Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_045860 (gene) - C. hemisphaerica

Overview
NameXLOC_045860
Unique NameXLOC_045860
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at scaffold_98:169585..169750-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_045860 ID=XLOC_045860|Name=XLOC_045860|organism=Clytia hemisphaerica|type=gene|length=166bp|location=Sequence derived from alignment at scaffold_98:169585..169750- (Clytia hemisphaerica)
TGGTCCGTAAAGTCAGAATTTAGATATATATCTCTATTTCTCTGTAATAA ATCAACCGTTTTACAAAATTCTTTCTGTGTTTGACTAAAATGGAATAAAG TACTACTTTATATACTTTAGAAAGGGCTTTGAAATACCAAAATAGTCCAG AAATTCCAAATTATCA
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00073842TCONS_00073842Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_98supercontigscaffold_98:169585..169750 -
Expression
No biomaterial libraries express this feature.