Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000851 (gene) - C. hemisphaerica

Overview
NameXLOC_000851
Unique NameXLOC_000851
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000011:74637..84132-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000851 ID=XLOC_000851|Name=XLOC_000851|organism=Clytia hemisphaerica|type=gene|length=9496bp|location=Sequence derived from alignment at sc0000011:74637..84132- (Clytia hemisphaerica)
CAGTACAGTATTACAGTAAATGATGAATAAGAGAGGTGGTCGCCAGCGAA AAAACAAACAAAATCAGACGAAATGTCAATTTTGTGATTTGTTTGTGGAC AGTATAGAAGACCACCAATGTCCTCATATGGCACCTGTTGGGGGTGTTAA TGGTTTTGGTGTGGGTGGAGGTGCTCAAAATGGCGATGCCTTAATTGATG AAGGTATTTATATAACTATTTATATAAGGTATATTATTCCATTCACCTCT GGAAAAAAGGTTCATTTTCCGACCTTTCCTCGACAGGGAAGACTAAAGAT AGGTCTGGTCCTTATGGATACTGGAAACTGACTCCATTTGATTGAAAATG CATGATAATATTTTATTGAGTGAATTGAAATGAAATATACCCAAGATTTG GTGAATAAAGAGTCAAAATGGACTTTGCGCAAGCCAATTACATGATTTTT GTTGGTTTGGCGCAACACGAAATAGGAAAAAATGCAAGGATTTTGGACGT TTTTGATGATTACATTGGTTATGTGATATAAATTATGGATTGTTTTACAA ATACAGTTAAAAGGCTGAAAAAACTAGGTTAAAAAATACATTTTGTCATA AGATATAACGTTTTCTTTACTTTTTCGCCCTTTTCCCGGAAACACGTTTC CGGGGGTTTACTAACACCTTGACGGATATTTCTCAGGATTGGAAAGTGCT AGCTTCATGAAATTTTCAGGGAAGGTTTCTTTCACCATTTGCCAGAAAAC TAATGAAAAATTTTCATGAAAAAATGTTCCACTCCTTCAAACTCAAAAAA ATTACATATATTAGATTCCGGCCCCCTGGAAAAAAAGTTTCAAAAAATTT TTTTTTTAGTTTTCTTTGTTTTCTCATTACAAAGCTGTGTGCCAAAAATC TTTAATTGAAATGATCTAGAACTCTAGAAAAGCCTGTTGAAAGAAAAATA TAGAACCAATATTACCCCCGTCTTGCTATTTTTAGAATTTCTTTTTCATT TTTGACATTTTTAATAGTTGTGTTACATTTATGGAAAGTTTCATCAATAT ATCTTTGATATTTCAAAAGTTATGACTAAAAAAGTAAAAAAATGACTTTT TCCATTTCTCAGGTAACTACCACCTTAAGCCAGAAATGGATTAGGTAGTC ATAGGTAATAAAAAGCTTAACTTTGACTTTTTAGGTGTTGAAATCATCTT CACATGGCTCGAAGATCATAAAATCGATGGAAAAATGAATTCAATTGATT TACTTATCATGGTAGGCTGCTTACATAACAATTTTTATCTTTTTCAATGA TTTTGGTGCAAGGCACGACCTCATTAAATTACATACAGGGTTTCCATAAT ATAGAACAAAAAGAATTTCATTTTGACACACCACCTTTGAATTCAAGGAT TTATTCTACACCAATTCAATTTCCTCTTTATGTAAACCTTTGATCGGTAA AACTAAGGCTACACTTATGTTTTTTTCCAGGCGACTGTAAAGCAATTGTT TTAAAACATTTTGTATTGCAGCGGCCTAGAAAAAAATATTGGTGCAACCC TAGCTTAACCCAAGAAGTACTTGATGTCAAAAATTTCTAGAGTTGGAATT CTGTGAAATCATAACTTTAGCAATACCTGACTGGGTATTAGTCTGAAATT GAATCAAATTTCTTTGGAAAATGTATCGTCCTTTCTAAGCTTAGATCGTC AATCTTATTGAAACAATTGCATCCATCAAATTTTCACGCACCTTTTCAAA AGTAGTGGATGTCATATTTCACACCCTTTGTCACAGACTCGCCCCACTGT GAAATTGGGCAAAAATTTCGTCCCCGGTGGGAAAATACCTTGGATTTTCA GCCCCACTGGGAATTTGATTTTTATTTCGTCCCCATTTGTCGAAATCCAA TGTAAAAAAATTTTACTCCAAAACCACCCCACTGGATTTTTTAACTTTGG AACAATAAAATTTCTTAATAAAATTTTTTATCCCCACTGAGGAAAAAGTT CCACCGGGGATGTGAGACAGGGGTGCTATTTCATCTTACCAGGGAGTGGT AAGTGTAAGCATAGTATAAGAAAGTCGCGGCTTTCTTATACTATGGTGTA AGTCTTCTTCTAAAGCTGACGTCATATTTTAAAATAAGTCCTCCAAATTT AATTATTTTTTTATTTGGATTTCAGGATGACAGAGTTCAACTCAAGCGAA GCAACGACGGATCCTTCAGATCAGACAAGAAGAAAATTCCTTTTGGCACA ATACGCAGAGGCAGACTTTTGATTGGAGAGACACATTTCTGCTTAAAAGA AATTGTGACCAATCAACATTCGAATGTAGTCCCTATAAAAATCGACCGAG GTGAGCCATTCCTCATTGAAAGTAAACCCCTGCCTCACAGCCCAAGTGGA AATTTTTACCACGCAGTGAGGAATAAAATATCTATCGATAGTGAAATTCT ATTGCGTAAAGCTCAAAAAATCCAGTAAGGATGATTAATTGTCCAAGTTT TTTCAACGAATTTCGAATGGGATGAAATCAAAGTCAATTTGTCAGTTAGG CATAGATTGTAGGATATTTTTCCCACCAGAAACGACATATTTTGGCCAAA TTTTCCAGTGGATCGGGGGTCCCATCGGGTTTAGGACAGAGTTTTAAAAG TAGATAAACCCATGTTTATCATAAATTTTCCCTCAATTGACAGACAAGAT TGTATCAAAGAGTAAAATAATTAATTTTTACCTGAATTATGACACTTGGA ATTCCATTAAACTGAACCAATTGCGTCAATTCAGCCAAGGCATCTTGTTT TCTTAAAGGACGTGGACATTTCTGAAGAAAGAGAAAGATGTAGGTTGTAT GTAAAATGTGTTTACAAACTTTTTCTCCATTTTAAGATAAGTACATCGTT TTCCTTGGAAGAACTGGAGTTGGTAAATCAACGTATATCAATTCTTTCGT CAATTATCAACAACACGGAACCTTCCAGAATGCGAATGATGGTCCTTTAT ACGTTCCAATATCCACAAGATTCAACCATTCATACCAAACAGATGATAGT GATGAAATTGAAGATCAGATAGTGACTTTGCAAGTTCCAGAACCATCCAA AAAGACATCTGAAACAAAAACAAAATCTGAACCTGAAAACGAATGCGATG AATATGCACAAGGTGACGTGACGTCATCAGCTACAAAATTGCCAAGAGCT TATGAAGTCCAACCGAAAGATGTGAACCATAAGATTATCTTGATTGATAC TCCAGGTGTTCAATCGACCACTGGCAAGCTGACTGATGAGGAAGCTTCAA AAGATACAGATAAAGAGAATAGCAAATTTATCATCAATCATTTAGCACAA GTTCCCTTTGTTAGTGCTTTCGTTATCCTCTTAAAGCCAGACGAGGAAAA GTTGGACATGTCTTTTGTGGCGACCATCAAATCATTATTCAGTCAACTTG ATGAGTCAGCAAAGAATAATGTTGTTTTTGCGATCACGCATGCCAACAAC TGCTGTTTCCGTGATACCAAAACGACAGTGGTGCTGAAAAAGACTTTTGA TCAGATTGGCTTGGAGATCAAAATCACCAGACGCAATATATTCCATTTCG ATAATTCACCATTCCGTTACCTAGCAACCAAGAAGCTTGGTTACCAACCA ATCGAAGACGAGGCTGATATGAAAAAATGCTGGCATAAAACAGTTGAGAA TTGTGAAGCAATGATTACATATATTGATGCATTGGAACCACACGATACCA GCACCTTGGTTGCTATTGACGACACAAAAATGATGATCAACAGTACTATA AAACCATTGGTCAAAATCAGCAAGTTGAACAAGGAAAATATTTTCACGTT TGAAAGTATTATCAAAGAAGAAGCGAATAAAGAAGGTAGCGAGGTGATAC AAGCTGCTTTGAAAACATTGGTTTACTAGAAAGTCGACAAGCCCTTCACT GCATGTACCAATATCGAATGCCATCAAAAGCAACAATTTAAACCAAAAGC TGAACCTAAAGAAATCATAAAGAACATGTACAACAAAATTTGCTGTGAGA GCTGTACTGTACCTTTTGTGACCCAAGAAACAACAGGAAGTTGGATGTTG TATTTCTGCCGAACCATGAATTGGTCTGGCTATTGTAAAGTATGCAAACA CAAGTTATCAGAGCACCAGCATGTGGCTTATGATCTAGCAGAAGTCGAAA AACGGTTCAAAATGAAGGTTGAAGATTTGCCAGAAAAGCTGAAGAAGCTT AAAGAAGAATTGAACATCACCATTGATGCTCTTGTCTATTTCACCAAGTT TCTAGACTGTCGTTGCATGTTCAAAGAAGATGATTTGGCTATTAGGTAAT TTTATCAATATATCACCAAACAAAGATACTAAAACTATTTCTCTATGAGC CCGGGGCTAAAAGTAGTCGCTGGACAAGTCTCTCTATGGGTTATAAAAAC AACAAAAAGTAAAAACAGTCTCTCCAAGGTTCACTATTTTCCCATTGTTG GCTTGAATTAAGGGTACTAAAACCGTGATAAATCAGATCCCTGGTCGGTT TTCGGAGGTCCAGTTCACACATAACCGACATTCCCCAACGCTTAACCCTA ATACATTACCGGCTTACGAGAGCTTTCCCAGTCTAGATACATTTGATTTT GATTCTTAGGTACATAAACGAAGAAGTCAAAGCATCGTGTCAACAACGTA ATGAGCAAGCAAACACCGTGACAGAATTGCAATCGAAATGGGACGAACTT TATGCCAAATGTTTTGAAAAGCATAACCAACATATGAAATCGTTGCTAGA TTCTAAGCTGTTAGAAGAAGCGTGCAAAGATCTAAACATGAATGACGTCC CAGACTCCCACAAAAGGGGAGAAGGTAGTGATTATCTTTTCAACGGTGTT TTAATCACAAAATTTGATGTATATATCAACATGAAAAAAATCTAAGTGAT TGTGAAATATTCCCTCATAAAACCTGGAGAATTCAAGGAGACATTTCTAG AGAACAACTGGGGTCCCTTAAGAAGAGGGTAGAAATCCTGTAGGTCTGTC CTGCAAAAATAGCTTCCTCAACATGGGTGGGATGAAATCCAGTTATAAAG TACCGTATTAATTCAAACAAGAAGCCCAAGGGCATGAAGGCCCAGCATTA AAAGTTTTGTTTCTAAATAAGAGTGATAAAGTTTGCTTAAAATCATCAAT TTTAATTTACAAGCTTTTTTATATTGAATTGGCACGAATGTGGAGCAGGA TTGGTCAGAAAGAGGAAAACATTTTTTTGCTTATATTAGCACAATATAAC AAACTGATATGAAACATGTGTCTAACATGAAACGGGAACACTTATTTATG TAAAAATAAAACTTTTGAAAAATCTTTAACAAACATGATAACGCTCTAAC TAAAGGAAGCAAAAACAAATGATAAAAAGTAAAATTAAAAAGAAACTAGC CTCGAAAATTTTTTCCTGCAACCACAGCGGCTGCAACCACAGCGGNNCAA GATGGTGTCTGACAGGGTGGCGCCGATAAGCCCTTTTGACCGTTTTGGAC TGAAATGGCTTAATTTTCTTAGATAAATGTATCTATAATGTCCTTATTGT TTATTTTTTTAACCATTATGATATGCTGAAATTGTGTACAAAATTTGAGC TTTTTAGTTCAATTTTACCAGGAGAAACAGGCAAAAGAAACTTGCAAAAT CAAACAAAACCGCAATACAAGCTGCAACATGGAGAATGCTCAATATGCCT TGCGACAACTTTTTCAAAACAGTAGATTTGAGCCCGGCTCGAACCACTAA AGTTATTTGTCAGTGATTCTGAGCCCGGCATGTGCTACCAAGCCGCTGCA AAAATTTGAAATTACAAACTCCTACCCCTTCCGTGAGATTGGGTAACTTG CATCAGTGAAGGCTAACATGCATAGCCCTCAAATGACTGACCAATCAAAG CAGCAAAATTTCAAAACAAATGAACTACGCAGCTTCGCTCGCAGCTCTAC TCTACCATTTTTGTTTTGATTTCACTTTGCTATGCATGNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNATCTAGCAATTCCTTTGTTTTTGAGTGATATACTTTTCAAAATT AAGCGGTAAATTTTAGTTTCAATCTGTCATTTGTGTAAAAACCAAGCGGG TCGCCCAAGGCCGTGCAACTTTGGTAGGATTTGTTGGCTTCAAATCCTAC CAAAGAGATTGACCTCTAGCCCTTCGGGCTTGAAACTCAATATGGTATAC AGTACAAAAAATTTACTGTGGGAAATTTGAATTTATCGCTGTCCTCACTT ACGAAAATAAAAACCATATTTCTGAACTTGCGTTTTCTCTTAAAGAGTGT GACCGTTGAAAGAATTTGTTTGGTTTTCAACTGTTGAACGANTATTGTTT ATTTTTTTAATCATTATGATATGCTGAAATTGTGTACAAAATTTGAGCTT TTTAGTTCAATTTTACCAGGAGAAACAGGCAAAAAAAACTTGCAAAATCA GACAAATCCGCAATACAAGCTGCAACATGGAAAATGCTCAAAATGCCTTG CGACAACTTTTTCAAAACCAGTAGATTTGAACCCGGCTCAAACCACCAAA GTTATTTGTCAGTGATTCTGAGCCCGGCATGTGCTACCAAGCCGCTGCAA AAATTTGAAATTACAAACTCCTACCCCTACCGTGAGATCGNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATTTCGTTCGATTACGAT TATGTACGATGAGTTTGATTGCGATTAAATTAAATTGGATCACTCTGTTA GAGCTTCTTAGCGTGGGCGGCCGAGCGCTTAAGTACCCGAAAAAAATCTA ATATAATTGAATCATTTCAATCTAACGTAATTGAATACAATCGAACGTAA TCAAAGCAATCGAACAGCAAATCCTGGGTAGTATTCGATTGCGATTCGAT TGCGTTTGATTGTATTCAATTACGTTCGACAATCGAATTGCAATTATTCG ATTGCGTTCAATTCGTTCGATTGACACCGTCTGGTGCGTGATGTAAACTA AAAAAACTGAGCATGATCAAGACTCCTTTAAAAAAGCTCAACAAATATAA AATTTCACCATAATTTTATGCAGAAAAAGTATCAAAATATCCAACAAGAA CAATACAAATAGAGGCTATTCTAGTCAACCTCTTGCTGTTTGAATAAATT TTTTTGTCGAATATAAAAGCCTGAACACACATTTCGCACACGTTAAGTTN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTGAGAGAGGA CAGAAAAACAGAACACGGCACGGACTGCGGACAGACAGGACAGGACAGAC AGACACACGGAAAGTTCCTCTTGAAAGGCCCCTTCGCTAGGCGCTGGGCC AATAAACGCCCCCTTCTTATAAACGCCCCTCATCGAATAAACGCCCCTCC TAAAGGAAAAATTTTCAATACACGCCCTCTAGGAAGGCAGGCCGTTTATT TGAAACAAGTAGCTGTTAGGGAGAATCATATGGAGGAAAATTTAAAATAT GTGTTGATAATTGTATTTTTGAATCATTCAAACTAGTTTGACTCATTTTA AACATATCTAAAATGAAATTTTTCAACTGAAGAAAAACGAGAAGGCAAAA CAAGGTTCCAATTTACTTTATTAAAGTGACCTTGGTTGAATATTATTTTT TATTCGAACTAATACGGTAGGCCAATCAACATTATAGAAATCCACTTATC TTTAGCTTTTACTGAAGAAGTTAAGCGTAAAGCAGACGAAGAAAGTCGAA TCGATCCAGAATTTAAAGCTCTCAAAGATCAACTGTAAGTGGCAGAGAAG AGTCGCAAAGAGAAGGAAATTTTGGCAGCCGGATTGGAAGATATGCAGGA AAAATTCAATGAGAAAATGTCAGTAAATAAAGTCGAGAAAAAGGATCTAA CACCCAAAAATGTCGAAATCAAAATCAAAGAGCTTTGCCACTTAGATGAA AATGGTGTAACTTTTCAGAAATGTTATGCTAATATCAAGAATGCTAAAAA TAAAGGTGTGCTGAGACCAAAATCATTAGTCAACTCACGNAATGTTATGC TAATATCAAGAATGCTAAAAATAAAGGCGTGCTGAGACCAAAATCATTAG TCAACTCACGTGACATACCAAAACAAACCATGAAAAAAGAGCCAGTTGAA GCTTAGAATGCATGGCAACTTGCAATAATAAAGTGACTAACCCTTG
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001637TCONS_00001637Clytia hemisphaericatranscript
TCONS_00001636TCONS_00001636Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001637-proteinTCONS_00001637-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000011supercontigsc0000011:74637..84132 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.03 0.03 0.05 0 0.36 0.27 0.64 0.74 0.68 2.45 0.81 0.84 5.07 5.5 21.88 27.48 3.45 4.48 11.62 15.52 0.31 0.31 1.08 0.66 1.89 1.99 1.94 2.62 0.16 0.14