Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000256 (gene) - C. hemisphaerica

Overview
NameXLOC_000256
Unique NameXLOC_000256
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:2642219..2642406-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000256 ID=XLOC_000256|Name=XLOC_000256|organism=Clytia hemisphaerica|type=gene|length=188bp|location=Sequence derived from alignment at sc0000001:2642219..2642406- (Clytia hemisphaerica)
NNCGAAATTTTAATATCCTTGACCTGGGAACAGGGCAATTTCGACTCCAA ATTAAAAAAATTCGGGGTGCGAAATGCCTTTGGCATGTTTCATGTTCCAA ACCCAAATCCCATCCCCGAAAACAGGCATTTCCCACCCCGAAAATGCCCT GTTCCCAGGCCTGGGTTTTTAACATTTTTTCCTGTGTA
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000382TCONS_00000382Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2642219..2642406 -
Expression
No biomaterial libraries express this feature.