Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000940 (gene) - C. hemisphaerica

Overview
NameXLOC_000940
Unique NameXLOC_000940
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000011:1155976..1156470-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000940 ID=XLOC_000940|Name=XLOC_000940|organism=Clytia hemisphaerica|type=gene|length=495bp|location=Sequence derived from alignment at sc0000011:1155976..1156470- (Clytia hemisphaerica)
ACAATCATTCTTGACAAATCAAACATCGGGATTATCACTATCAAGAAATC GGGGAAATATGGGAAGTCAAGAAATGATTGGGTTTTGTATTGGTACAATT TTCGGTAGTATTGTTTTGATTGCAGTGTTTTATTATTTGTGTAAAGAATA TTGCTGGAAAAGATATTTTCGTAAATTGACCATTAAAAAAGAGAAATTAT ACGAGTTAGAATCAAGCAGTGAAGAAACTCAAACTTTGGGTAATAATCCT GATTCATTGAAGAATGGATTGAAAACACCAGCAACTAATACAGAAGATGA TGAAGTATTGTTGGAATTGGTTACCATTGAATTGAAAGGTAACCAAAGAA TCGAAAATACTGAATCATAATTTCATTTTATTTTCATATTTTCTGGATTG TTAGTCAGATTGCCAGCGATTTCATCTACAAACATAGACGATTTTTTAAC AGACTTTTAAAACTGAAGATTGGGATGAGGACAAGCCAATCAAGG
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001755TCONS_00001755Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001755-proteinTCONS_00001755-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000011supercontigsc0000011:1155976..1156470 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0 0 0 0 0.15 0 0.39 0 0 0.17 0.09 1.83 0 0.28 0.1 0.13 0.55 0.48 0 0.28 1.42 0.27 0.36 72.46 44.29 0.96 0.42