BlTCONS00000025 (transcript) - B. lanceolatum

Overview
NameBlTCONS00000025
Unique NameBlTCONS00000025
Typetranscript
OrganismBranchiostoma lanceolatum (Amphioxus)

Sequence
The following sequences are available for this feature:

transcript from alignment at Sc0000000:227086..227287+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>BlTCONS00000025 ID=BlTCONS00000025|Name=BlTCONS00000025|organism=Branchiostoma lanceolatum|type=transcript|length=202bp|location=Sequence derived from alignment at Sc0000000:227086..227287+ (Branchiostoma lanceolatum)
GCAAGCCCTTGCCAAACTGTTGTCTAATGTAGCATTAATGCCAGAAATAC ATATGCAGCACTAATGCTTGGTTAGTGCACACTGCCATGGTAATTTCATG GTAATTATGGCTGTCCAAAATCCAGCATTAATGCCCAATGTGCTCTGCTA AGGAGCGCGTAGTGCGGCATTAATGCTACATTAGACAATAGTTTGGCAAG GG
Gene-mRNA-Prot
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
BlTCONS00000025-exon-Sc0000000-1564993656:227086..227287BlTCONS00000025-exon-Sc0000000-1564993656:227086..227287Branchiostoma lanceolatumexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000000genomeSc0000000:227086..227287 +
Spatial Expression
in the tripal_feature_cv_term.tpl.php
Properties
Property NameValue
GeneIDBlCUFF000020