TCONS_00000003 (transcript) - C. hemisphaerica

Overview
Name
Unique NameTCONS_00000003
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length4576

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000003 ID=TCONS_00000003|Name=|organism=Clytia hemisphaerica|type=transcript|length=4576bp
CTTAAAGAATTTAATATTAACTTAATTAAACCATCGATTGTTTTCTTCGC
TTTTAGATATTCTTGAAAATCACAAACTAATAGAATCGATGAAATGGTAA
TACTGAATAATAAAAGAAGTTTATTTAACAGAATTTGTTTCTGGTGCATA
TTTGGCAGTATGGATCTCAAGAATAGAACAGTGGAAAAAAGACTTAATAT
AATCTGAAGAACCTAaagatatgaaaatgaaaagagtTACAAAAAGTGAA
GATGCTTTGATGTTTGGAGATGCATTTATGGAACGACCATCCAGCTCCTT
TCCACCCTGATTTATAATGCTATATTTGCTCTACACGCTATCGAGCCAGC
TCTTAAATGATGTTCAACAGCAACATAAATAATGATATATTGGTTGATAA
ATCTATATTGATAGCACCTGAATGGAGCGTATCtttcaataaaagtgaaa
ttcaaaGACTGGACAATTCGTGTCAATCCATCAATGGAGATGCGCGTGTT
TTGGTACTTATCGTGGAAGAATAAACATTGAACGGATGATTGTTAGTTCT
AATCAACGCAAAAGCCTGGATAATATCCTTGATGGGTAAAATATGGGTAA
ATGGGTAAAATATTGGAATAATATGGAAATTTAAAATATATCAATATACA
GCGAACGGAGCTTTTGCTTTTAATATAAATACCTTGATGCTTACAATTAT
TGATGATGGCTGGGATGCACAAGTTGGaaagttgaaaagtcaaaatgTTA
GTTTGTTGTATAAATTCATCAACACGAAAGAAAATTAATACACAAAAGTT
GTCAGCTGGAACTGCATTCTGGTATAAATACATCAACACAAAATCATCAT
aacttgaaaatgttgaaaaccaCGTGACATGAGAAATGTTCAAAATGTTT
TGGATCAAGCAACAAATATCATCAACAGATGTGAAGATTCTTAATTCGAA
AATTTACAAAGATGTCTTGGTTGCTTCTGGATAGTTGATAATTGATAAAG
CTGGGCGTTACATCTAAAATATTGAAAGTCATTAAATACAGTAAAAACTA
TGGCGAGTGCAGCTTGTCGTATTGAAGTCGAGATCCCGGCAGATGAACGG
AAATGGCCATGGTTTTTAGTGGTTTCCGGGTTAATCTTTAGTTCCGgttt
aattttaattatcatcGGACGTATTTTGTTATATTTCTTCCATGGCGCTA
AAAGAAGATCGAATAGTGTGATTGATATGAATGAGGTGGACGAATTGGAG
GAAGAGGAATTCTTCTTGGAAGATTTAGAACAAGGATGGTATTTAGATTT
GAAAGAAGGTGCTGGCAATCTTGTGTCTGCTCAAACATTACAAGGACGTA
TATTGGTTGTTTTGTCGTTTGTATTCAACTTGGCAGAATGCGCACTCTAT
ATCACAGAAACAGGATATCCAATCGAGCATTGTTTGGATTTGTCCGATCA
AACATTATGGAGAGTTGAAATTTGTTTGAAcgctttcttcatttttcatt
ttctcattcGGTTCATTGCGGCGAACGACAAATTATCTTTTTGGGCAATG
GAACCTTTAACGTACGTTGATATTGTGACTGTACCAGCCGTCTTTGTGGC
TGTCTATCTTGGCCGAAACTGGCTAGgtcTCCGCTTTCTACGTGTCATCT
ATTTGATCAACTTGGCAGATATCCTACAATTTCTCAACGTACTCCACACA
GGTTCAAGTCTTGAGATGGCACAGATGATTGGTAATTTCTTGGCTTTGAC
TCTGGCGTCAGCTGGTATTGTTCATTTGttgGAGAACACTGGTGATCCAT
GGGAGCCTATCAACTACACCAACAAACAGAAATTGAATTACTTCGAATGT
CTCTATTTTCTATTCGTAACCATGTCAACGGTTGGTTATGGTGATATATA
TTGTCATACGTATCTTGGAAGGTTGTTTAATATTGGTTTCATCTCTGTTG
GCCTGgGTCTATTTACATCATACCTACCAGCTATCCAAGAATTCTTAGCT
TCACATACGAAATATGATAGAGCTTTCAAGCCTACACCAGGGAAAAGGCA
TGTCATTGTTGCCGGATACATCACCGAAGAAAGTGTGACtgggtttttca
aagatttcttgCATCCTGATCGAGAAGATAGTCAAACCACTGTCGTTATA
TTGTCACCGAAATATCCGAGTTTGAAGATGCAAGCCGACTTGCAAAGACA
TTGTACAAAAGCTTCATATTTTATTGGCACCATCTACAAGTTCATGGACT
GCCATCGGACTAGGATGCGAGAAGCAGATGCAGTCATCATTCTTTGTAAC
AAGAAATGTATAAGTCCCGATGAAGAAGACGCCGCTAACATTACAAGGGT
GATTTCAGTGAAGAATTATCACGAGAACATTCGATGTATCGTACAACTCA
TGATGAACAAAAACAAGTCACATTTATTGAATTGTCCACAATGGAATCGG
GAACTTGGTGATGACATCATTTGCATTGATGAGttGAAACTTGGATTCGT
GGCACAAAGTTGTAATGCACCTGGATTCTCAACGTTGCTGGCAAATCTAT
TCGCTATGAGGAGCGATACGATAAGCGAGGAGATTCAAGAATCAGAGAAA
TGGAAAGTAGCGTACATGATTGGTGCAGCAAATGAGATGTACACAGCTCA
ACTATCGAATGCTTTCATTGGAATGTCCTTCCCACAAGCAGTAGAattat
gttttgaaaaattgaatttaatgtTGATTGCCATcgaaatgaaaatctca
aaaaaagagCGATACTTTGCTATCAATCCCAATGACAAGAAGTTGAGACT
TTTACCAGGAACGCGTGGTTTCTTTTTCGCTCAAGACGCCAGCGATGTTG
CGAAAGCATCGAAATATTGTGCGAAGTGTCACAAAGACCTTCAAGATCCT
GAACGAATGGTCAAATGTAAATGCAGACGACGTATGAAACAAGAACAGGA
AAAGAAGAATCCAGCTCAGAAAGGAAAATACGAAACAAAAGTCGATGTTG
ATCCAGTGCATTTGCTCGAAGCCGAACCCGATGAAGCTAAAAAGGATAAA
CAATCATTGACGGGAGACTATTTTGCAAGTGGTGAAAAACCAAAGTTTGA
CCAAAGTGGGACGTTTTATTGGTGCGAAACAAGAAGCTACATATCTGCCA
GGAtgAGTCTCGGTGATGCTGCAGAAAGGAAGTTCAAGAACCATGTTGTT
GTGTTGGTTTTATCACAACGTCTTTCACCACCGCTTGGTTTAAGACAACT
TGTACTTCCATTGCGTGCAAGCAATCGTCTGCCGCACGATGTCAAAAAAG
TTGTCATTCTTGGAGATGGAGATTTCTTAGCTCGCGAGtgGCCGACGCTG
GCGAATTTCCCTGATGTTGACATCGTACCTGGTTCGCCTTACAACCGTTC
CGATTTACGGGCAGTCAATGTGAATACAGCGGACATGTGTATTTTGTTAT
CACCCGGACATGGTAGCGAGGAAGATGAGCACCAAGCTCTCTCTGATAAA
GAAGTCATCCTGGTTACTTTGAATTTGAaagCCATGACTTTTGACGAATC
AGAACTAGCAGTCACGGAGGAGATCAAGAAAGTCGATTCGTCACGAGGAA
CTTCTATCAACGGTGAAAGTTCTGCCGATGTACGGGTGGGATTCTCATCG
GGCGCCAATTCAAGGGCGGCCACCCGTATGACTGGACGCCCTGAAACTTC
AATGTCTCACATGACAGCGGGCGGTAATAGTATGATACAAGAAGTCAAGA
AAACGTTTAAAGGAGCTTTGAATGGAGCTAACATCCCTATGATCACTGAA
CTTGTATGTGATTCGAATGCGATGTACATTGATCAAGATGATATGAACAT
CTATGATGATGATGGAATCTTTTTAACGCAACCGTACGCTTGCGGCTCCG
CTTTCACCGTATCGGTTCTCGATTCACTCGTCAGTGCGACATATTTCAAC
AGTGACGTATTAACACTTGTCCGTAATCTGGTCACCGGTTCTGTGAGTCC
GGAACTGGACGAATTGTTAGCAGAAGGCAAGCAGCCGTCCGGTTCGTACG
AAACACAAGAGATTGCCGCTGTCAGGAACAGATGTCGGGTGGCACAAATT
TCTTTGTTTGAAGGGCCTTTATCTGAATATGGGGAATGTGGTTTATTCGG
TGATCTATTTTTGTACGCTCTCCGTACGTACAACATGATCTGTTTGGGTC
TCTACCGATTCCGAGATTCGCAACGTATGAAGGACAAAATACCAAGCACG
AAACGTTACGTCATCACGTTCCCGCCctttaattttgttttggatCCAAC
TGATCTGGTCTTTGTTTTAATGCAGTTCGAAAAACCGAAACGTAAAAGGA
AATCTGTGTCTCGTGTTGGCTCTGTGGCGTCGCGATTTTCAGGCGctttt
taactttgttttttgaTAGCATTGACTTGTAGGTTTTtatatcttttgtt
ttttttaatctttttaaaacccTAATCACGTACTTCTATTACTTTTCAAT
TGTCTTGTTAAGATTTACAAATTATACCTAAAATTCTATGATCCAGGGGT
CTTATATAGACCCAGCGAACGGCGAC
Run BLAST on NCBI

transcript from alignment at sc0000001:38516..84744+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000003 ID=TCONS_00000003|Name=TCONS_00000003|organism=Clytia hemisphaerica|type=transcript|length=46229bp|location=Sequence derived from alignment at sc0000001:38516..84744+ (Clytia hemisphaerica)
CTTAAAGAATTTAATATTAACTTAATTAAACCATCGATTGTTTTCTTCGC TTTTAGATATTCTTGAAAATCACAAACTAATAGAATCGATGAAATGGTAA TACTGAATAATAAAAGAAGTTTATTTAACAGAATTTGTTTCTGGTGCATA TTTGGCAGTATGGATCTCAAGAATAGAACAGTGGAAAAAAGACTTAATAT AATCTGAAGAACCTAaagatatgaaaatgaaaagagtTACAAAAAGTGAA GATGCTTTGATGTTTGGAGATGCATTTATGGAACGACCATCCAGCTCCTT TCCACCCTGATTTATAATGCTATATTTGCTCTACACGCTATCGAGCCAGC TCTTAAATGATGTTCAACAGCAACATAAATAATGATATATTGGTTGATAA ATCTATATTGATAGCACCTGAATGGAGCGTATCtttcaataaaagtgaaa ttcaaaGACTGGACAATTCGTGTCAATCCATCAATGGAGATGCGCGTGTT TTGGTACTTATCGTGGAAGAATAAACATTGAACGGATGATTGTTAGTTCT AATCAACGCAAAAGCCTGGATAATATCCTTGATGGGTAAAATATGGGTAA ATGGGTAAAATATTGGAATAATATGGAAATTTAAAATATATCAATATACA GCGAACGGAGCTTTTGCTTTTAATATAAATACCTTGATGCTTACAATTAT TGATGATGGCTGGGATGCACAAGTTGGaaagttgaaaagtcaaaatgTTA GTTTGTTGTATAAATTCATCAACACGAAAGAAAATTAATACACAAAAGTT GTCAGCTGGAACTGCATTCTGGTATAAATACATCAACACAAAATCATCAT aacttgaaaatgttgaaaaccaCGTGACATGAGAAATGTTCAAAATGTTT TGGATCAAGCAACAAATATCATCAACAGATGTGAAGTAAGTCATTTCATC TTCGACTCCATTacgattttctttttatatataacAAGACGCCTTagcgg cgtgaaggcccagcgattGTCTTCTTATTCCATGTTGTTTACGCTTATGG GAATAACgcttgtaatttttttatctgcCTGTGTTTAATTTATAAACTAA TAATTGTGAGGTACATTTTGTCTGAATCTGATATTGGACgctttttgtac tatttttccTGTTACAACTACCATATATATaagcagtgtagacctaactc ttcatacaaaaattacgggaaacgcatatttggactttgtaccctatgct gcactcaagcacttgggccaaaatcccgcaaaggcgggacaaaaatcagt tttttgaagtttgcNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNcaaaaaaacgccacatagaagatctttca aattcagtatgtgaatagagcagtaaaaaatacaacttttctatttttcc ttttttttgcaaaagttctattctaggaatgaaaataaagggataatgat aattgaatactatccattgatgatccgcggcattatcgtaaagctagaat cgcttgttggaatgtttataaggctcttgacagaatattgtttgttttat tgtcaatgatgacagtgccgttataaattttgttagatctgacaaattga tgtttgtaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNtgatgtttgtaagtgcactttatagttttgattcccattgaagaatc atattctggttttcatgttattagatgctgttttagagctttagagctac actgataagtagtaagtctgcgaccgcagtcggaggcgacccgaaggctc ctctctttcgatagctatctacccgaaggtaggggagggcgccactcttt ctccctggatttctccacttacccttgatccttctcttagttgctgagca tNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgcaagtaccatttt gggaatctttggtatgacccggctgggggttgaacccacaaccttgcgaa ccgtagccggatgctctaccactgtactacggtcgacCATATATATAGAG GTTTAAAATTTGAACTAATGATAAAGGCACTTATAAAAGGGATTCAATTA TTTCGCTATTTTGGTATACACAGGGGAAAAACTactaaaataatgttttt ccTTTGAAGAGATAATTATTTGGATGAGGGTGTTTGGAGTTTAAATCTCA TAGTAGATCTTTATAACAAGGGAACTCATAGAACTGAcaatccaaaaaaa taatactacATATATACAGCTGCATAAACGACgcttaaaaaaatcataaa aattgaattatagTTTACAAAACGCACCATAATAAACAATcctttaattt ttcattaaatattaATCATATTGTTTTATTTGTTGAAAATAGCCAACATT TATTAGACGATGACAGTTATAAATGCTCTGTTCCTACCCCCTAAacatat tattttctttgtatatattttgtttattttttatgtcctATATTCCGCTT CTTTTTAAAACTGTANTAGCATTCCTCAtctattcctcgaacgttcctga gGAATGGACATTTTATGACGTTATTCTTAAGCGTTCATCACTCGTTCCTC GAATGTTCCTCAGGAACGGACATTTATGACGTTAATTTTAGGCGTTCCTC ACTCATTCCTCAAAcattcctcaggaatggagatatttcttcttcacttt atCGTTCCTCATCTTTTCCTCGAACGTGCCTGAAGAATGGGCTTTCATGA CGTTATTTAAAAGTGTTCCTCGTTTGTTCCtcaggaaaatatattttcgg aGCATTTAATACATTTTCATGGATAAgatattcaatatcaaaaactttta tgtCGTTTAAAATTTCAGGCTCTGCCTCCAGAGAAAGAGAGAGGGCTNgc tattaataagcatacatcaatgttcttagccaaattactcaattttttta tgagatagatgtttcacagccccggtggaactttttcctcaatGGGAATA ggaattttattgttccaaggtggaacaaaaatccagtggggatggttttg gagtgcaattcttAAACATTGAatctcgaatggggatgaaaatccagggt attttcccaccagggaagaatttttgcaaaattttccagTAGTGATGAGG TCTCAGAGGGTCTGTGGCACAGGATCTTATTTGTGTTTGAGCATGaagtt ttggtttctaaacTCGTTTTTTCGGCTGCAAatacaatgattttttttga cgtttcaaaaaatctttcacgTGTCtaattataattataatttgAATAAT TGCAAAAGAATTAACCAAAAATTGTATTGGGCATAATATAATACGTCAAA GTGATGAACACTTTACATGaatgtccattcctgaggaacgttcgaggaat agaTGACTCTCTATGAGGAAcaataaagtgaaaaagaaatatctccattc ctgaggaacgttcgaggaacgagtgaggaacgCTTAAAAATAACGTCATG AAACTCCATttctgaggaacgttcgaggaacgttcgaggaacgagtgagg aacgtttaaaaataacgtcagaaatgtccattcctgaggaacgagTGAGG GATGCTTGAAAATAACGTCATGAaagtccattcctgaggaatgttcgagg aacgagtgaggaacgtttaaaaataacgtcagaaatgtccattcctgagg aacgagTGAGGGATGCTTGAAAATAACGTCATGAaagtccattcctgagg aatgttcgaggaacgagtgaggaacacctaaaaataacgtcataaatgtc cattcctcaggaacgttcgaggaatagatgaggaatgctaaaacaaagtt ttgaaatatccattcctgaggaacttTCGAGGAACGCTGAGGAATGGTGA GGAATAGAAGAGGAATATTGAGGAATGGAGATGTCCGTGAGGAATGGTGA TCGGGTTAGTAGTGATACTAGATGGgaaggaactgggattggattgccac tatccaaccctgtggctctcacacacattttacagttcaaagaataagat ggaaagagtggggaaagaatgagaatttaNTTTTGAGTTCAAGCTCATCT GGATAGATATCTCTATATACAGACTGAAACAAGTATATATATCTACCGAG AAATTTCAATGTTGACAATTTGGACAGAATTCACAAAAAAAGTATGGCAT TCTAATTTTGTTTAAGATTTCAATTAATAGTATATTAAGAAAGGTAGTCA AAAGATTTCCCACAAACAGTTAGTCACATTAGCATCCTAccgaaatgcgt atcaaagattaatgctgccaTTTTGCACTATATCGGTTACTTGAAGCAAG AAAATGCGTCGCAAAACTTCTAATAGGATTCATAGAAAATATACTgacgc tttttaatgaaattaatatttttatgagaaattaccaaaattttgagcta tagatgaaaaaatttgagctgagccaaccttgaaaactaatttgaagaac aacttctcaagaaaaaatATACGGTGGAGAAGACCTACATCCATGCACCA ACGGATAGGAACCTCAATATCTCCGTtatattttgaaaggaatttttcCA GAAATTATCAGTCGGTCGGACGacaaacacaagttatttgtgattgtgGC TTAAACCAATCTAGGTATTGGTAAACAATGACTGTCGTCAGTAAAATCTG TAAAGTTATCGGAAATCGAACGAGTCACTACATCCGGGAGGTCACATATC TCAAACATCTTTGGTCGTTTAAGCATTCCATTTACACCTGAACCTTTAAA CCTTCAATGATACACCAAAAGTGCAATCAAATTTATAGAGTTTCGTCAGG AAATTTACAATTCAATTTGATTGTCCATTCTGTTTGATTGGATATGATAt gacttgaaactttcaaaaGCTTGACTTTTATAGCGTCACCTGACCAATCC AACGTTtgctctgttttgtttttgccatACATCAATTTTGTTTAACTGTA TATCAATAAGTATTTACATACAATACATATATACATCTGTGATAAAAAGC TGATATGATAATCAGACTGTACAGACTGTATCGTATAAAAGTCCAATAAG TTTCATGGTGTTTCATGCCGTCATGGGGCATGGATGGCGCACAATGACCA ATGTTGAATAACGTCAATGTAAACAATGGTAGTAAAAACTTGCATGGAGA TCATAACCATCGGCCAGCATGATTCAACACcattgattttttggaaattt tatttccaGTCACCAACCATTTAATATTCACATTTTGATTTGTCttgttt ttcttgtaaaaaagttgTACTGTAGCGGCAGCTGCTAGTTATTGATTTCT CGCTTAATACTCGAGCAAATCTTAATatgaatcaaaattataaaaaaatg aGTATCAGCCCCTATGTACGAGGTTGATTTCATCTTCACTCGGTTATACT AAGTTTGTATAGGTCTTACCGTATGTGGATTAAATTTCCTGTGTATTCAT TTTTCAGCGATTTTCGctatttttggccattttcacgAAAATCAGTCCTC ccaaaaagatttaaaatccGAAATNcgatttttgcgatttttggccattt tcacgAAAATTAGTcctcaaaaaaagatttaaaatccGAATATTGGCCCC GAGGGAAATAAAAGAGGCTGATTATCGCGAAAATTTGTCCATTAAAGATC TTCTGTTCTTAATTGGCAGGCAAAAGCTTTTTGCTTCGAATCTAATTTCT TACCACAATCTTACCACTGTGAAGAATGTGATGTTTGTATAAAAAAGGTC CTCGTAATTAATGCCAATTCTTATCATCTCATGATATACCTTTGTTGAAC ATCTTTGGATTGCAGTGATAGCTTCAAGATAATAATTTTTATCAGAACAC GTTTTTGTTAACCATGCAGAGAACAGTCAACTACATTTTCCATTCCTGTT GTTTATAAGAAGAATTGTGAGTAGGATTTGACGAGTAAATAGAATTTAGA ATTTTGAGAGTGGAAGATAATAGTTTTTCCCAGTCCCCCTACAGTGCTAT ACCGTCTTGGAAGAATTTCTGTCGCAATGAAGTATATAAAAACAcatccc cggtggaactttttgcCAAGTCcttgaaatcctaatggggatagcaattc tattgttccaaggttaaataattcagtggggatggttttggagtgcaatt tttaaaacattgaatttcgaaacgggatgaaatcaaagtcactTTCCAAG TGgagctgaaattccagggtattttcccaccgggtatgaaatttttgcca aatgtTCCAATGGAGCTgaccaccgggtctgtgacaaagGCTTTTCCATC TTAAAAATTCAGCATAATTCACCAAACATTCAAGAATATGTGCtgatttg ctgtgtaaaattcAATTTCCTGCCCAGGCCTTGTGTCACTGTGTCTAAGA AATAACGTTTTTCCTTAGCCTGGAAATCTAACCTACTTTAATTCAGTCAC AAGGATGAATTTGATGGTAAGTTGTAACTGAATAAATGTTCAATATTCCA AGGCAAATTTAAAAtctgtaaatataaaaaatctttaaagcgccgaaaac gctatattgtcATTAGCCgcgtgtcctagccttgtgaatacgggctttgT TAACTAGGCTAGTTTTTCCTATCAATAAAGTTCTTATAAGAGAAAATAAG ATGTCTGAAGAAGACTTATCTATGGATTAGTTTTTCACTCCTTGCTGTAT TACATCTGATATACgttattattttaaaaataaatcttttccCAATCGAT AAAATCGTCATTAATAATTCATTGTCAGATCTATGcagtatttaaaaatt tatttatgtTTTAGAAAAGAAATGTTGAGATGATGATTataacagaaaga aaaatagttttaaaaagattttaatagaatcttttctttttttaaggcGT TTTGAAACAGCTCAAACTGCTCAAAGTTGGAAGAAGTTTAGATTTTAGTT TagaaaaaatctctttttattTGGTGTCCCCTTTTGGTCGATTCTTGTCT TAGGCAGTATTTTGAGGCAATCAGAAATTAACTATGTGTTATTGGCTACT TTAGTTATAAATTTGGTTACACTCATTCCCACAAAAAGGCCTTGTTAAAA TTTACACGCCGTATCTAGAACCTTAGCACAATGTTATGGCTGAACCAAAT TTACCTGAAATTTCTGATTGAATAcaaatatttcttataaaaaatcttca CCAAAAAcagtataattttttattaaaattcttAAGTATTTTATCTCACT GCtatgaatattgaatatatattcatgaaacttttttatatataatacaA ATTGATAAGACTGTGACAAAATGTTGATTGCTATTAGtataatatttttc atatatttcataatataatgaaaaacgaaaagttttcttaaaaaaatttg gaaCTCGTTGTTGTTAtggtaaaataatatttctagaataattttttaaa gatgTCGATGACAAATGTTCTCTAATTTGTCGGACAGTTTTACAGTTCAC GCTCTCTTGGTCGATTTtaaaggggaattggattttcatcgaataaggga gcatatcgaatagtagagtgtTGTTTCTCGCGTTGATGGTggtttcaata ttttataaaaatgaagtgtattgaatagtagaacgtcgctTTATGAGAGT TTTATACACCCATATcttacagccccggtgaaactttttcctacaAGGCC CTTACAACGgtgataaaattttgattaaaatctcaatggggataaaaatt ttattggtccagtggggatggtttcggAGTGCAATTGctaaacaatgaat ttcgaatggggatgaaatcaaagtcaatttctcagtggggctgaaatttt agggtatttctcccaccggggacgaaatttttgctaaaCTTTCCAGCGGG TCTTGTTTGACGGtgattttcaatattatcgaagaAAGGAGTGCTTGAAA TAGTAgaaggtcgaattagagagagtcaactgaaGAAGTTTGTGGTACTG TctgtgaaaaatatttcacctTTGCGTATATGAAGTTGAAGACTCTTGAT AATTCaaacttcaactttttttcctcagtggggataaaattcctattgaa atcccaatgcaATGGGAATAGCAATTCTAAGGTTAAAAATCACAGCAAGG ATGgctttggagtacaatttttagtgaGCTCCATTTAAGAATAAATAAAG TGAGCTGGGTTCGAATTTgagaataaataaattttgaagttttatttttt ttggctcATACTCTAAATAAGTGATACTTACACTTCCAtctttttcttat aataaattTCTTACAATGGCATTCTCTGTAAATTACTTGGGGAAAACTGG CAATCTACAGTTAGCATTCTTAGATTTTGTTGCCTAATTCcacgatggtg atattcttagcatattcttaattttttggcaaatttcttcatgaatattc ttataaagtatgttATTATATCAAAAAGTGTGTATTTCTAAGCTATGGGA TTTCTATTTTCCAGTCTCAACTTTGAATGTGAAAAAACAACTTTATTCTA ACTCATTTTCCTATATAAATAATTGCCATGTTTTAGGGAAAAATTAGCAA ATATATGAGttcttctttctttcatttttcaaacaatcTTCTAATTTTCC tatgttgttttttcaaaaagtaattTTCTCTATTTATCAACGTAAAACAA GCCTCTAAACATTATCATAACATAGACTTGTGAGAATCAGTATGAAATTC TGTTATCTTGAAGCTGTTTTTTGAACCAATTTCTCTTGATgatattattt ttatcaaaatatttggaaattttctactgattttttttctctgaaaattc TGTTTCCTTTTCATAGAAGAGAAGTAAATTTACGTTCTGTGGCCTACTTT TGTGATAGGATTAGATTTTAGAATTGTATCTCTAGTTTTCAGTTTGTAGG TTAATGATTTTTGCGAGTTTTGAGATAACTGGGTACATGCTTAAAAAGTT TAGCAAAACATCCTCGTCTCCTGTGATAAAAATTTCCCGTGTAAAACTAA TCGTAACGCTCATCACTGTCATCAGCCATGGGAATGGTACCATAGGACTA CGATGCGATGGTAAAAAAGCTATGGTGATTCCCAGATATAACAATAAAAT TCAATCTCCATCCTTTGAAAACGAGAGATTTTCAACTTAAATACCATTTG GCTAACGAATTCTCACTGCTGGTCACTGAGATAGGGCTGTCtttagaaaa caaagaaaatttgcaTGCAAATTGGAACTTGGGTCCTTATTTTGACCCCA TTTTGATCAAAGGGTATACATTTATCACTGGAATATTATAAGGAAGTTGA GCTtaaatttttatgatttatgttgaataaagtaattttttatttggctt gaaggttttgtttttaacctttccagcgcactgttttttatattttcacg ctttctgcgcgcaacttttttttgagaaaacgcgATGTTTGGGAAATTTg ccataactcaagaactagaaatcttttggcaaaaagtaaactatccctga aaagctaattaAGTTTTACAGCTTTTAGGTTGGGTACAAGTTCAATTAAA GTATTCTAACTTAAATGGTAGCTTTACATACACCAatgcttttttcctca tttttcgacaatgtcacttttttggcatttttcactttctatGCAAAGAA AAGTGGGGGAAAGTTAattataaaatctttctttactATTTTATCAATAT ATACTTACTCATGAAGCCATAAACCAAAAATTAGCATCCAAAAACAATTC TACTGGTCACAAGGGCTTTTCAAACATTGTTCACTTTTCTCCAAAATCAG TGTNNNNNNNNNNNNNNNNNNNNNNNNTGCCATCTTGAatcagtgttttt atttgaaaagtgctgactcacaccgtgatcataacattacatcattatat atcaacggaaagcttagactctctactctctttttctttatttttcaacg atCAGAAAGCAAGCCAATTAAAGATATTGCGCGAGAAAGACATGCCTATC AAATTgcgtatatgtacggcattcggaacgtctcaaggacgtatatgtac ggcattcgggtccaaaaggttaaaaaagagtggtatcgtttgcttactca tcaattttaattcgcaAGCTTTTACACTTTAGATtggcacgaatgtggag caagtttggtcagaaagaggaaaagaaaaacgtttttttgcttatatcag cataacataacaataggcagacactgttctgatatgaaatatgtgtctga tatgaaacgggaacagttattttaaaagcaaaacctttAATGCTAATCTT GTCAGTTCGCgattaaaaaaataagacaaagTAATGTTTTTCTCAAATTG TGATTTTCAAAGGTCAATTTGGTCAACAGAGTATCCAGTCTATAGTTCAT TAGGTTAAAAAGGTGTTGATTTTTTAGCCAAACCTGAAATACAACGTTTT TTATGGTTCTTATATACCCagcaggcacacaacgttgtttcaacgtttat ttaacgttcccaacgttcatataacgttagatgaacgttgaaacaacgtt gtgtgcaagcTGGGTAGCTTTACTTTTTGGGCGATTTGAATGTTAGATGA CAGATGGAGTACTTTGTGATAGATTAAGTTGAATCATGATAGATAATATT TCTCGGTAGAAGCTtatgaaatattgaaatattacaCGCAGAGCATTTTG TACTCTGTGCCACAGTGTATCTTTACGTATAATGTTGCGTGGAACgtcaa ttaattttgaaattgccACGAATATCAGGTCTATTTACAGACAAAACACT TTATATATATGCTCCTTTCTAAAGAAGCACCATTTGttactattttgtat ttatgtGTGGTTTGTATGTAGTATGCAGTCCTGCCGAGTcttaataagga cgaaatgcttATACGTCTCAGCCACCCAGATCTCCTGAATggatatagtt ggacagaaattcttattttttcacatatgccttatcggggaaaacttcgt cggggaaaagtgacaaattttggccaagtgacgaatatttttccccgacg aaaattttccccgaccttaatgcgtttaccaactaccagcaagtaacgaa tatttttttctgacgaaaattttcctcgacgaagttttccccgataaggt atacagATTATTTAACTCTGAGGCTTCTTCTTGAAAGTTACTTGTAGGAA ACTCATAGTAAAGCACTAGTCTATTTTCAGCGTTAACTCCGAAAAGAATA CTGAAGAAGTTGGTGTTCAAAATGCTAGTACTAATGAGTTCTATTTTTTA GTGAGGCGTAGTGGTATTGTGGTTAACATCCTTGACTCCCGCCTGGGAGG CCCTAGTTCGATACACACCGTGTCACTACGATTCACTCGGCAAGTGATTG TACCTTTGCCCGGGTCAAAcaatgccatgtgaggggaattgggtaccatt attctcatacaagagtgtgggtagaaTAGACAGACATTGTGACCTGCCGT GACACTCACGAGGTTCGGCCTCGCATGAGCATCGctctcccagtgtcgtt cgagtgtcatggtatacgccatggcttggcagctcacgtctgtcaagtcg cagtgtctgtcagcgctgtgattcctactcctttgggagtaggacccatc ccgaatgcattcggagggcCTACTGATAAGGCCTGATATGGATAATTAAA GACCATCCTGGTTAGATCTCCAAAAGTGATTATCTCTTGCTTTAGAAAGT TATTGTAGAACAACAAGTTCTTCTTGTGCTACACgttttctctttatttt aagaacatccaaattttttgacgccttcggatgttcttaacttttttgcg ttttaagcctaaaaatgttcttaacatgctctgagtatttttgtccattt tcctaagaaattgagtgtCTTAGGGACTACgaagccttgaaatattctta acttgatctttggccatcgaagccctatgttcttatatagtttgttctta taaaaaaacgtgtatacaaaATCATGTAAAGTTGGATATCAAGAATAATC CATAGCTATAAGTTCTGTCTTTCAAGTTTAATACATCCAAAGATTATATG GATCTTAATATATTTAAGGTTCGTTTTCATTAATTATCATATTATGAGTT AGTCTATTACTTACGAATATAATCCTAttctcatttaaaaaaacttgtat ccTTCAGGTCACATAGCCATTCAAAaaagtccctctaagggtcaGGGTAC ATACTTAGCATACCTCAAACCTAGTAGCCCCTCGGGGTTCTACATCATTG cattttctctatttttctaTTACAGGATTCTTAATTCGAAAATTTACAAA GATGTCTTGGTTGCTTCTGGATAGTTGATAATTGATAAAGCTGGGCGTTA CATCTAAAATATTGAAAGTCATTAAATACAGTAAAAACTATGGCGAGTGC AGCTTGTCGTATTGAAGTCGAGATCCCGGCAGATGAACGGAAATGGCCAT GGTTTTTAGTGGTTTCCGGGTTAATCTTTAGTTCCGgtttaattttaatt atcatcGGACGTATTTTGTTATATTTCTTCCATGGCGCTAAAAGAAGATC GAATAGTGTGATTGATATGAATGAGGtaaatttttagtttctatGGAATT GAGTTTTCTTTTGGAAGAATTCGTTTACTTGgctaggctgcacacatccc ctctggtATGTCTTGATATAGTTGATGcaattgacttccaagcccgaagg gctagactcgagacttcTGGATGGgcaatgaaaccacttatttcccatcc agaacgcccgtgcgtggtttttacacaaacgccggatttaaattaaaatc tatcgctatagatttcaaaaaatgcaatcctcaaaaacaaaaaaaaacgc tagatacaatccgtggttatgattacggcgcgttctggatgggaaataag tggcttcactttttcttgcctgggaaaggttagagagtctactctagccc ttcgggctttaagtTCAATGGTTGATGCTCAACCACAGCAtttcccgtcc gagagttaccccaatCTTTGTGTTtcagttttagaaacttgattggCTAG AGGTTAATACAATAATTGGATTTCTAAACcttttcaagaaattgaaacag gttaccTCAAGTTTGGGttaactctcggacgggaattttatacaagATTT TCATCCCTTACTTCAAAACATATCAgtggggatgcgtgcagccttaATTT CTCATATCCCAGTCAGTGTAAGTTTCGGCGTCGTTGGGTGGACGTTGATA AAACCTTAAAGATCTTTTTGCGTCTTTACTGATCTAACGTACCTGATGTT AATAAATTGTGTCTAAATGCTTAGAAAATAGCTAGTGGCCGAACAACTGA CCGACTAAACTGTGAAGCTAGTAAACTGATCATTGATGAATAATGCAAAC AGAGACTGGGACTGAGCCAACACGATATTAATGAACTAAAAGATGAATAG ACATCAATAGAGTGGGGATCAGGCCCTCGAGCCCAgacatcaatgctttg taataGGGCGAGCAAATATGAGCGagcaaaagaaaaagatcaagCACTTT GAGGAAAGAGCTCGAAGAAAGAAGACTTGAAAAGGAGAGCTCGAAGGAGC AGGACTTGAAAATGAGAACTAAAAGGAGAAGGACTTGAAAGAAGACCATC GTTAATTACATGCCAGATCTATTAATTTACTTGATATAATTATGGTATAC ACTTATTAGACAACCTAAACCTAATTGGAAAAAGACCTAACTTCCCTTCG TCACAAAACGATTAAACGATGCTATAGGTTAAAACAAATCACTATACTAA GAAAGAaaccaaagccgaagaaaattcgcaagtggttttttttttgccga GTAGAATTTACAACGATAGAGAATGCCAGTTTGTACCGCCGATTTTTGCC GCCCGTATACCGCCATTATGGCTGTAAACTTTTCGCATCTTTACTAccaa gtttatgtatcggaggatatccaGGTTGACGGTAaatgaaatcgatacaa aacaaagtcgatagttgatgtacggcgctatatcgcctttgctcacctaa acagacgacggtattttgatgtttttactgTCGTCGAGTAAAGTGGACga tgattttggagacattcaactttgctttataccgcccCCCTcgtttatct cgaatacatataAACTCGCCACCATGGATCTTtttaacggacgataacat cgtctattaaacgatttgaatttttgtttcaaataacACAAGTCTTACCT GACTTTTTACGGTAAAAATATTGCAATAACAATTACTTTTCCTATTTCCA ATCCGTTAGGTGGACGAATTGGAGGAAGAGGAATTCTTCTTGGAAGATTT AGAACAAGGATGGTATTTAGATTTGAAAGAAGGTGCTGGCAATCTTGTGT CTGCTCAAACATTACAAGGACGTATATTGGTGAGAATTTCGATACAATTA ACTCTCTttatttcgaatctttctgtaaatcGAAATAAATTGTTGATACC ATCAGCTGGAACGtggtataaaatactctctgtaattcgattcATTGTCT AATTCGAAGAAGATACCTGGtcgcttgaagatcgaattagagaatgtttc gaattacagagggtATTGTATACTACGTTCAAGCAGATGGGACTAACAAT TtatttcgaattacagaaagatccGAATAAAacaggttcgaattagagag agtttgCTGTATTAATCTTTTTAGTCAGCACACGTcttcttaaaataatt tttttacttgagtCTTATTTTTGTCATAAGATCTGATCTTTCCAACGCGG AATATTTTGTATAGACTGGAGTTGTTTATAATGCGTATAATACAGtatat atgataatacgattattgtcacgggatttagtttgtataaagctaaaatt gttcccttccATTACTTTTTGTCTGAATTTATAAAGCCTATTTCTACTTT GGAAACTCATTTCTTTGTTTGTTACTTTGTTTAGGTTGTTTTGTCGTTTG TATTCAACTTGGCAGAATGCGCACTCTATATCACAGAAACAGGATAGTAA GTTTAAAAATTATCTAGCACCCTCAACCCCCCAAGAAATATCTTGATACA AAAGAATTCTAAACATTATTGCAAGATAAAAACCTGTCCCCCGGACTCCA TttccgagtttatgtatgtgtctTTTTCAgcaacggagacggtaaggttc taatttgactagatcatgaccaactgaggacgacggtaaatcagcatttt taccgtccttgattttgcaggtcagaagtccgggtttttccaaatcgttt cagtcacattatcgtcctcaaaagtgcaaatacataaactcgctactatC AGTGTTGAGTCCAGAAATGGCCGAGAACTCAACACTAAAAGTGGGGGAAA GGGGGACCATGTGCAGTGTCTCGGATATAAATTGGGAGATTGCAGATACA TATTTCCATCCgatacgctaaagctctgaaagtTGGGAATACTGACCCGC TCCTGTAAAGCTTTAGCGTTACCCTTACATATTTTTTAATAGAATTACCT AAAACGAAGAGAGCATCGTGATTCttagaatttttcaaatattcctAAGC CAATCATAAGATTTTTAAGGGAAAGCAATAActgtgccgtaggaagcatt ttttaaggggaagctgaagtttagtgacaccgcgagggcctaccatggtt tggcccgcgAGGGGAGGTTCGAAAAGTTTGTCCAGGAAAGCAGATTTTTA TTACCCAATAATTGTCATGTGATTGAAGATAGAGAGTCTATCatcatatt tccctaacaccctgctTGGAAGAGCTTGGACTCACAAACTTTcaccgcaa tggactgtgttcgaatcccaagctcttccaggcagggtgtcggggaaata tggtgatagactctctaccttcactcacatgtcattctctctcaatccgg ctgataatcgaagtatcgattgacgtcgaatgagcttagtaaaagctcaa attgcagatgtagaacgataaactcggtatacaataattgtatttttata ttatgaaaagATGATTACCGAGTCATAAATATTTGCTCTCCTCaccaaat tttgcgcccctcttgtctacgcgACTGCTACGTCGTCATATTTTACTTTG CATCTTTTTCAGTCCAATCGAGCATTGTTTGGATTTGTCCGATCAAACAT TATGGAGAGTTGAAATTTGTTTGAAcgctttcttcatttttcattttctc attcGGGTAAGTCATTTCTGAAACAACGTCCTAATAGCGTACACCTAACG TTCAAAACATCAATATAACATCAGATGAACgtttaagaccatgttcacac gttactgttccatTTCGCTCCGGTACGATTTTCGTTAGATCGAATGTGta catattggtttcggaatgtttcggagcaagaaaacggagcagttccgttc cgatgaaaaatgtggagcgaaaccgtttcgatctgttttgctttgtaacg tcttcttttttgacgcttcgaattttgacgttcacacgcTTGTTTCGGCA CCGTTTCGTTTTGGAACGGAATGGAACTGTagcgtctgaacatggtctaa ataaCTAACTACCTAACATAAGGAGGTGAAATTTAACTaagtctttttca ttttttcgtaTTTAGAGGTAAATGTCCGACTTCCCGGCAATTAGCCCCCC CctgctttttaaaatttgaagattctTCAACACCCGCTGTTTATAAGGCT CCAAACAAAGCTAAAAGTATCGGTAAATGACTTGAACGCGGACTTGCTCC GCGAAAAATGGTCCGTATTGCTTCTAGGACGAACCTCAGTTAAGCCTATT TTCTGTAAAGAATATTTGTCATGCTGTAACGCAGACGTTGCGATACTAAA TCTCGTTAACACACCTCGTTGTTGGGTTAACTGACCATAatgcacctttt cgaccgtagctgcgCGGTCAAGCGCGTGCCACTTAATTATTTAATTATCC tcctaaactcgatccaatccttttttgacacatttttctattgtctatag gtgcgaaaaaaggactgggacggttttagtgggataaagcggataaaaaa atgcccgcgcggcaattggcggctacggtcgaaaaggtgtatttcggCTT CTTCTTTTCCAGTTTATCGAGGTGAACGACAAATTATCTTTTTACCTCGA CCTTGTTGTTGGGCTAACTGTCCCTTACCTGCCATAAATTCGACTTTTTC TTTTCTAGTTCATTGCGGCGAACGACAAATTATCTTTTTACCTCGACCTT GTTGTTGGTTTAACTACCCCTTACCTGCCATAAATTCGACTTTTTCTTTT CTAGTTCATTGCGGCGAACGACAAATTATCTTTTTACCTCGACCTTGTTG TTGGTTTAACTCCCCCTTACCTGCCATAAATTCGACTTTTTCTTTTCTAG TTCATTGCGGCGAACGACAAATTATCTTTTTACCTCGACCTTGTTGTTGG GCTAACTGTCCCTTACCTGCCATAAATTCGACTTTTTCTTTTCTAGTTCA TTGCGGCGAACGACAAATTATCTTTTTACCTCAACCTTGTTGTTGGTTTA ACTACCCCTTACCTGCCATAAATTCGACTTTTTCTTTTCTAGTTCATTGC GGCGAACGACAAATTATCTTTTTACCTCGACCTTGTTGTTGGTTTAACTA CCCCTTACCTGCCATAAATTCGACTTTTTCTTTTCTAGTTCATTGCGGCG AACGACAAATTATCTTTTTGGGCAATGGAACCTTTAACGTACGTTGATAT TGTGACTGTACCAGCCGTCTTTGTGGCTGTCTATCTTGGCCGAAACTGGC TAGGTAAGTTATTTTATACAGACTTGACCTCACGAATCGTGGATTGACCT TTAAGAATCGTCGTCAATTGTGGCATTACCCtctaaaacattaaaacaag ccgctgtttccttaaaaaagcagaaaaattcgtgttaatttcagatcgtg caaatttcaaggccgttaaatacttgcctagtaatatttgtgtaataagg taataaCGAATATGTATGAAAATTGACACCTTTTGTGTTCGAGCGTCTAT CCATTCCTTATTGGAGTACTTCACTGGAAAGCACAGCGAAAATTAGCCTA AATTTTAATAAAgctgactctctctaattccaTCTTCAAGGGAGGACCAA AAATCTTTCTTCGAATTATTGAAAGATTCGGATTACGGGGGATATTTTAT ACGATACTCCAGAACGAGGGAACGATGTTTTAGTCCGAATTATAAAatga ttcgaataatagaagttcgaattagagagagtagactgtatttcttttta ctttttaggtcTCCGCTTTCTACGTGTCATCTATTTGATCAACTTGGCAG ATATCCTACAATTTCTCAACGTACTCCACACAGGGTAAAATTATTTGACT ACAAAAGAATAATAGTATCATAGTAGAATAATTTCTAATCTGTTTCGACT CTTATAATACACCCTGTGTCACTGACCCGGTGGACCCCTACCCACTGGga aatctggcaaaaatttcgtccttAGAGGTTAAAACGCCCTACAATGTCAT CCCCACTAGATTATTTTGACTTCTATTGTGATTTTGATAGAAAGATAAAA AGTTCCatcagggctgtgagacaggattGTTATGATCATACACTTAAAAC AAAATTAAGTGACGCGGGTTTGTCAGATATCTTTTAATTCTCGCATATTT TTGCCCCTTTTCCAGTGCAATTATGTGAAATACATTTCTTATTGGTTATC ATATTTTTACCTTCAATAGTTCAAGTCTTGAGATGGCACAGATGATTGGT AATTTCTTGGCTTTGACTCTGGCGTCAGCTGGTATTGTTCATTTGGTAAG TTGCTGGAATAAAGAAAAGGGGgcgtaccgtaagttggtctaatgtcgac atccctcttctaatttcgacacccttctttagagaggaatgataggaagg tcggaatcactgatggacTCCGTAAGTGATttctaagcaaagaaaattag ttccaatcaGCGAtcccgaccttcctattattcctatctctaaagaaggg tgacgAAATTAGAAGGGAACTTTTACATtatagaccaacttacggtacgg CTTCGACGGGGTGACGATATTAGTTCTTTTTTCCTGTCGGTCCAGGAAAA ATGCTTTGATTTTTCGGTGTTCAAGACTCCCGTACGCCCGGCCCTTCCAC AGTTTAAGTATTGTTAGGTACCTTACGAAGCAAGGTAGACCAACCTCGGG TATAAAATATCGGCTTTTCTTGCTTCATGTACTAATCCCTTAGTTTAGTT TAAAGTTCAATATGCTTAATAATTTCTTGCTTTCGAGTACGATGTACGAG TACGCTAAATAGACGTAGCGTCGCACCTAAAATTTTCCATTTGAATTTAG ATACAGTGAAGTCTCTTTAAATCGAATTCCAACCTCTACAACTTGAATAA CTCCTATAATGGAACAAGTTTACTGGTCCATTCAGTTAACGAAGCCTCAT AAACCTATCTCATCTcctaactcgaaatttccataaatcGAACAAATTTC TGTTCCccatgcgtgttcgagttatggagactccatagtacaatatataa agtttgtctcaatataatttgcaccAGAGacaaaaaggctgtaacttttg atagaactCGAATTAAATTTACCACTTAAATTGCAAATTGCGGAAATTgt tgcaaattatattgagacaaacTTTAATTCATCTCAgactaagaccatgt tcagacgttacggttccgttccgaaacgaaacgaaacagttccgaaacaa gtgtgaacgtcaaaagtCGAAACGTCGAAatagaagacgttacaaagcaa aacagatcgaaacggtttcgctccactttttttcatcggaacggaactgc tccatTTTCTTGCTCTGAAACGTTccaaatatgaacacactcgatccgta acgaaattcataccggagcgaaacgaaacaataacgtgtgaacatggtct aagatacgcttttttatagtttgtcctttgtttttatttcagttgGAGAA CACTGGTGATCCATGGGAGCCTATCAACTACACCAACAAACAGAAATTGA ATTACTTCGAATGTCTCTATTTTCTATTCGTAAGTAAATCTTCTTATAAA CATAAAGTttcaggctcagtttttggtacctaaacaatgactctattgtt taagactaatagaatgctaagcataatgcgagcctgagtAGGAGCAGACa ctatgcttataaaataaaatctaccTTCAAATTGACTTTTTTAGTCAGAC TAGAAGTTCTTTTTAAGGGGCATTACTGTCAATAAATTGTCTTGCGTTGA ATCTGTTCGCCATAGTTTCTAGCGTTGAAATTGtgcaaaaatttttcaaa tattggatTTATTAGAAAagcacttttctttttttcaaagttttccaaaa tttgttgaaatacacgcttttttataagaataatttcataacacgaggct gaaaattggccaaaacctaagaacaaattaagaacgtTCTGTGCCTCAGA TTTTAGAATCATTAAGAAAGGActaattttaacagattttaaacgCATTT TCagtttaagtaaagaaactatgcgtattaagaacatcgtaagaacattt atcctgaacatttcaaaaaattaagaacagtttagCCAAAATGTActcag ggtgtctacgggaccttgaaaaccttgaaaaccttgaaaaccttgaaaat gaaccacccaaccttgaaaaccttgaaaactatcaattttctgggaaaaa ccttgaaaaccttgaaaactatcaattttctgggaaaaaccttgaaaacc ttgaaaaattgttaaaaaccttgaaaaNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNtagatcaaaagttatgggcctatttgtggtca aaaaggtgtttaattttgcataaattaatgcagattgtggggaaattccc tNNNNNNNNNNNNNNNNNNNNNNNNNNNtctagagaagttgggactttgg tgtaatacacttttttgctcagtttgaagagctctatcatgtggNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNcacgataatatcgtggaaactttttgattttgtaa tctacacatactaattcgcgagtttccgttgttttttttggaatctaaaa tatgtatcacgaaatgaaacgcttttcgacctcagccgcgcgactatatc cagtcattcgaaaagtaagaataagtaaaaaaccgcctgcggcgctaaac ctTTATAACATTTATAGAATTCCATATTTCCCTCTTTCTGTTGCGATTCT GTCGCAACGAATGCAacatattcttttatcattagctgagtttttgtcac tatttttttttgtttgcatgAGCCCTTAGAAATCGACTgttccccaattt tcaaatcgcttcagggtgtcttggaataatggccattcatcaataaaatt tcgaggattccttaaaacaactcttttggcatttttgtaaaaaccaaatc aaaaagcaaggcgttttttagccatttgaaagactcagaatcaaaatttt ctcttgtcggcgcaaaccatggttgcgcctcctcagtcactgtaaacaat tggttttgcttctaattctttatttctacagCTGGAAGACTACTTAGGGA GCTGGAGTATTTATTTTTGTGGTATTGTTCTCGAGAGGGAGATAGGAATC TAACTGTGGAAGTTATTCCccgggcaccaaaagcgaataaattttatttg ctgtcctctatttttctttcacctaccactctgaaaaaaaaattcctgta aAGAGCCATGTCAACTGAGTAtcagaaaaccttgaaaagtgccaaagttt ttgctaaaaaaccttgaaaaaccacttaaaaatgaccaaaaaaaccttga aaaccttgaaaatcccgaaaaaaaatccgtagacaccctggtactggttc ttataaaaaaaagctttacgtggaaattttattgataattCATTGAAGAT TTCCTTTCCATTCTGGGCCTCATACATATCGATTTCATGGAGAAAGAACT TGATAAATAACTTAGACATGCCAGACTACTCCATTCATGATAGATGGGTT TGTTTTAAGGATAAGAGAGGTGAACCCCTtatgtaggatttgaagccatt taTTTATCCTACATAAAAGTTGCGCGAGCAGAATTCACCGCTAACGAAGA TGAGAGAAAGTGctaaattcaatccgtcatctGAAATGTGACTACGTTAA TCTTAAGGCGTCAGcgtcattttcattttgcttggaaAGGGTTCGACTCT AGGCTTCGACTACATTTCATTGGTTTAACTAACGACATAAGCCTAAGCAT GGTTATATCGTCAAAATCTGGGAGTCTTGAAATTACAGTCAATTCTCTCT GATTTGAGCCTTGGTCTCCTCAGCTGGAAATTAGCATAAATTTCTCTCTA TAATTTGAATATTTCTCTAACTCGACGAAAGGTCTTAGTTCTTTGAAAGT CGAATAAGAGAGAGGCTACTGTACATTAGACTACAATTCTTCTGCTTTGT TATAGGTAACCATGTCAACGGTTGGTTATGGTGATATATATTGTCATACG TATCTTGGAAGGTTGTTTAATATTGGTTTCATCTCTGTTGGCCTGGTAAG ATGACATTGTTTTTTTCCAGGGGCCATTCCAATACAGTAGAACCCCAAAA ACCTATCTATGACAATGTCTCCTTGATTTGAACAGTTTCTTAGTCCCTAC TACGGCATGGGTTTCGCTTTGATTTTGATAGGCTGGTGGCGAATAAAAAA TTAACTCTGAAAAATTCTAGATTCTAGGCTGGCAAATTCTTTAGCTAGCC CAGAGATTTGGTTAGTGTGAGTATGTACTTGAATATGTAAATGAACTTTT AAAAACGAATTGTAATTCTTTTTGACCGGCGAAATTCCCCGTTTGTTGGA CCCCCTCTACATATGTTACAAACCCTTGTAAGCAAATCTTATATtaccca aattttcaaaacattttacaCTGATGCTTCAAACATGTAActattatttt cttattttaggGTCTATTTACATCATACCTACCAGCTATCCAAGAATTCT TAGCTTCACATACGAAATATGATAGAGCTTTCAAGCCTACACCAGGGAAA AGGTATATTGTACTATTCAGTATTTTGATATCTACGTTTTTTAATGGAAG ATGACTGGAATTGATTTACCACACctgttttcatttgtttttatcTACTT TTTGATGTATATTATAACTTTGGAAATTAATAATTTCTCTCCTGACAGGC AGGGataacttcaaattagcctatcatctcGGAATATCAGCTAATTAGCC TAGAATAAGcaaattagcctatttcatacaGGCTAATTAGCccataatga agaaaaattagaCTTTTGAGCCAAATACTAATAGTCGCATCTTTTTTTCA ATAAAAACAAATCTTATATGTTTCAAAGAACATTCTCCActtaaaaatct tttgtgttcAGCTCCCAGAAAAGATGTATTTTAAAAAAACTAGCTGATAG GCTAAATAACTGATaataggctaattttctgatcttataccgtgtgcaaa aaaaaaaaacaataaaaaattttaaaagatttgtcGAAGTTTTTATACTG CGCATGCTCGGCGCATGCGCAgttagaaaaaattgaatatctcctATTCT GGAGCTGATTAAGGGATAAAATTTGGAATATATTTTAATTGAGTGATTAG AGATTAATCTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGCTAAT TAGCCtgtatgaaataggctaatttgCTTATTCTAGGCTAATTAGCTGAT ATTCCgagatgataggctaatttgaagttatCCCTGCCTGCCTGAGTCCT TTGAAAAACATCAAAGGTTCTCATGACTTTATTTTCAACAACTCCATGtg actaaagtctattcacgataagtgtgcactcttttttcttttacaaataa cttttgaaggaattcttcaatgtttataaatttggtatcgttagaGAGAT acttgtgagtggaacaatttgaaataagaaagtctttaaaaatgttctaa aaacgaagatgaaaataaagaagaaaaaaaatgaagatcttgtagaaaag tgctatatctttcattttcactggagatattctttgatcttaggagaccT CCTAAgaatcactgtgaagaaatttcactaaaatatttattcaatataaa gttatgatacaaagttaataagtgattgaccccaaagtacagcagaaaac agcgtttttagacgtcaatcagcttataactttgtttgatatcttttgac tgaatgattatttttgagacatttttttcatagtgatgacgttcgatgat taaggattcacCTCAGTGAAAATGacagttatagcacttttctacaagat cttcattttttggacctaccccggtggggtagaggtcctataaattaacc tgtgttcgttcgtccgttcgtctgttaccaatttttctcaggattgaatc ataagAATCCTtagatttttggtacaaaggtgcaaaattgTGGTGggaaa aatgtgacggagcccgaattttcaataaaaaaattggcccaaaaaacggc taaaaaacgggttttttggactttgtgaaaaattgaatcattaatttttt cagattttttgtatgaaagtagggtaccatcataggtaaaagatggctca agaagatttttgcaaaaaaattttgttggctcaaaaaacgcatgtttatc tatatataaataaatcactattaataagcatacatcaatgttcttagtca aattgctcaatttcttttatgagatagatgttttttttgctcatgagggc ttacttttgaagaatatatgtgtttagacatgaaattttggttgcttggc gtgttttaaagaaaaactggccaaattcgatatttttggacctaccccgg tggggttgaggtcctataaattaacccatgttcgttagttagttagctag ttaccagcttttctcgagattggctcattagtttttatgatttttggcac aaaggtgcatgaccataaaccctcaaatgtgacagagcccgattttcgaa aaaaaaatttggggagcaaaattgggccaaaaaacggcttaaaaaagggt tttttggactttgtgaaaaattggatcattaattttttctgatttttagc atgaaagtagggtacaatcatagttaaaagatggctcaagcagatttttg caaaaaaaattttttggctcaaaaattgcatttttatctataagaaccac ttttaataagaatacatcacaagacatcaatgttcttagccatattatta ttattattattatttttattagtttttttttaagatgaaaatgtcgcggt ggagggtaatgatttgagttttctagaaacactttttttttcaatgtcca cgatcaaacatggttcaatcgtcaataaaactgatttttgaagccggaat tTTCTAtaaatcgccggaacaggcgattttcgccggaaaaacggtatttc ttgaatttcttgagctgtactttatatttttttatgaaattttgcacact gatgcaaaatgtcactacctaaattgtgaaggagcctgattttcgaaaaa atttcatttccggccgaaaatgccggaaacatgccggaaaagctgttttt ttggcattttctcgagattttctcattagttttttctgattttttgctca aagatgcgtattaacaatgcccaaaacatggccgagtccgatttttgaga aaaaattttttccggtggaaaatgcctgaaatatgccggaaatcgacgtt tttctagattttcattggacttttcccttttaattggttgttttttcatt caaaaacattattaatagcaatgtccaccatcaagcatgtttcaattttc aataaaattgatttttgaagccggaactaatTTAAAAGTCGcaggaacaa cctattttcgccggaaagacagtatttcttaaatttctcgagctttactt tatatttttttatgaaattttgcacactgatgcaaaaatgtcaataccta aaatgagacggagcctgattttcgaaaaacatttttctccggtcgaaatg ccggaaatatgccggaaaaaccggttttttgacattttctcgaattttca tttttagtattttctgattttttgcagaaagatgcgtattcgcaatgctc aaaacatggccgagttcgatttttgagaaaaagatttttccggttgaaaa tgccggaagtcgccgtttttgcagattttcattggattttttccttaaat ttctatgtttttcacacaaaaacattaatgataacaatgctcaccattta ttttttccctacaacccttccctctccccccatcatcaatcaatgatgaa ttttttgtgttatgcattttcgctaaacgctatgttttctgactgatttt tttcatttttcctcgTATTGCTatttaactttcatcatcaggtaggtcca ttcagcatctagcttgttttataagcacattatcaattaatttaaaagta ttagcttttctcgagattggctcttttattttttatgattttttgtacaa agaagcataactataaaccctcgaatgtgacagagcttgatttttgggaa aaaaattttagggtaaatttcagctaaaaaaacgattttttgcatgaaag tagattaaagatggctcaagctgatttttgtatacaaagaatttttcagc tcaaaaaacgcatgtttatctataagaatcactaataagcatacatcaat gttcttagccaaattacttaattttttgatgagatagatgttttttttgc tcacgaagtcttgaatataaaaaaatatttcaagagcatggaattttggt ttctaaacttttttttataagaaacaaacaactaattttaatagatcgtc actatttgtgttttgaatgattttttaatggtcacgctcacgtagatatc aattatatgtgtgttaaatgcataaccaggtaggtctataaaagtatcac ttgtttttttttctacagagcGTGTTTCAAGTCTTTGCCGAAAGTGTTGT GTTTCAACACGATGCGTTNcattttcatcttcgtttttagaattttttta aagatttttttatttcaaattgttccactcactaatatctttccaatgat accaaatttataaaggttgaagaattccttcaaacgttataggtaaaaga aaaaagagtgcacacttatcgtgaatagactttagtgttaagtaatagtt atcggacagttgcgagtacaatatgagaaatattttacgagttccgagat tctTCCGTacaatatacggaaaatccggaacgagtgaaatatttccatat tgtacgaccaaatgtctgataactggtttatcggtgacccaaaaaatgca ttCTTTGTGTTGGaggcactgacctttatataccctggacaaagcttctc aatcccagccaagcaaaatctttgatcggagttttttgaaaattggtacc ctaatgtcggcactactcgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNtgcatcgagagcgctaggtctacttttcctcaaattcttttg atgatgtagcggcgttagacgttaatttttaacattgcaatggcttttcc ttgggtaccaattctaaaaaaactccaatcaaagatggcagatattgttt ggtccagggttatataaaggtcagtggttggaggacacttttgtagcaaa gtgacgttagattgcttctagcgctacaatgcaacaacatcttttcgtca atctatatttttacatttaaaatacaagatatattgtactctttttaacc aatcagattgcagatattttttggatcgccgataaagtGTCATATTTTGT CATCGGgtctttctaaaaaataatgTACTCCCTGGTGTGAATATGTATTG TCAGAGGGTAGTAAACAAATGTAATAAAAGTGGGTGTCCAGGGACACGAG GGTTAACTCGTTATCCACAGGTAAAACCTTATCGTCAAGGGAGGAGTTCA AAGTCTCgatcattgagtttgaagccccgaaGGGGCTGGATATGAATCTT cgacctttctcaagcaaaagAAAGGTGAAGCATTAAGTTTGCCCCGgatt tacaaattttgtttgaaaaacacggCATTGTTCTCCAACGTGGAATTCCG GTTCTAGCCCTTtcgggctttgaaatcaatggtctTGATGACCGGGGgtt gaaaatacaattttctGTCATGAAGAACCCATTGAGTTTCGAAGTGTTAT TCACAATCGTCATTTTACAGGCATGTCATTGTTGCCGGATACATCACCGA AGAAAGTGTGACtgggtttttcaaagatttcttgCATCCTGATCGAGAAG ATAGTCAAACCACTGTCGTTATATTGTCACCGTAAGTTACTTATCTTTTA TATCATATAATTTGACGCAAAAGATTTCCAGAATCTAAGGGAAATACAAG CGAAAATCGAGTAAAAAGTTGTAAATATTTTACCCCGACGCAAAATATTA CGAAAATCTAAGAGAAATACTAACataatttgttcaaaaatttgctttaa atattttacagaatttcaaaatttggagaAGTTGCTTTGAGTTAAATTTT GTCTTTTACCCTGATTCATTAACATTTAAACCATCGTTTGGAATAGTTTT ATGTTGGCTTCCATCTTTCATTCTACACAAACTTAGTTGGAGTATTTTAT TGATCAGCTCATCCACGAAAAAGGATACAAAATTACATACATATTACGTA ACCTCGACCCTTACTCCTAACCTTCTAACCcaaatattcttgttttaaat CCTGCAGGAAATATCCGAGTTTGAAGATGCAAGCCGACTTGCAAAGACAT TGTACAAAAGCTTCATATTTTATTGGCACCATCTACAAGTTCATGGACTG CCATCGGACTAGGGTAAGTCTAAACACTTGAAGATgcaataccttatcgg ggaaaacttcgttggggaaaagacacaaaattttggccaagtgacgaata tttttccccgaaaaaaattttccccggccttaatccGTTTGCCAACTACC AGCGagtgacaaatatttttcccggacgaaaattttcccctaCGAAGTTT TCCTCGATAAGGTAGATCATTTCATGATgtgtgtaccgtcaactgctcta acttgggacgatttgtcgaaacatgggactggttgatatctagTCTGTAT TCTCActcactgttaaatctctttgacaacaaatttgttttcgtgtattt tttaatacgccgttcattaagtcaaatcaaatgactttggaggttcggtg aaatggtggctgaattgccgtcccatattttgtcagatagtcccaagtta gagcagttgacagtatttatttatttatttatttatttattaaaggattG AGGTTCAAGGCACGCCGTGGGCCTCTAAGAACCTATCTTTTTACAAATGT TTGTTGTTACAGTTTTCTTTAGGTAAAGTTTTGTTCTGGGGCTTCCCCTG ACTttaaattgaatgtttttgtctttcatttgagcattGAGCTCATGTGC TCTCTTGCACAATTCTTTGATTGCCAATCGTTCAATAATTGTGACGTCTT CTGTTGCTCGATAGAATGAAGGAGAGCCTTTGTATGTCGTGATGGCTCTC AAGACTTtgttcttgtcttcttcattttcaaatactACCTTGATTGGTCG ATACCTCCCTTCCTCCTCTCTCTCTTTCGTGAACACTCCAATCCTCTgtg tgattttaatttttatattttttagcggcaattcttggtcattttcatcg attttttcctCCATTTTCCTTGCCTATTTCCTTCCTATTTGGGAATCACA TTTAGTGACTAATAAATTCAATCAATGAAGCGCGTATTAATGATAATAAA CTTTTCTTGCGGAAGAAAACTGGAGACTTTCCAATAGCTTGGAAATCACC ATACTTCTTGTGTTCTGCTTACTAGACTGTCAACACAAACGCCGGGTGCT TGCACATCAAAGATAATTCTAACAGAAAAAGTAACATTGAAAAGAGGGGC AATTTATATGCTAATTTAAGGACATGCCTTCCTGTAATGTCTCTACTGAC TCTTCTTTATTCACGCTTACAAAAACTGATTAATTGCAAGCGATTTATTG AGTAGAAAAAAGTAGGAAAACTTACAGAAATGCTTTACAGTTGAGTCTGT ATAACTCGAACCCGCACGAGGActacaaatttgttcgagttgaggaaatt tcgagttatggaaaaaGTTTACAAGGCGTTGATAAATGAAAGGGCGAGAA AACCTTTTCGAGTGAAGGAGACATTCgatttatagaggttcgagttaaag agactcttcTGTACTTTATTCATTAGATGCGAGAAGCAGATGCAGTCATT ATTCTTTGTAACAAGAAATGTATAAGTCCCGATGAAGAAGACGCCGCTAA CATTACAAGGTAATTCCTTCAATTTGATTGGTTCTTCAAAATAAGTCCTT CAATTTGATTGGTTCTTCAAAGTAAGTCCTTCAATTTGATTGGCACTTCA AAGTAAGTCCTTCAATTTGATTGGCTCTTCAAAGTAAGTCCTTCGATTGG TTCATTTAAGATAACTAAcagtaaatttttcaaatcagtgcactTTATGA TTGAATAAGTCATCAAAGACTATACAAGCAGCACAATGTATTAAAAGGGA GGAttccggttcaaatccgggggggggggNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNACTTTATTCATTAGATGCGAGAAGCAGATGCAGTCATCATTCTT TGTAACAAGAAATGTATAAGTCCCGATGAAGAAGACGCCGCTAACATTAC AAGGTAATTCCTTCAATTTGATTGGTTCTTCAAAATAAGTCCTTTAAATT CATTGGCTCTTCAAAGTAAGTCCTTCAATTTGATTGGTTCTTCAAAGTAA GTGATTCAATTTGATTGGTTCTTCAAATTAAGTCCTTCAATTTGATTGGC TCTTCAAAGTAAGTCCTTTAAATTCATTGGCTCTTCAAAGTAAGTCCTTC GATTGGTTCCGGTTAAAAtccggggggtacttaggctaatggagggtacg gtatgtgacgcccttaaagataacttttttggatttccaaaatcgggggt cggaaaaatcagaaaatcaaatttaagtCCCACTAAGGATttgagaaata ggaaaatttaaactttttactcCCGGTCATTTTGTAGGGTGATTTCAGTG AAGAATTATCACGAGAACATTCGATGTATCGTACAACTCATGATGAACAA AAACAAGGTATGGCTAAAACTTTCACTGGGATCTCTTATATCATTCCTAC ATTGATAACTTTTATTGTCGAAAGGACATAATAACCAAATTCCTTAACAT ATCCTGAAACTTTTATTGATGAATATGTTTGTTAGCGATTcgatgacttt tcatgtatatTACAATGGAGTGAATAAAGCCTAATAAAGGTAGGGTTCTG TTGTTGTTTTCTGACAAGTCTCAGGGATTGGTTTTGGTAATCGTATGCCC ATAATTaggatcttatcggagtttttgatttttctaaaaaagcgatgcat tgcgggattgtttcgggagtacgaaaatagaaatctcttaggaattcctc gaggaaattctattgtaatactcccgaaacaatacCACattgcatcgctt ttttagaaaaatctaaaactccgataaggtctatttggATCTTTATTATA TATGATTTTTTGTTTCAGTCACATTTATTGAATTGTCCACAATGGAATCG GGAACTTGGTGATGACATCATTTGCATTGATGAGGTAAAATAAAAACCTT ACTTCTTAACTCCGTTTGAAACCTCCTTCACTCATATTTcagtatttgac ccaaaatctCGACCTATTGCTCGAATcgttctataattcgaactaaatta TTGGTCCCCTGATCTGGAAAGTGGTTTacattactctctgtaattcgaat ctttctctgattcgaataatttttttgtcctttgaagatcgaattagaga gagtcaacattTCAGTATTTGAACCGAAAACTTATTAGGTCTCAGCTTGC AAAGTCTTTCTTAAGGCTCCTTTTACATGTTTCATcgttttactttgtaa gaaacAGACAACGGGttcatttataagaacagttttataagaacaccagc CTCAGACTTAGGCCCTCAGAACAATAGCTccattgtttagaacaatagaa atttaagaacaatctcaGGCTCAGCCAAAATTTGGTCACAACTCGGACCA AAACAAGCTTCCTTGTCTTAAATAAAAGGAAAGAAAGGGTTTGACCAAAA ACTCACCAGTTAATATTTTCATGAAacacttttttgtttacttttttttc agttGAAACTTGGATTCGTGGCACAAAGTTGTAATGCACCTGGATTCTCA ACGTTGCTGGCAAATCTATTCGCTATGAGGAGCGATACGGTACGTAAAAC ACAATTATAGTATCTTTGTCTAGTTTTTTGGTGCTTCTTGAACCTTGCGG TTAATTTGATTATCTAATTTGCTTCTACAGCCAAAACATTTAAATTCGTG TTGCTCAAAAGCTTATTTTATGTGCATACTGTATACATTTTATGCGTAAG TGTGCATAGatacattttttcattttttgtgctcCCACATTACGAAAAAG ATCAAAACGGTCTGTCAACCTAGACCACTTCTCTTACGACCTTTAGATAA AATACGAGTCTTACGCGGAGTATGGATCTGCTCAGAAATGacatggacgt tgaaacaacgtcgccAGATCAAGATCTTCATCTGTCCGTacattcattta ttttttttctctataaCTTCAACAGATAAGCGAGGAGATTCAAGAATCAG AGAAATGGAAAGTAGCGTACATGATTGGTGCAGCAAATGAGATGTACACA GCTCAACTATCGAATGCTTTCATTGGAATGTCCTTCCCACAAGCAGTAGA GTAAGTCATAGAATTCGTACTTAGTGTATTATTGGTTTTTACCGTGTTCt aggccgggggggggggggtacctaGGCAAGTGAactaaagaaaaactttt tggagCCTGACAGTCCCTGtactatacaccttttcgaccgtagttgcACG GCCatgcgcgtgccactttattatgtaatttaccaccctaaacaaactcg atccaatcctttttttacactatttttctattgtctttagctGCGAAAAT AAGACTAtaggacggttttagggtggtaaaatggacaaaagaaATGCCCT CGCGGCAATTTTGGAGCCTGGCAGTCCCTGTAAGGATTGAAAAAAGCAGA AAATTAAATCTTGTCCCATTAAGGGTTTTTGCCCCTAAAAATATCGAGTT TTGGTTAAATTagtttaatcaattttcacaaaattacCCGCTAAGGATGG GTAGAAAGTGGGGCGGCGAATacctgtcagctcgcaaccccaATACCCCC TCCCTGGGTTCTAGATGGCATCAGGTACTTATTACTGGTTCGCGCGGCCG ATACGTAGGTATACTGCCATAAAGTCTGGTATACACGGAGACGGGCTTAG TGTAAAGTGTCATAGTCGATAGCATTTATGATATTACTTTGTATATTGCG CACCATTCAAAACATTATAAATTTGCTTTTTAgattatgttttgaaaaat tgaatttaatgtTGATTGCCATcgaaatgaaaatctcaaaaaaagagCGA TAGTAAGTACTCTAATGCAATGATTTataacactttttttataagaactt tcaaaatttttgaagccttcggatgttcttaacttttctagatttaagcc taaaattattgttcttaacatgttcttattttcaccattttatggTTATT TCGTCCGTTTTCATAAGAGATtagctgttttagagtccccaaagccttaa aatgttcttaacttgttcttaatattttggccatcgaagccttatgttct tatatagtgtTTTCTTATAGAAACGTGTACTTCTTTTAAAAACTATTTCG AAATATCCTTATATAGTTTGAATATTACCAGTTCTGATAATATGAGTCAC AGACTTCTATAGATACATTTCCTATATAGTATTAAGCATAGCCtcaataa gaaactttttttgctagTGGATGAGCAGAAGCTTATGGTATACCTATGTT TCTGAGACAAGTATTTccttaaaaagattttgataattttttaacacTAC TTGATTCCCATTAATTACTTGACTTTTTATGTTCCAGTCTATATATTACT GTTTTTATGGTCGGGCCAAAAAGAGGACCAAATTTCCCCTGAGAAATCGA AAAGTTCGGCAAACAGGCGCACGAGGATCtcagctctagtttagacggcc cacttttcgccctgtatatttttattatgaATTAAAGTGGGCAAGAGGTT GGCTGTCTAAACAAGGGCTCAATAACATTAACAGTTCACCAGAATTGACT TATGATTATTTTATCTCTTCCCTAGCTTTGCTATCAATCCCAATGACAAG AAGTTGAGACTTTTACCAGGAACGCGTGGTTTCTTTTTCGCTCAAGACGC CAGCGATGTTGCGAAGTAAATACacacttttattttgttcaatcaTATCA TACACAATACGCCTTGGAAGGGGGTCTATCTaacaaatcctgcattacta aaaatagacaaaaaggacgacaaatttcataaagaacgacaaatgtcgcc atccacaaccccaACCGAAAGTGTCTATATACCCCTacgtattcattcct ctttgtttatcacgggaattaactacatatggtttaaagaacgacaaatt actcatgcgtgttacaatggcAGGATTTGCAAGACGAACCTACTGTTGGG AAGATCTGATCATGCTAACCCagatggcacacaacgttggtTGAACGTTT ATCTAACTTTATATGGACGTTAAGGATGTTTGAttaacgtcaaaacaacg ttgtaATCAGCTGGGGACACAGACACATCCCAGCTAGGACACAATGctct ttcaacgtttatctaacattcacaacgtcaataaaacgttagatgaacgt tgaaacaacgttttgtgttctggttgaaacaacgttttgtgtcTTGGTTA AACCTTCATCAACGCacatcaaaaaaattgacttttggaATTTAAGGCTA GCTAGAGGTGATAGTAGAAGCCTTTCTCCAAATCATCATCTTAATATATC TGAAACATTTTAATATTTGTATGTACTCTACTTTTAGAGCATCGAAATAT TGTGCGAAGTGTCACAAAGACCTTCAAGATCCTGAACGAATGGTCAAATG TAAATGCAGACGTATGTTTATCTGATTTCGTTTCTAGTTATTAGATAAAT TAATTCAAGAGTTTCTTATTAGGtgccactcacatatcgatttttTTCAC AACCAACGTCACTCCGACGCTATTTCTAAGACCCCCAACTCCCTACCCTT AACGTCAGCCACcaaaaatcgataaaatcaaTGACAAAACTATGCTTCCC CACCCCCTCGTGTTATTGTAACGTTATTTGCGGGAAACATCCATCTGCGA GTGGCCCCTTACAATTTTACAAATAGCTTCCAACGCAAGATACAAAAATT TAGAAGAAACACTTGCATTCATTCAATACCTAAGTCTGTCTTTGAAAGCT CTTTTATTTCAGTTGATTAAGTTTCTTAAGGACTAGGTGATGGCCGAGGG atgtcttttgaaatttttcaaacatttataAGTTCTTAGTCAGGGCTTGT GTCACTCATTGTTAGGCATATGATTTTACTGcaaaatttttgtccaaaaa aaacaaaccacgTTTCTCAACTTTTCCCaaacaaccaatcaaattttacc ATGTTTCTTTACTATCCAATCACACTTTAACTTTTCCCAATCAGCCAATc acatttcaatattttccaaATCAACCAATCATATTCCTTTAACTTTTCTC AATCGACCAATCACATTTCAGGACGTATGAAACAAGAACAGGAAAAGAAG AATCCAGCTCAGAAAGGAAAATACGAAACAAAAGTCGATGTTGATCCAGT GCATTTGCTCGAAGCCGAACCCGATGAAGCTAAAAAGGAGTAAGTTTTCT ATACTAAAGTCTCTTATCTTCGTCCGGTTAAGTAATGCTAAGAAAAACTT AACACAGAATGAAACCTAAGCTAAGGAGGAGTAAGTTTTCCATATAAGCA TCTCATCTCTTCTTCAGTTGGTAAAGCGAGGCTaaggaaaatttgacaaa aaagaacCTTTTTTATGACTTCGGGCTAGTGAGATGAAAAttcagttgac tctctctaattcgatcatTAAGGGATTATGAcctttcttcgaattagaga tagATTCGAATCATACAGAGCAGAGCATTTAACACTACTTTCCGCCTGAA GGCACAAGTGATTTAGTTCGAAATAcagagttcgaattagagaggatCGA CTGTATAAAGTGCACTCCCTTAAAGCTGAACCAAGTGAATGAAGAAAGGA GTAAGTTATCAGTAGAAAGTCACATATTTCTGTTTGCTAAAACGATATAG AGAATAGAGAAACTGTGTCAAAATTCGtttaaaaattcctttttaaattt gttttatttccaGTAAACAATCATTGACGGGAGACTATTTTGCAAGTGGT GAAAAACCAAAGTTTGACCAAAGTGGGACGTTTTATTGGTGCGAAACAAG AAGCTACATATCTGCCAGGAtggtatgaaatttttttcaaagatatttgG GTTTTATACTTGGAATGGACCTTCATCTCCCCTTCACCTTCTCTCTTTCT TACCTCGCATCATCCTCCAAAAAtttaaatacagttgacgctctctaatt cgatcttcaaggggaattgaatcttcatcgaataagggagcttatcgaat atgggagcgtcgtttatgagagtttcttgttgacggggactttaagtttc atcgaataagggagcctatcgaatagtagaacgtcgaattagagagcgtc aactgtaataatATTTCTCCGAAAAACAATGTCTTGTAAAAAAGTTGTTT CGAATTGCATTTCCGTCCAACAAGTATATTATATATGGGGCTTGTATCTT TATTAGTTCACCAAATAAATGAACGAGGACAAATAAtgataatattttca ctttctcCTTTCTCCAGAGTCTCGGTGATGCTGCAGAAAGGAAGTTCAAG AACCATGTTGTTGTGTTGGTTTTATCACAACGTCTTTCACCACCGCTTGG TTTAAGACAACTTGTAAGTTCGATCCCGATACGTTATACAGAACTCTCCG AAGCTGAAACCTTTATGAATAAATTTCTTCATCAGCTTACCAACGACAAC TCTCCTCACCGAGTTCATGATATAGTTAAGCCAGGACTCATTCATCCGTT CATAAGTTTTCTTATTAGGtctctgctcatcctctagcgaaaataGTTTC TTATAGacctatataggaagtatatctatagaggtctgtaATTCAGACta aattttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgtt cgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcg ttctcTCTACTTTCCCTTTTCGTTCTGCAGGTACTTCCATTGCGTGCAAG CAATCGTCTGCCGCACGATGTCAAAAAAGTTGTCATTCTTGGAGATGGAG ATTTCTTAGCTCGCGAGGTAACATTGGTATTTCTATGAGAGAAGAACCCT ACAGTAACCATATTATTAGCCTAAAATATGATCGGATTGTTGAAACATTA ACACTTCTTTGTGCGTTTACGAAATGGCATTTGAAATATGTTTCGAAAGa aagattgttttattttgaatttttgttgtgttttgtaATGATATTTAGTT TAGAAATTGTATGATAAGAAATAtccaattttttacttttagtgGCCGAC GCTGGCGAATTTCCCTGATGTTGACATCGTACCTGTAAGTACCtagattt tgaaatataattgaAGTTGAAGGATTGCCCTCTgcataataaaaacaaaa gaaaactaaaaCGGGAAAGGCGTTTTTTAATTAGTATTGTAGTTGTAGCC TCAGTCCTGGGGCCcaataaaaaatattctttaacgTGCATAATATACAT CTTCAAAATATTCATGGTTTAAATCAGTATTCTTCTggctatttctaaaa aatctgagTTTAGATTATCTTTTCTTAGCTTTTGAAATCTAATCCTTTTC TGCgagaaattttttgagttttgatgagtctagtttatattttcttttag tttttaaAATCTTATCCCGTTTCCAATTCCAGGGTTCGCCTTACAACCGT TCCGATTTACGGGCAGTCAATGTGAATACAGCGGACATGTGTATTTTGTT ATCACCCGGACATGGTAGCGAGGAAGATGAGCACCAAGCTCTCTCTGATA AAGAAGTCATCCTGGTTACTTTGAATTTGAaaggtaaaattatttttcaa tcaaCTGACATACACCCAAGTCGATATGTCTCAGGCGACcttagcgaccg tagtgcagtggtagatcATCCgactacggtgcgcaaggttgtggatTCGA TTATCAGCCGGGGCGTACttagtacttgatgcctctgTGCTTGATACTCA GCAATTAAGATAAAGATCAAGGGTGAggggagcaatccagggagaaggAG TGGTGCCCtctcctaccttcgggtagatagctatagAAAGTATACTTCTT AAGGTGGGTACGGTAAACATTGGGTCAGTAGAAACTGTGGCGAGGTTTTT CGGATTTgggttaagggctctgaccatcgtgaatttttcataattgccat gtttaaaatgtgttttctgactgatgtaaccaacaaaactatggcatgtt atacattttctgttagacaaactattcctgaatctgaaaatttaaaaatt gcattgaaaaattttgacgaagaagaaagtgaatacttttgcgaggaaga gtatttcaactttgaagagcttagtttcggcgaagaaaaaacattttgaa aaatttttcgcagtagatggtgtatctttNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgttt ttcatcaatttttcatctggattttgcttaaaaaaacagtcataactttt gacacatcgttttagaaaaattttccgcaaaatttaaaatagttcattTC CTTGcagacagtgtaaagaaattttgaaacaaaaaagttaattacccatt aaaacttagcactttttgtaaaagagggtgatgcaacatattattaacat cNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNaatttataaaggcaattctttgttaaaagtgttaag gaacctgaaatataacttttatgttcaaataccaaaatcaatttttggac tatggccagagcccttaaggaaaagtatttctttttagacACAATTTTCA ACCAAAGTATACCAGATTACTTCTCAAGATGCATATTAACTAAATGTTAT CATCAAGTTTTGGCTTTTTATCACTTAAATTATTgactattttgaaaaat attgtcttGTTTTTTATCATTCAGCCATGACTTTTGACGAATCAGAACTA GCAGTCACGGAGGAGATCAAGAAAGTCGATTCGTCACGAGGAACTTCTAT CAACGGTGAAAGTTCTGCCGATGTACGGGTGGGATTCTCATCGGGCGCCA ATTCAAGGGCGGCCACCCGTATGACTGGACGCCCTGAAACTTCAATGTCT CACATGACAGCGGGCGGTAATAGTATGATACAAGAAGTCAAGAAAACGTT TAAAGGAGCTTTGAATGGAGCTAACATCCCTATGATCACTGAACTTGGTA AGTAGAAATTACTTTAAATTTAGCCCAGGCTAAACCCAGGCTTTAGTTCC CATCCCCTTAGCTCAATTTTGCATTcttctgatagcgctcacgaaAGGTG TGCCATGCTATATAAGAGAAGTAATTTTGGCAAATGAGCCTATTCgccaa ttttggtgcaatttggcggaatttattttggcgatttagtaaaatttcta aatttggcgagaattaattttggcgaatgacccatttttgttcaatattt tagctgaagaaagaggaaaaaagggtttttaggagaaatagagactaaAT TGAAAGAATAATTAAATATGGCGAGAATCaatttggcgaatgacctataa atttaaatttgatggcggaaaaaaaattctttccgccaaaatttcttccc tttaaaGTAGGTATAAGCTCACGATTGTATTACGTCCATTAGTAAAATCA AAACGTGGTTTAAGTgactctgggtacgagattgaatTTACCCTAGAAAT CTTTAATACTACTTTGAGTCAGCtactaggataaatctgatgacAAGTGG TGATTGGAATAACAGTAACAGTATTCAAAGGCAAACTTACAACcctaaaa tctttaaagcgattcaaaacgctatattgccgtAAGCCGTATGTCTCAGC GTTGTGATGAATACGGGCTTATTTAACTAGGCTACTCTGAATTGACTTAA AATCACTAACGTAAAGAAAAGCCACGGGCCCAGTTGTTGAAAAATAGTTT ATTGgttaaaaatagttttgaaaaggCTTTGTTATTTGATAAGCAAAGTG ATTCTGGGATTTCATTGCCTGCAAGCATCCTCTAAGAGATTATACTACCT GTGACTTTCCCAGACAcgcaacgttttttcaacgttgcttcaacgttcat ttaacgttatatggacgttgtgaacattagaaaaatgttgaaacgacgtt gtgtgccagctgggttgacTCAATCTTGGGTTTTCAACATATTACTCTAA ACTTATACTCCCAGGTAGCTAATCAACGGGCGGGGGCTAATTTCCGGGGC GGAAATTACACTCTTAATACTAGACTGGAGTTGTTTATAGTTATGtaata atacgattattgttacggtaTTATACTCCCAGGTAGCTAATCAACGGGCG GGGGCTAATTTCCGGGGCGGAAATTACACTCTTAATACTAGACTGGAGTT GTTTATAGTTATGtaataatacgattattgttacggtaTTATACTCCCAG GTAGCTAATCAACGGGCGGGGGCTAATTTCCGGGGCGGAAATTACACTCT TAATACTAGACTGGAGTTGTTTATAGTTATGtaataatacgattattgtt acgggatttagtttgtatagaattgttccctccattacttttagctttat ttctactatgtctgagaTAATCTTAATACCCCCCAAAAAGGCAATTACAG ACTAAAACCAGTCTTATTTggatcaaaaaaggaaaaagggtCAAAAGTTT TAAACGACTAAGAATAATGGATCTCtaaatcatttttttccttcAGTATG TGATTCGAATGCGATGTACATTGATCAAGATGATATGAACATCTATGATG ATGATGGAATCTTTTTAACGCAACCGTACGCTTGCGGCTCCGCTTTCACC GTATCGGTTCTCGATTCACTCGTCAGTGCGGTAAGTATTTGTTTAAAAAG CTGTCAGCCGCATAGGATAAATTCTATCAATTCCAATTCCTAACTTTGAA AATGCAAACATCTGTCATCCTTTAAAACATAAGCGAACTGGGCTAGAATT TACCAAGAAAAACTCTTaggcatggcgttctaaatctgaTCTTAGTTCAA ATTGTCGGAGGGTCGTTGCATTCGATCTTATCATAGACAATGAATTTTAA CGTAattttccttgtaaattcattatCAGTACCCTCAGAAGCCGACTGTG CAGTTTAAGGGTTGAAAGGTGTATTTTTCACACTCTAAACAAGTTCGTTT ACTTAGTTAACAATCATGTGGTTCAAAGCTTCGAATGTATATCAAATTCT AATTAAAATGACTCTCATCATGTGTGAAGTTGTTTGTAGGGGCGTTGTAa tcctttgaaattttgaacctttgcttgaaaacaatagaaaaaagtgtgaa aagtccctgaaaagttccatttttcgagatttcaaattggcataacttga gttaagaaaataaatacaccgaaaaatttagaggtttttcctaaaatcct agaagctatctgcatggaaaatatctcagaccatctgattatccctttaa ctaCTGTATTCAGCTTACTGAAGATTAAAGGATTGTTTAGTATgatcaaa atgaaaagaaagagcATATAAAAGTGCTAAGCATATAAGTAAGTTTTATG TAGGTATATTTAAGAGGTATTAAAATTAAGAATGTATtatgttggacggt gaaaaagaatgcggctattatattttgatttttataattatgAATGTATT ATAATTCATAGTGGATTTCAAGAAGCACAAATTGACTCTTCGACCATCTT TAACCTTGGTTTTCCCTTTTTTCATCAGACATATTTCAACAGTGACGTAT TAACACTTGTCCGTAATCTGGTCACCGGTTCTGTGAGTCCGGAACTGGAC GAATTGTTAGCAGAAGGCAAGCAGCCGTCCGGTTCGTACGAAACACAAGA GATTGCCGCTGTCAGGAACAGATGTCGGGTGGCACAAATTTCTTTGTTTG AAGGGCCTTTATCTGAATATGGGGTGAGTATTTAAATTATTATACAGTCA TTTCTCTCTAATCcgaacctctactattcgaatctttctataattcgaac aaaaatatttttcccttcAGTTAGAAATTATTTATGAAATACTTTCTGTG ATTCGATgaaaattcttggtcccttatgaagatcgaattagagaaagccA ACTATGTTGAAGTATTAGTATgtttcacccctgtctcagtgactcaCTGA GAATTTAAGGCCAGCAAGGATAAATGAAAGGAATAAATACCAATGAGTAT GGAAAATCAGTTCTTTAAATGAGTGAGGGTTTCGAATTCATCTTTATTTA CAGCCGATTTTCCGAGGTGGATGAAGGGGTTCCAACTAGGTCTGTGATTT GAGGTGTTAAGATAGTCAAAGACTTTCAGACAATTAAAGAAAAGAGACCT TtctttcaattccaaaaaaattgttaaTTGTGTTAATTTATGATATTCAA TGTCTTccttgcaatgtcttctggcaTTAAATCACGGACcgaacagctga ttggttgtaagtgacgtaaaatcagtcaatacgtaaCTTGAAGCCAGTCA GCTGTTGGGTTCGtgaaagacattgcaatggtgcatatcatgaattgtgt CAGTGTTTGGTATGCTGACAGTGAATACAAGGTGCTTCTAAGTCAAATta ggctattccaaaaaaaatttgtaccccctatgttgaagAGGTCATTTTCG GGAAAGGTGACAGCCTGGATTTTATTTCACATTTTCAAGACCCCCCTAGC TgatcttttctcattttttagactACCCTGGATTTATCTCCTCGACATAT AGTTCTAGAGTCCCACAGTCAGACTTGGATCCCTCTGGATTTTTGGATTC ATTTTACTGACTACCCTGGATTTCTTATTTTCCataccaccctggacgtc acaccgccttaacatagggggtacagactatttctggaatagcccaatct tTGGAAACTCAAATTTCTCTTGATTCGTATTAGTCATGAATATGATAAAT ACACAGTTTACCATTTTTTCATTACTAGGAATGTGGTTTATTCGGTGATC TATTTTTGTACGCTCTCCGTACGTACAACATGATCTGTNTGTGGTTTATT CGGTGATCTATTTTTGTACGCTCTTCGTACGTACAACATGATCTGTTTGG GTCTCTACCGATTCCGAGATTCGCAACGTATGAAGGACAAAATACCAAGC ACGAAACGTTACGTCATCACGTTCCCGCCctttaattttgttttggatCC AACTGATCTGGTCTTTGTTTTAATGCAGTTCGAAAAACCGAAACGTAAAA GGAAATCTGTGTCTCGTGTTGGCTCTGTGGCGTCGCGATTTTCAGGCGct ttttaactttgttttttgaTAGCATTGACTTGTAGGTTTTtatatctttt gttttttttaatctttttaaaacccTAATCACGTACTTCTATTACTTTTC AATTGTCTTGTTAAGATTTACAAATTATACCTAAAATTCTATGATCCAGG GGTCTTATATAGACCCAGCGAACGGCGAC
Gene-mRNA-Prot