BlTCONS00000006 (transcript) - B. lanceolatum

Overview
NameBlTCONS00000006
Unique NameBlTCONS00000006
Typetranscript
OrganismBranchiostoma lanceolatum (Amphioxus)

Sequence
The following sequences are available for this feature:

transcript from alignment at Sc0000000:99346..99973+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>BlTCONS00000006 ID=BlTCONS00000006|Name=BlTCONS00000006|organism=Branchiostoma lanceolatum|type=transcript|length=628bp|location=Sequence derived from alignment at Sc0000000:99346..99973+ (Branchiostoma lanceolatum)
TGCCTCCCTCCTTGGGAGATTTAATCCCTAACAAATGTTGTTGATAGCCC AATTGTTCTGCGCTGTCGCGAAGACAAACGCTCGCTTTAATGGGTTCCGA GGTCATTAGACTTTAGAGAATCCTGGCCGCTGAGATACGGCCGGTTGTCA CGGTAATCGGTCGTTTTGTTGATTGGGGCTGTTGAGTAAATGGTGCGTGA CTCAGACCCATTTCACAATGACACTGGAGGAACGTGATGAAAGACTTCCC ACATGGAGAGCTCTCTGCTAGCTTTCTTCTTCTTCTTTCTTTTATGGCAA CCACCTTCAGCATTTTGAGAAGTTATCATCTAGCTTTGTTAACCTTCCAA ATGTTGTGTGCTAATCATTGCAGTAACTTTGTTTGCATTGGTTCCAGCAA TGGTTAGGATAGTGATGGTATAAATCACAAGCATTGAATGTTTGTAAGTG TACAATAGACTTCTAATAGAGAGATATCACAATAAATTATCCCAGATAAT CCTGTGTTATAAATCAAACTTGTTGTTTTATTCTTATTTTATTATCAATT TTATTAATTTGTCTGAGGCCCATATCAACAAATACTGTAGATATCACAGT TAGTTCTATGGAAAGCTATGAGTTCTAA
Gene-mRNA-Prot
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
BlTCONS00000006-exon-Sc0000000-1564993656:99346..99973BlTCONS00000006-exon-Sc0000000-1564993656:99346..99973Branchiostoma lanceolatumexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000000genomeSc0000000:99346..99973 +
Spatial Expression
in the tripal_feature_cv_term.tpl.php
Properties
Property NameValue
GeneIDBlCUFF000006