript|length=6217bp|location=Sequence derived from alignment at sc0000001:2150344..2156560+ (Clytia hemisphaerica)
TGAACAACGGAAAATATTATATATTCTGGGCAATTGATAACCAATTACAA AACGATGTTGAAGTACCAGGATGGGGGACTGTTTACACCGACATCCAAGT TTTGGTTACCGCTAAAGGATCGAATGTAGTGTCTGGTAAAATGAAAGAAC TTAAGTTCCAACCTTCAAAAGGTAAAAATAATTCtattacagtatgtggc ccccaaaacggcgatcaaatttgaaatttctctcatatctagaggaaaag agattttacaaaaatttttgctgcatgaaaacctttaacatNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNcaactgaaactgaaaatattaagcttt aaagatatttttctcctatattttgcaaaaaaatgacagaatttgccgtt tttgctgattcagcgaaaatttttatttttataatgttattttttgttat aaactattaactcaaggtgataggaatagaattccaagattttttgcttt ttctgatatttagaatttttggttttgtcaatgctgattcagggctccaa aatactggttgaccttcaagatgctatatcttttacccagcctctaaagt cacagatttacattttctgaacggcattaggtgtagaaagtttcctatac cccttattttcaatatccaagggagctagagtgagttatatgcaattttt atctaattttagttttaaaatatattctttagacgcaaatttgttatttt gaatccgtctcaaaccagcaaaaacatgctcatttttaagtataaccatc attctttcaaaataaaccaaaatcgtttaattctgataaatctacaagtc agaatcttcatttgaatgaaaacctccgttttgggggccgtctccgtttt gggggccatatactgtatgaAGAATCCTGATAGCNtctcgaaaaactata tagaagacttttaaacgggtatagccgatttcattacctaactcgagata attcacgcagaagatgctatttatggtcaattttgcccaaagtgtggcga aaagtggaacttgcgcatgaaatatctcgagttaggtaatggAAATCAGC gataaccgtttaaaagtcttctatatagtttttcgagtttcagctagatc ttatttttttcctacaaacagcctgtatttttgtaacacgaccacactat acAGTATGTGCCACTCtcctgaccatagtcggaaaaatagtcggaaaatt gattttagtatttgaacataaaagttctattttagattctttaacacttt taacaaagaacgTTATTAAAGAACGTTAATGACGTTacgaactttaaaaa gacgttaataatatgttgcatcaccttcttttataaaaagtgctaagttt taatgggtaattaacctttttgtttcgaagttttttcaaactgtcggcaa agaattgaaccgttttaaatttttcggaaaatttttcaaaattaatgcat caaaagttatgttatggttgtttttctataaaaaattgggatggaaaatt ggtcaaaaagcacgattttcaagattttgaatcgaataagcttttaaaaa aattttccgaaaaactaattttagttcgataaaataaactaagctcttca aagttgaaatactcttctgaGCAagagtcttcattttcttctttatcaat tttttttcattgcgattcttaaattttcagactcacagatggttggccta acagaaaatgtataacatgtcaaatTTTCTCCGCTACATTAATACAAATT AATACAATAtcttcagtacagcccgaaaaaaccggtcgttattgtatttg ttaaccgtttccttaagcttcgattgatttttagcgctttatctaGGAAA AATAgtgaaataaagcgaaaaaaaaaagcgaaaagagataaaaaattgtt ataatttctgagtcagtaataacaagcaacatgctgaatgaacctaccta atgattaacatcagttgaaaataagaaaaaagtgacaataattgtacaaa aattcagaatggaaaaaaNNacgaaaatcacttaaaccattcagacccaa aaaaccttttaagctgtttttggcccaaatttgcccaaaaaaaatttcct taaaaatctggctccgtcacattgtgggcattgtcattttgcatcattgt gcaaaaaatcagaaaaaaattatgagtcaacattgagaagctatattttc ttatttggttaaaaggaatttccccaaaatacgaaaatccgtcttttaac cctattcgtactagggggtggggggctctttctgttcggaggtcaaactc ttgctaatagctcctgaaataatagagcttttgccgtgaaattttctgta aattcctaacttttatNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNTCacaaaattgacacttttccaata caaatttattttcattgtcaaatatatcgtttaaaccgtaatttattgaa tatttagaataaaataagcattttaaacgcaggcaatttttttctaaagc atTTGTTAGAacacaatagctatttataagaacaaaggaaattttcggtt tttgctcactttaggcatgagtgacgtcatcaaaaaaaatttttgtcaaa agttaccttgcgtcacaaggatcttgtgtgccaaatttcatccaaaaaga cacactagatcaaaagttaaggggtggtacaggaaaagccccccccccta gttctgaaccgcccctaaaagcctaagttgaatagggttaaggcgaataa gaattttccaggaaaaaacacttaagccattctttaaagaatcttgccct ccatctttgtacaaaatatcagaaaaaagtaatgacaggattttgcacaa agtccaaaaaaccctatttttaggtagtttttggcccaaatttgcccaaa tattatttttttcgaaaatcgggctccgtcacattttaggcattgccatt ttgcatcattgtgcaaaaaatcagaaaaaaataatgattcaactttgaga aaagctatattttcttatttggttaaagggagtttccccaaaatacgaaa atccgttttttaaggcgaataagaattttccgggaaaaaccacttcagcc attctttagagaatcttgccctccatcttNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaatcagaaa aaagtaatgacagaattttgcacaaagtccaaaaaaccctatttttaggt agtttttggcccaaatttgcccaaataaattttttctcaaaactcgggct ccgtcacgttctgggcattgccattttgcatcattgtgcaaaaaatcaga aaaaactaatgagccaatcctgagaaaaNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNaacgcattgttcattttcctttgaaaaagtgacgtca caatgaattttcctaacgacgggcaactctggacagtgtaggcccgtcgt catgcgaaatgaaacaatgaattgcgcaaaaagccgtgtagctcgcttcg aaaaagtaaccggttaacaataggcaaaaatgcatattttgaatgtggca aatattaaaaattcactatggtcagagcccttaagggtaccttttttgga tttccaaagtcccgctaagggtcggaaaaatctgTAAGTAGCGTAGACAT TTATGGAAGAGTGCTGGTTTTTAAAACACTGCAATACACAGGATGCGAAA TTAAAGTCTGAAAataaatcacgcttttactcgaaatttttatgtgcttg ttacatgacatttctgattggttcaaatttattgacactaataaagttat cagctgtaagttgtaaagcaagtaacataaaatcacgtgaacgttttcga gtaatcacatgttttgactaaACTGATATCAtgttgcaacccgtgtatta gctattcataatataaaagaATTATTAGTGTGTCATAAAATCTGAATtcc tcttgtctacgctactgactCCCCAAGATACTTGAAAACCTAAATCTAAA GAACCGCAAGCCACGTGGGTCCGTTAAACTTACAACCTcgagttttttta attcaaagggagaatcaaaatggtttgagaTAATTGGCcagcataaaatt tctttgGTCCAGAGTAAAGCCTTCTATTGTATTTTTGTCTAACTATTTCT CAAAGCGGAGATAtcccaatttgaaatttctaaaaatgggtTCCTTTACA GTTCTTAGGTCAAAATTCTATTTGTTTTCTTACTAAAATTCAAAACTTGT AACTTGGATTTTTGGaccccgattttcgaaaatagcaaaaatattttgag attttaatgATGAAACTAGAAGGAATTCACacgccaaatatctcaaacca tttAATAACCCTTTTAACTTTGAActtataaagcattaaaaactaTTTCT TTTATAGGAATTACTTATAACAGtggattgttacaagaaatcaTTCCAAA ATGGGGAAAATCATGGCTCATAAAAGTCTCATTCAAAGTTGTAAAGCAAC CAATAGAGAAATGgaattgtatttttcatttcgtaAAAGATGGAGGCTAC TTTAACCGTCTACCGACAATGTACTTCAAATCTGACACAAACGAAGTACA ATTTGTACTTTGCCAAGACCCTACAAATCGTAATCTTTGCCTAAATACCT TCCTACCGTCATTTGTTTTAAATACAAAATATGATTTCGAAATCAAACAT CAATTGGAAGGAAATGGATATTATATGTCTGTTTACATCAATGGCGTACT AGAAAAACGTGACGTTACTTTTACCAACCCGGGAGTTTACGAGAATGTTG AAGTGTATATTGGACCA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000061XLOC_000061Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000114-exon-sc0000001-1491911889:2150344..2150514TCONS_00000114-exon-sc0000001-1491911889:2150344..2150514Clytia hemisphaericaexon
TCONS_00000114-exon-sc0000001-1510915933:2150344..2150514TCONS_00000114-exon-sc0000001-1510915933:2150344..2150514Clytia hemisphaericaexon
TCONS_00000114-exon-sc0000001-1491911889:2156151..2156560TCONS_00000114-exon-sc0000001-1491911889:2156151..2156560Clytia hemisphaericaexon
TCONS_00000114-exon-sc0000001-1510915933:2156151..2156560TCONS_00000114-exon-sc0000001-1510915933:2156151..2156560Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2150344..2156560 +
Expression

Hover the mouse over a column in the graph to view expression values.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0 0.257224 0 0.245227 0.114789 0 0 0 0 1.61196 0.829231 0.269283 0.0893579 0 0.525561 0.171352 1.00171 1.14616 0.733892 0.167251 0.810423 0.786735 0.920727 0 0.139563 0 0.107848
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00000114 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Spatial Expression
in the tripal_feature_cv_term.tpl.php