BlTCONS00000022 (transcript) - B. lanceolatum

Overview
NameBlTCONS00000022
Unique NameBlTCONS00000022
Typetranscript
OrganismBranchiostoma lanceolatum (Amphioxus)

Sequence
The following sequences are available for this feature:

transcript from alignment at Sc0000000:166980..168941+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>BlTCONS00000022 ID=BlTCONS00000022|Name=BlTCONS00000022|organism=Branchiostoma lanceolatum|type=transcript|length=1962bp|location=Sequence derived from alignment at Sc0000000:166980..168941+ (Branchiostoma lanceolatum)
GACATCTGTTCTGGTGGCCTGAGTGTGGATGTGCGGCTGACCCAGTCAGG GTTTCTCCCCAGTGTGGCTGATGTCACAGGGACATCTGTTTTTGTCTCAC CGTGGCCTGAGATGGACCGATACCCTCCCGACTCCCCCCGCAGGCACCTC GGCTTTAATTGAAAGTGTTGGGAGGACGGCGGTACCCAGATGTGTGCCAG TTATCGGCAGGGGAGGAGAGACGGATGCGGGTTGGAGGGACTGACACAAG GAAGCTCAGGAGCGGAAGGTTTGTCTCCAGTGTGTGTTATCAGCTGAACC TGCGAGGGCTGCTCCCCAGTGTGGCTTTAAGGCTGATGATATTGGCTGGG GAGAAGGAAACGGATGCGGGTTTGAACGACTGGCACAAGGAAGCTCGGGA GCAGAATATCCCAGGGTTGCTCCCCAGTGTGGCTGCACGGCTGAACCAGT AAGGTTTGTCCCCCGGTGGCTTTACGGCAGGTGTCACAGAGAGACGGATG CGGGTTAGAGCGACTGGCACGAGGAGGCTCGGGAGCAGCGGAATATTCGG CAGATGGGGAGAGAGGAGCGCGGTACCCGACGATTGGCCCATTAGGCACA TCACCGGCAAAATACTAATTTCATGATCCATGCAAATAATGGGGGCTCAT CGGAGGTAATTGTCTGGCCGTGCATCACCGCTGGGCCGGGGAGTCCATCA NATCACTGCTTGGCCGGGGAGTCCATCAGAGCGCGCAGCTATTGCATTTG GTGTGCATAATTTATTGGGAGGGGAGAGAGGGATCCGCGCTGCACGCTTT ATAATGCACTCCCGGTGACACGCCAAGCCACGGACGGAGAAGGGGCCACG TTTCGGCACCGCGGGTCCACTCGGAGCGTCGTGTGTGCGGCTGACGAACG ACGGGAAACTCTGGCTGTACGTGTCCCTGCATGGACTGTCTGTTAGCAGC TGTCTGTGGGATCGTGGGCTGGACTTTGGCAGCTGAGAAACACTCTCTGT GCTGGGGAAACATTGGCTGTGTGTGTCAGTGCATCGGCTCTACATGGGAT AGCTGAGAAACATTGTGGAAACCTTGCCTGGCTGGACATGTCCCTGCATG GGCTGTATGTAAGACGCTGAGAAATACCGGCTGTGCAGTGCTGACGTTGG CTGTAAGTGGGCAGTTGAGAAACACTGTGCTGTACGTGTGCCTGTACATG ACTGCTGGATTGGCAGTGAGGAAGGCTGTCTTGTGAGGGAACGTTGGCTG GAAGTGGGACTGTGCAGAGTGGAAGTGCGGGTAACCCTGTGAGCACTTGT GCATAGTTTACGCCGGGACGCTGCATTGTGATTCACCTGGCAAGGAAATT AGCATTCTCCCCAGACAATTGGAGAGAATCGGAATCGTCATAGCGCGGGC ATGTGCAGGGATTGCCACATGGGGTAGCCGCGCTGCAGTCGCCACACGGG GGAGACGGATCGCCACACTGTGTGTGCCACAGTTGGAAATATTGCCACTT GTCAAACCGGGGGAGTATCGACGTCAGCTGGGGGATCGAAGGCTCGCCGA GACAATCAAGGATTATTCTGATTACCGACGGAACAGGGAGGCGGCGCGGG GTTGCCACGGCGCACGTTACCACGGTTACTGCGGGTCCGGAACACCGGTG TTTGCGAGGTAAACAACGGGAGAATATTCCTGCAGGAATTCCGTCTGGAA GTGTTGTTGTTGGCTGTGCGTGCGCTGCTCTGGAATTAATGGGTTGCCCC ACGGAATACTGAGCTGGGTTTTGATTAAACAAATGGGCCGGGAGCTGCCG GGAATGGAGTAGCTGCCTGATCATTCCCCACCCACGGAGCAGGGCGACAT TAAACTTTCATACTTGTCATGCAGGAGCAACCCAGGTGACACGCAGAATT GTTTCCCTGTGGGGTTTAGACAGGGCGACATTGCAACTGTTATAGACAGG GCGACAACTGGT
Gene-mRNA-Prot
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
BlTCONS00000022-exon-Sc0000000-1564993656:166980..168941BlTCONS00000022-exon-Sc0000000-1564993656:166980..168941Branchiostoma lanceolatumexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000000genomeSc0000000:166980..168941 +
Spatial Expression
in the tripal_feature_cv_term.tpl.php
Properties
Property NameValue
GeneIDBlCUFF000019