Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

Blg00320.0 (mRNA) - B. lanceolatum

Overview
NameBlg00320.0
Unique NameBlg00320.0
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000086:1035658..1049735-

Legend: polypeptideCDSexon
Hold the cursor over a type above to highlight its positions in the sequence below.
>Blg00320.0 ID=Blg00320.0|Name=Blg00320.0|organism=Branchiostoma lanceolatum|type=mRNA|length=14078bp|location=Sequence derived from alignment at Sc0000086:1035658..1049735- (Branchiostoma lanceolatum)
ATGGATATCAATTTTCTAACGAGGACCCTTGTGAGATTAGAACAGGGTTC TTTTGCATGGGTCATCTCCGCACAGTCTGTGCAGTCAGAAAGGCCCAGGA AATAAAATCTTTGCGTGCTACAACTGATCGTTGTTTCCTGCAGGGTATTT TCCTTGGGGGATTGAAATATTTTAAAGTGTTGCTATTGACGTGAGTGATC CCACATCCTAGTAAATTATTCAACGTTTGATAGATGTCAAAGAAGCATCA CACGTATGCATCACTAAAATTTATACTTACGACTAGAGTGGAGTAGAATA TTCGACCTGAAACGTTAGAAGAATTTTGTGTTTACAACTTATAATGAACG CTAACAATTTTCTTTGTTTCATATTTTTCAGAGAATTCACATGGGACCCT GGAGTGACTCCCTCATTCAGGAATTCCGCTGGGGCTGAATTTCGATGTGA ATTTCAATTTACAAATATTCTGACAACTTGTACATGAGCCACACACTCAC ACCGAAAGTTCACAGACCACCGTTACCATTACGTCATAACCACAAGGGAG CATCCAGGAAACCTGTGGTGTCTACACAGTCTTGTAGTCTCACCATGACC AATCAAACTGTGTTTTCTAAGAAAAATTCCAGCTTTCAACATTCACCCTA GAACTTTCAAACCATCCAGTTGTGAAGAATTCACAAGAAAGAACATGTCG CAAAGGAGAAGCGTTGCCATTGTTCTTTTGTCATCTTNCGTTGCCATTGT TCTTTTGTCGTCTTGGACTTTGATTTGGAATCAAACTTTTAGCACGGCAT CTTTCAACGTCACAAGGACGGACCGAGACTACTTCTCCGTACAGACGTTA GATGGAGAGCCGTGTCCGGATGGGGTGGACGATTTCTGCATGACGAAGAA TGCGGAGGGGGCCCACGTGTTTACGGACGTTCACGGGAACAGGTCGTGTG CGTGTATGTGTAAGAACAGAGACACCTACATGTCGGATGTGAGGAGATGT TCCCGCGCTGTAGAAGGTGAGTTTGAGCTGGATTTAGTAAGTTACGTATT GGTAGATGAGTTACTGTATGTGCTGTACCTGAATGTTGATGAATGTTGAG GTCACTGACCCACCCTCAGGCACTTTTCTCACTCCACTATATATTGGTGG CTACCTATTTTAGTATGACAGTGAAAGTGATTTTGAACCACTACAGCTCA AATAACTTAGTAATGAACATTTGAGTCACTGGTCATGACAGATCTAGGGA AAATTTCGAAGACAGTCATGTAGTATGCTATGTACAGTATTTATAGGTTC ATTGTACCAGGGAAATTCTCCGACATGTAGCTCTTTCTGTAAAGTGCAAT GAACAGTCATTACTTAGTTGGACTGCAACCCTTCCCACAAGTGTGTAAGT CGAGTGAGCGATAACAGCCGAGATTCAAACTCACAACCTCTTGGTCCAAA GGCAGGGTCAGTAACCACTGGACTACACTTAGTGCCACAATATAACTGCT GCCATTTCTGTCCCCAGAGTGTAAGCTGCAGTTTGAGGTTGGGGATGGAG AGGAGATCTACATCATGAAGGATCCCCTAGAGGACAGACAACAGCACAAT TATGTCCTGGACTGGGACGAGGTGGACTGGACCAATGACGGCTACGGTCC GGGGAGGGACTGGACATGCTCCGTGTCTTCTCAGAGGTTTCTTGAAGACG GGAAGTGGAAGCCTTTCTCATGTCTTGGAGAAGGTGTTCCAGACGAGTTT GTGAAGGTTACTAGAAGAAGGGCGTGGCTTCTTGTGGTGAGTTTGAGTTG CTCACCCAGTGTGTGTGTGTGTCTGTGGGTGGGTGTTTGTGTGTGTACAT GAGTGTGTGTATGTGTGTGTATGTTTGTTGATGTGTGTATGTCTGTGTGT CATGGTGTGCATGATGTATCTTTGAGTGTGTGTGTTGGGACAGGCAGGTG TTTTATATCTACCTACTAGTACATGTATACCGTTGCGTGCAAAATGTACA TAATGCTTGATTGTATACAAGCTGTGGAGAAGAATTTCTGTGACTTGAAG TCTGAAGAAATCATTACATAATAGCCAATAATTTTATTTCTTCTATTCTA CGATGTACTTCTTATTTCAGTGAAATAAGCTGTAACATGAAATGAGTCGT CATTATTCAAAAACTAGGCTAAACAGTAAACTGAAACTGATTGATCTCAC TAGTAGTACTCCCCAGTCCTGCTCTTGCCCAATATGAGCCTTTGGGTTAA AACTCAGAGGTGGTCCTGTCTCACTGTTTTGCAGAAAACAACTGCCATTG TGTCACAGTTAACCTGAATCCTCTGCTGTTCAAATCTTCTGCTAACTTTT GTGTTCAATGTACACCACACTAAGAAACTAGCTTGTGATGTTTCCATAAT CTTAGAGTTAGTTTGAAATATCATAGAGAGTCTAATGAGACATCATATTG GGACTATACATGAATATCTTCCTATAACATATATACAAATGTATCTTCCG TGGTGAATAAGCATGTTTATGGTATAAGTTTGCTTTTGTAATTGCTGTAA CACTAATCTCTAACCCCCTTTCTTAGTTCCAGTTTGGACCATACCATTCA CAATTTGGGGGACTTCTCATAAGGGTGGAAATGAACTGCAATAACCCAGA ACAGGGACAAGAAAGCAAGGAAACGGACACGACTTGTATCGTGTTTAAAA CCAGAGGAACGCGTCTCCGTAAGTGTATGCAACTTGGTCGATCTACGTGA AACTGTAGCTTTTGTTGTACATTTTCATGTCACGGTTACATCAAAAGTCC CTATTGTAGGATTTGGTGTCTAAATTGGACATATTCTGTGGATCAAAATT TCTCTATTTCATTTATCTGTAATCATGTATCAAATCTTCCTTGATATCAT TTTCGCAGATATCCCAGGTACCCCCTGTGCGACAGACCCCACCCCCACGC CCCGCCCCCCTACACCCACATCTACCCACAGTACTGTAACAAGAGCAGGC CCTGCAGCAACTGATAAGGGTTCACCTGTGTTTACTCCAACCTTTCTGTA CACAACAAGGAGGCAAAGATCTCCGGCAACAGAAAAATCTACTGTGTCAA ACACTACAGGTGGGTGCAAAGCATACCTTTTCTATTGATTTTAAGATATT GTTTATTCTGCATTAAGGTAACCTTAATTGTATTAAAACACTGATTATTA ACATGATTAGGAAGACAAATATTTTTGAAGTAGATTGGCAAAGATAGCAG TGACGTCACATTGTTACAAATATTTGATACACACAACACTTGAATCAAAT ATTTGTGGGCATTATGTCTGTTTCCTGTTCAACATTACTAGTCGGTAGAC AATCAAAGTATTTGAATCACAGTAAAGAAAACATGCACATTTCTTACACA AGGTTGAAAGAAGAAATGCTTCTCTTGAACAGTTTGATATTGAGAAAAGT ACAATAGTTGTTAGTTTTATTCTTGATAAATCTCAAAATGTGTCTAGAAT AGAATGCTAAAATTATTCCATACTTTCCAATATTTCTATTGTGTAGTATG TTGTGGTCCTACTAAAAAGTGTAATATGATATGTATACAATACCTTGTGT GTATCTTTCTTTAGTTCTCTATTTCTGTTCTATTTTCCTATTTAGTAGGA CTCTAAATATTATATACTTTCTACAGGAATGATGATGGCAGCTGATGGAA CTGGTAACAACTCAGGGCTGATAGCTGGTACAGTGATAGGAGTTCTCCTG GCCGCTGTGCTGGCTCTTGGAATTGTGATCCTGGTTTACCGAAGGAAAAG AAGGAAAAGGTGAGTGATGAGGTCTGCCTACACCAAGGTTCTTACTTTCG TTTTCATGACCAATATCCTGTATAATTAGCAGCAAGTTATCTAAATTACT GTACATAAATTGACTACTGTTCAATTTCAGCTAATAGAATAATGTTATGT TTTTCGTAAATTTTGCAGGTTTTCCAAACTAGATACAAGGCAGAGCCACA ACAGGGTGAGTGTAAACCCCCCAAATCAATTTACATGTTCATGAAAATTA AAAACAACACTAAGTTAGATACCTGTCCGACAGATACTTCCAAGTGTTTT CTTATCCCCTCCCTCAAAACTGTACATGTAGCGTACAAAGGCAACTTTTT AGATTGATAGAATCTTTTCGTATATTTGCGTAACTGTTTAGCTTCCTCCC TGTCGTTGTAGTAGAATATGCCAGTAAAATGCAGTATTTTTGTGCTGTCT CAATAAACTGCAAGGTTTAAAAGTTGTCTTTATTTTTCATGCAATTTCAC TAGCGTGCTCAGATAAAAAGCAATGCTCAATATTAGTAACATTGCAGCTT ATAACTGATGTACAGTCAGGCAAACATCATCAACATCATCAAGCTCACTG ATTCTTATGATTGATGAATGTGTCACATGGTTCCCTTCCCAGATCAACAC GAGTCGCGTGGAGAACCCCAGCTACGAGGACGCCATATTTCAGAACGGTC GGACCAGCGTGCTGTCGGAGGGACTCCTGTACAGCGTGGAACACAACGAT GACGATCAGAGTGAGGAGGGCAATGTGGAAAACGAGATTTACGAAGGGGT AGGTTACGAATTTGAACTACTTCATCATGCTTTATATTGGTACACATGTA TCTGTTTCTGTCATTTAAAAACTGTAAAATCTAATACTGGATACTACTAC TACTAAAATGTTTGTGACAAAATAAAACAGTCCGTAGACTTCTACAATTA CATGTAATTATGTGATTCATGAAATCTAGCCTGTATTCTTTTCACTTGTC AAATTGCAAATTTTTCATATTTCTTCTGCAATAGTTTTGTCATTTTAAAA GTTTTTCTGCAAGTTACAATTTTTATTGGTTATTTATGCCTGCTATAGAT GACTAGCTATTTCAAACAATGAAAGCAAAGTTAGCTGGTCACACATTCAC ATGTATTATTACATGTATTATTCTATCACAGTTACCTATAAAGGCTCTGG TAGCAAGCCCTATCTACTATATGTATCATAATTTGAATGTATTGTCAAAA CTGTCTTTCCTCCAGCCGCTAATCATAGAATTCTTTTCCCGGAATAGAAT AGAACATTTTTGGCAATACCTTAGGGGTGGAGTCATCCTTTGTTCCACGT GGTGCATACATGTTAAAGACAGAACACCATGAAACCGATAGTATGTCAAA CTTTGCATTTGTGTTCATTCAGGGTTTGCCTGACAACCCCTATGACGAGC CCCTTGGTAGTCCTACTGACTCACTGGAGCAGCCGCTCGAGATCTCCGGT CCACAGATTTCAGGTTTCAGCATTCCAACAGAGGACGTGTACATTCCCGT CGGAGGACATCTCAACACTGTTTCTTCACATGTGCCTACGCATCTTGACT TGCCTGTGCCGGCGTATAGAGACGCACCAAACAGCGATGGTTATCAGACC CTGAACAGGCCATTAGTAGAGACTGACCAATCGCCTAGCTCGCCAATTTA TGCAACACCCCACATCGGTCATGTGTATACGTCCCTAAGCCCCCCGTTGC ATAACCACGGTTACACAGAACCGACTGTCCCTCCGTACGTGCTACCAGAC ATTACGCTTAACCCGGCATCACAGAATCACGGTTACGATGAACCAAACAT TGTTTCTCCCTACGCGCTCCCTGATATTTCCAACCAGAGATCGGACTACC AGACCCCCAAACCACAGAACCATTACGAAACCCTTGAAGATCCAGACGGA TCCAGTTTGAAAGGCAACTCTCAAACCTCGCTTGATCATCCCTACACAGT GTTGCAAGGACCTGACTCCCCAACTGGTGCTTCTCCAAATGTGGGGCTAA CTTTCTCCCAAGCAGATGTAGCATCACATTCAAGTCAGTAAAATGACTCA GTTCTGGCTGGACCAGATATTTAAGAACAATTGCTTTTGGATCAAGCTTT GACAAGTAGAAATAGGTTTGGATAGTAGACTCAAGTAGCAACAGGATATG TATTTTTTTACAAAAAATATCAAAGGGTGCCTTTAATGCAATATAGATGT ATGTATCTATGGGACAGATGTTCCTTGTTGACTGTCAAATTGAAAAACTG CCAGTACATGACAAACATTTCAACAATCTAACATAAATTTTTTATAAACC CTAACATTCTTGATACAATTATAGCACAGAAAGTTTAGTGTGCATTTATT TGCATTTAATCCTCATATTGCATGTTACATTTTGTACATGTATATGTAAC GTTAACAGTTATGGTAGTTAAAAGCAACTGACTGGTACTGCTGGTGCCAC ATATATAAAAAGATTGTTCCAGTATGAAAACTGAAATCCTGCATACATTA AACTGACCATATAACGTTATTCTGAAAAGTTCCATGGTTGTATTTGTCCA AGTATTATGTCCTGTAATAACATCAGGTAGTGATATATGTAGCTATACCT TATTATGCTATAGTATATTGTTTCATTATGTATGTTTTGGTATATTTTTT GTTTCAAGTAGTATCAAGCATTATACATCCAGAAATGTGTTGTATACAAG AAATATTTATATTTAGTTACCAAGTATGTAACGTTTTCCGTATTTATTCA TCAGTTCGATAGCACAGTTGTATTCTAATGTTGTTGTTTGTCACCTCGAG TTAACGTTTGGAGCAATAAATACAGTTCCAGAGATCAAATGAGAGATTTG CGTGCATTAATTCATTTGGTGTGTGGAAAGCATCAAACCTGATCTTACAG CTTTCCTGATGAGGCTTGAAGCGCTTCATGCCTTTTTTGCTAGATGGCGT TGCTGCAACATCTGCACCTTTGTGTCAAAGGTTAACCTGTGGTGATTGAC CTCATTCCTTTGTTGTGAGTGTGCAGGCAAGAAAGGTGATCATGTTGCAG TGGATGTCACACACGGGTACGGCTGGAGCTTAAAAGAAATAGGCCTCAAA TACTAGACTAAACCTTCGTGTGATGGTGTTTGTCCATTTTTACAAGTTTG TAGGAAGTTTCAAAACGCGTAATCGGCGATTTTTAATCCGGAAGGATGTT TACCAGCCGGAGTCCGAGTTTGCTGACATGGATGACCGCCCGGGTGACGA TGACAACTACCTGGCTATGACGTAAAAGCGGATGGAGCCGGGTTTAACAA CATTCTTTTGGCAACAATAACAACTTCTTAAGTGTGCAGAGAAGGGATAA GTATCAGACACTACTTTGTCGCAAAGTCCGCATCACAAACCTTCCGTTAT AGCTTCCAAGACAGTGATTTAGGACCCACAAGTAGGACGCTCTGATAATA AAAAATGAAGGACGTTGTTCTAGTAGTTATCCTGCTGTTTCAAGCAGTCA TACGGACAGCAGGGGACTGGACTTCGGTCCTTAACGTCACCAGGACCGGC AGAGAAGGCGACGTCTTCACGGAGAGAACGGACACCTGTACGGAGGCTTG GAATGGTTACTGCAGCCAAAGATATGCTAATCGTCTCAGCTGGAGAGAGC CAGGTGGCCGGCGGGTGTGCATGTGCCAGTGTTACACCTGGTTCAACACG TACCTGTCTGACGAGGATTCGTGTGAGAATGTTCCTTCAGATTCAGGTAA ATTTCTTAAACTTTAACATGGTAGAAAATTTAGTTGTACTTTAAAGTTGA TAAATCAGAAAAAGAGATTTTGTAACGACTTCTATTTGCTGTCTGGAGAG GTTTTTAAAATAGCCTTTGACCTTGTTTTCTCACTCACTGATTCTGTACA CAGTTTAGAATGTTTTATAGGTATGTCACCTATTTGAGGAAAACATGAAA TGAAGGGGCACAATTTGCATGACAATGAAAAATAAAATTTCACTTCATAA ATAACGTTATATGAAATATGGAAGTATATTTTTCAGCGTTTGGAGCCCAA AACAAACAGAATCATTGTAAAAAAAAATGTCCAGGTATTGTGTATACTAT TATTACCAGCTTTATAATTCTTACTCCCTCCCACATTTTAATTATAAGAA ATAGACATTTGTTTGGCTGAAAAATTCTTATGCATGAAGTATGCATCTGC TGTTAATCTGAAAATTGACAGTTTTATTTCATTTGACTCACTCCAGATTG CGAGTGGACCTTTGAAGACGAAGGACCAGAGAACCTGTACACGGTCACAC CTGGCGCCGGTCAAACCGGCTGGATAGACTGGGGGGACGAGGACTGGCCA GGCTCGGGGGTCACTCCCAACTCCTGTTCCATAGACTGGTCCTGCGACAT GACCTCGCAAACTTACCTGGAAGATGGGGAGTGGAAGGATCTCTCGTGTC TCGGCGGAGACATTCCGGACGACGTTTTTGTCTTAGACTACGAAGAAAAT GGCAGGAGGAGAAACTGTCAGAGACATTGGTTTGTCTCTGTAAGTATGCG TTTTATGACGTTGACTCTCATAATTCCACCGGGTTTCCCACGACTGCCAC ATTGAAAAAAAAATGAATTTAAAAATGAATCTACTATTGCCACATTAGTA ATCCTCGACCCCGATGCACACACACTTCAGATATCCAGATGTTCAAGACA TTCTTGAGAAGACCTCAATAACACAGACTTTTTAATGTGGAAGTCTCAGG GCATTATGAGAGTTGACCTTACAGTAATTGTTGCTTTCTACTTTATAAGT TAAATTAATGAGGAATTGTTTGTATTCTGTAATGTAACTTTTGGAACTGT AGTCAAACAGCACTGTTGACAGTGACAGTAAATGAAAAAGTTATCCAAGA AAAAAGGGTAATGTGTACTAATGTACATGTATGTTTGCCACCAATTTCAA AAGAATGTTAAGTAAGATAGGCTGCTGTTATTAAGTCAGAAGTGTCACAG GAAGTTGTGTAGTCTACTTCCTATGTGCTCCCAAAGGAAGTCATGTATGG AATTATACTATGTAATGACAGTTCTAAATTTCATTTATCTCTTACCACCG TCCAATTGAAGCACTGTAATCTAATTGAATTACAGTCAAACCTCCTTGTT TTGATGTAGAATTTTCTAACTAAACCTAATCTGGGCCTATGGGTGATAAA TCAACTTTGTGTCAACACCAGTATGATTTACTGTTTGTGGCCAATGTGTC AACAGGAAAGAGATTTGTTTGTTGTTTGTTCCAGTGGGATGTTACGTATG ACATCACACGACTGGGAGGACTGGTGATCCACCTGGACATCACCTGCACA CGGCGCAGGTGGGGGAACAGACAGTACACCGAGTCACAATGTCTCAGGTT CAAGACAGAGGGAACTCATCTTTGTGAGTATAGACATGTACATGATTACA AACTAATTTTAGAAGTTCTTTGAATCATAACTTCCTAGTCTTTAAAAAAT GCTGTGTTTTATTTTCATGCCATCGTTGTGTTAAAAGCGGTCAAAATACA GTCTAACCAAGGAGGTTGTATGTGTATTAACTCCTTGGTCTAACCTGTCT TTAGAAAAGCGACCAATACAGGGGCTTGAAGAAATTTTTCATAATAGACA GGCAGTTTTCGCCTCCATTATAAAATTACAAATATGTGATTTTGCGCTAC AGTATTGTTTCAACTGCAACAATGCGAAAGCCTTTTGTCCACTCCTAAAA TTGAATCCTTGCAAAAATAAGTAAGGTTACAGTAGATAATTAGAAATGTC TTTATATTCAATGAATCGCTATCTTTGTTGTGAGCAGACAATTGCGTGCG TAATCATAGTTATCATTAATATAATTAATGCAATTTTCAGCACGCCTTGG CTCTGTTGGCTCTATCTTTTCACACAATTGTTCTTTGAATGCTGACAACT GTCAACACTGAGTTCTTTCACCACGGCTTAAGATTCAAAATGACCTGGTC TGTCACATGTTATTTATAATTCTGTACCCTTGCGTGCTGTAGACACACCA GGGCCAGGCTGTACCGCGTACACACAGACCACACCCCCAGGCAAGGTCAC CACACAAAGGAGCCAGCAAAGTAAGAAAATACCTTTTGATCTGTAAATCT CTCTGGAATTTGCTTGTATTTAATTGAATCTGGAGTACATGTTGAATGAA CTTTACTTGTATTGTTTGGGTTCAAAGACTAAGTCTTGTTATTAAAAACC AGTAGAAAAACAAACATTGCATACATTTAGTACTGTGAATGTCACTGAAA TACCGACTGTAACTGTACAATACCCTTTGCTTTTGACTATATGCATGCAT ATTCTTGTAAATTCTTTTCTTATACATGTATTTGTTGCTGCAGTGTTCTA ATGTTTAGTTAAAATTTTAGTTTCAATCTGTATGGTATAGATGCATGTTG GTCGTGATGTCTACATTCTCTGTACGGTTGTTACCTGGCCTTGTTGTTTG ATTACACCAAGGAGGTGATTACACTGAGTGTACGCCTGTCTAATTTCAAT GTGTCCTTTAACAAGCTACAGGTAGTGCACCTGAGACACCTGATGCAGGT ATTACTAAAGCACCTGGTGTGGAGACAACACATTCCAACACAACTTCTGG AAATGGTATGATAACGTTCTTTCCTGCATATGTTTTGTTGACTAGAATAT GCCCCATGAAAACACACATTCAAATGTTACCTCTACTATATATTTGTGTA TTTGCGCCTGTTCTGTTTTGTGACCTAAATTACTTTAACTGCAAATTCTG AGACTGTGTGGACCAATAACAAACCTCAATTCCATTAATTATTCAGCTGT AACGTGTAAGCATAAGCATGGATTAATGAAGAGGATAGCTTTGCATTAAT GATCTGGCAATTATTCACACGTTGTAGGAATTATGGGATGTATAGTTTTT TTTAACAATGTCAATGTCAGCTTGAATTGGCTATATGACAATAACGTTAA TGATCCCCTTTTCCTCTGTCTGACACTGTTTATGGAAAGATAACACCTGT TCAGAGACCTATGAAACCATCTCATGAGCTCATTTGTGGTTTATTTGGTT TCAGTGACTGTTATATAATGTAGGTCACTGGTCATGCCACAGTTAACACC TAGGGACTGGTCATTAACTCTAAATCAAATACATGATAGGGGGATATGTT GCCCAGTCTTACAGTTTTGATAATGATGAGAATTGAATCAAATGAAGTGT GAAATGTTGATGTGTTATGTTCCAGGAGACATGGGCAGGAATACTGGCGG AGGTGGGGGGAACACAGGAGCCATCGCAGGGGGCGTGGCAGTGGCTGTCA TCGCTGTCCTGGCCTTACTGGGAGGGTTTGTTTTCTTCTGGAGAAGGAAA CATAAACAGGACACTGGGTAAGTGTAGGTTCCATCAGTCTTCTTAATTAG CTATATAAAAGATTATGTTTTGCATGAGGCACATCTACATATAGTGTCAA CTGTCATAACTTTGTTGGGTACTCTATTACTAAAGTTGACAATGTCCACG TTTCATGCAATAACTGAATAAGCGCATGCTATATCTTTGTAAATATGAGT TCAATACCTTTCTGATTGAATACGTAATAACACATTTGGTTAGAAAAAAA TTAACAACTTCTTACTTTTTGTCCTTTTGTGGTAATAATTTGTTCTAATG TTTCTACTTTTTTTGTAGGAAACCGTCATCAGGAGGTCCTCAGGTAATTA TTTGATAATCTTATTTCTGTGTGTGTTGGCCAATGCTATGTTCTAGAAGC ATTGCCCCCTGTTGACTGATGAAAAATACTGTAGGCATGGAATATGATAA AATGATGAAGTAATCAGTTTATTGCATTCAATGAATACCATTTTTGGCAC ATACCACATTTATATCTTTAAATAAAATATTGGAGTACAAATGTATATCA CAAAGACCTCTTTAATTTTGCCCTCTGTGACTTTGACAAACAATTCTAAC TGCTAAAGCAAAGCTGTCAGGTCAAAGGTCACTGATGAAGGACAGGTTGC TAAGTAACAGGTCACACCTGTGCTGATACTAGCCATACCAGCTGATAATG GGTTAACTCTTTCCAAAGGTCACATGGCTACATAGTTTTCTGTAATGCTT GTATTGAAATATTGGAAATTTTTTTCATTTGGTGGTGTCAAATGCTGAAA GTGTGTATATATTTCAGGTGTTGCATTTTATAAGAGGAAGTTTAGATTGT TTGCAAATCTGAAATAAGTTATAATAAGATATTTATACCATATGCGTGTT TTCCTTTCTTAGGTATCAGTCAGCACACTGCAGAACCCAGGATACCGTGT GCACATCTCAGCACCTCAGATCAACAGGATAAGTTCAGATTCATCGGGAT ATGTCGACAACACTGCATATGTCGGGTATAGTACAGGAGGCAGCGTGGAC AATGCCATCTATGAAGGGGTAAGTCAACTGATGAGCTACTTTTTCTTTTA AAGATAGTGGCTAAGTGCTCATTGATAGTCATACTGTTGCTATTTGTTCA CTTGTCAGTTCTAGTTCACATGACATTTTAGGGCTTTATTAATTTTCAAA ATTATAGGAATAGCCTAACCCCAAAGTCAAAGTATATTTAGTAGTAAAAG GCTAGCTCAGCAGGGAGAAAGTTAAAAACTGAGCAAGAGCAACTGATAGT CCACCCTTTAAACACGCCTATATCTAACTGATTGAAATTAATCTTTATCA TACAAAGCATACTATAGCACACCAAATTTGTGTTTGAACATCAGAAACTT AGATGAGTAAGGTTAAAAGGAATGGAATCTGTTTCCCCTTTTTTTTATCT ATGCCTCTATCCCTAGGCCTTATTTGGCCATGCATGGTTTTGAATCTAAA ATGGCTGCATATTGAAACGTCCGTTTTTTCACCAGCAACAGCAAGAGTAC GCCTACACTGACGTGGTCGTTCCCTCTGCGCCAAAACACGATGCCACCTA CCAACCTTATCAACCCTATGACCAGGTGCCGCATGAAAACCTGTACAACT CCCCTGATGCGGACAACGTCTACGCACAATTGGACGGTACCCAGGAACCG CAAGTCCCGTCTGCACCACCGCTACCGTACGCAGAGTCCGAAGGGACAAA CCACTATACATCACTTGTGGAGGGCCAGGAGAACTTGTACCAGGATCTGG GACCACAGTATGAAGAGCTTCCTGCATACGCTAGAGGGACAGAATCAGAT CCTTCTTTAGACAAAACAAAGTCACCGCATGGTTTTCTATGAGATATAGA AAGCACTGAATTGCTGGATCACTGCATATTAGTACATACCGTACCATGTA TATTGAATAGGTGCTGGGTCACTGCAAATCAAGATAGATTATTTCATGTA TAAAGTGTAATATCAACTCTCATACTTCCACAATGAAAAAAAAAATGTTG AGGCCCTCTCAAAAATGTCTTGAACACCGGGATATCTGAAGTGTATATAC CTTTGGACATCCAAGGAGGTTAAAGAATTTTTTAACCTGCTTGGGATAAC TGATGCTGTATTGGTAAATCTCTTTTGATTTACATTTTCTTTTAATGTGG CACTCTAACAAATTATTAGAGTTGCAAGGAGTCTCATTCCAGTTATGAAA TACAAAATAAAACTACATAATATGTACCATGCTGCTATTTGAACCAGGCC ATGCTGCAAATGTTTTGATGTCATGCGGGAATGTTAGAATGGCAATATAC AGTAGTACCCCCAGACTTTATTGTTTTTGTTTTCATTGTACAAACTTGTT AGCAATCTGACCAATTTGTTTTTACTCTTGAAAGTGTCAAGAAATATTTT AAGATTGATGATTTTAAGTTGCTCAATGGAATAATATTTTCCAAAATAGC TTTTAACAGGTGTTACACTGTCACCTCATTTCAAAACTTCTCAATCTCCA ATGTATTTGAAGTGTTAACATTATATGTCTCTGGCATCCACATAATGTTA TAGATTTGATTTTTTACAAATTGTGGAATACAGTGTAGTTTCTGGACAAG TGTTGCATAATTTGGCATCAGAAATTATCCTCATAGCTGTGCAAGTTGTA TATAAGAGCACTGCAAAATGTATGGATTTTAATATTTTTAATGTTCTTTC TAAAATAAGAAACGTTTTGTCTAGTGTAAATTAGACTAACTTTATGTCAA ACTGTTTTATATGTTTAGGTATTTTTAG

Coding sequence (CDS) from alignment at Sc0000086:1035658..1049735-

>Blg00320.0 ID=Blg00320.0|Name=Blg00320.0|organism=Branchiostoma lanceolatum|type=CDS|length=2877bp|location=Sequence derived from alignment at Sc0000086:1035658..1049735- (Branchiostoma lanceolatum)
ATGGATATCAATTTTCTAACGAGGACCCTTGTGAGATTAGAACAGGGTTC
TTTTGCATGGGTCATCTCCGCACACACGGCATCTTTCAACGTCACAAGGA
CGGACCGAGACTACTTCTCCGTACAGACGTTAGATGGAGAGCCGTGTCCG
GATGGGGTGGACGATTTCTGCATGACGAAGAATGCGGAGGGGGCCCACGT
GTTTACGGACGTTCACGGGAACAGGTCGTGTGCGTGTATGTGTAAGAACA
GAGACACCTACATGTCGGATGTGAGGAGATGTTCCCGCGCTGTAGAAGAG
TGTAAGCTGCAGTTTGAGGTTGGGGATGGAGAGGAGATCTACATCATGAA
GGATCCCCTAGAGGACAGACAACAGCACAATTATGTCCTGGACTGGGACG
AGGTGGACTGGACCAATGACGGCTACGGTCCGGGGAGGGACTGGACATGC
TCCGTGTCTTCTCAGAGGTTTCTTGAAGACGGGAAGTGGAAGCCTTTCTC
ATGTCTTGGAGAAGGTGTTCCAGACGAGTTTGTGAAGGTTACTAGAAGAA
GGGCGTGGCTTCTTGTGTTCCAGTTTGGACCATACCATTCACAATTTGGG
GGACTTCTCATAAGGGTGGAAATGAACTGCAATAACCCAGAACAGGGACA
AGAAAGCAAGGAAACGGACACGACTTGTATCGTGTTTAAAACCAGAGGAA
CGCGTCTCCATATCCCAGGTACCCCCTGTGCGACAGACCCCACCCCCACG
CCCCGCCCCCCTACACCCACATCTACCCACAGTACTGTAACAAGAGCAGG
CCCTGCAGCAACTGATAAGGGTTCACCTGTGTTTACTCCAACCTTTCTGT
ACACAACAAGGAGGCAAAGATCTCCGGCAACAGAAAAATCTACTGTGTCA
AACACTACAGGAATGATGATGGCAGCTGATGGAACTGGTAACAACTCAGG
GCTGATAGCTGGTACAGTGATAGGAGTTCTCCTGGCCGCTGTGCTGGCTC
TTGGAATTGTGATCCTGGTTTACCGAAGGAAAAGAAGGAAAAGGTTTTCC
AAACTAGATACAAGGCAGAGCCACAACAGGATCAACACGAGTCGCGTGGA
GAACCCCAGCTACGAGGACGCCATATTTCAGAACGGTCGGACCAGCGTGC
TGTCGGAGGGACTCCTGTACAGCGTGGAACACAACGATGACGATCAGAGT
GAGGAGGGCAATGTGGAAAACGAGATTTACGAAGGGGGTTTGCCTGACAA
CCCCTATGACGAGCCCCTTGGTAGTCCTACTGACTCACTGGAGCAGCCGC
TCGAGATCTCCGGTCCACAGATTTCAGGTTTCAGCATTCCAACAGAGGAC
GTGTACATTCCCGTCGGAGGACATCTCAACACTGCAAGAAAGGTGATCAT
GTTGCAGTGGATGTCACACACGGTCATACGGACAGCAGGGGACTGGACTT
CGGTCCTTAACGTCACCAGGACCGGCAGAGAAGGCGACGTCTTCACGGAG
AGAACGGACACCTGTACGGAGGCTTGGAATGGTTACTGCAGCCAAAGATA
TGCTAATCGTCTCAGCTGGAGAGAGCCAGGTGGCCGGCGGGTGTGCATGT
GCCAGTGTTACACCTGGTTCAACACGTACCTGTCTGACGAGGATTCGTGT
GAGAATGTTCCTTCAGATTCAGATTGCGAGTGGACCTTTGAAGACGAAGG
ACCAGAGAACCTGTACACGGTCACACCTGGCGCCGGTCAAACCGGCTGGA
TAGACTGGGGGGACGAGGACTGGCCAGGCTCGGGGGTCACTCCCAACTCC
TGTTCCATAGACTGGTCCTGCGACATGACCTCGCAAACTTACCTGGAAGA
TGGGGAGTGGAAGGATCTCTCGTGTCTCGGCGGAGACATTCCGGACGACG
TTTTTGTCTTAGACTACGAAGAAAATGGCAGGAGGAGAAACTGTCAGAGA
CATTGGTTTGTCTCTTGGGATGTTACGTATGACATCACACGACTGGGAGG
ACTGGTGATCCACCTGGACATCACCTGCACACGGCGCAGGTGGGGGAACA
GACAGTACACCGAGTCACAATGTCTCAGGTTCAAGACAGAGGGAACTCAT
CTTTACACACCAGGGCCAGGCTGTACCGCGTACACACAGACCACACCCCC
AGGCAAGGTCACCACACAAAGGAGCCAGCAAACTACAGGTAGTGCACCTG
AGACACCTGATGCAGGTATTACTAAAGCACCTGGTGTGGAGACAACACAT
TCCAACACAACTTCTGGAAATGGAGACATGGGCAGGAATACTGGCGGAGG
TGGGGGGAACACAGGAGCCATCGCAGGGGGCGTGGCAGTGGCTGTCATCG
CTGTCCTGGCCTTACTGGGAGGGTTTGTTTTCTTCTGGAGAAGGAAACAT
AAACAGGACACTGGGAAACCGTCATCAGGAGGTCCTCAGGTATCAGTCAG
CACACTGCAGAACCCAGGATACCGTGTGCACATCTCAGCACCTCAGATCA
ACAGGATAAGTTCAGATTCATCGGGATATGTCGACAACACTGCATATGTC
GGGTATAGTACAGGAGGCAGCGTGGACAATGCCATCTATGAAGGGCAACA
GCAAGAGTACGCCTACACTGACGTGGTCGTTCCCTCTGCGCCAAAACACG
ATGCCACCTACCAACCTTATCAACCCTATGACCAGGTGCCGCATGAAAAC
CTGTACAACTCCCCTGATGCGGACAACGTCTACGCACAATTGGACGGTAC
CCAGGAACCGCAAGTCCCGTCTGCACCACCGCTACCGTACGCAGAGTCCG
AAGGGACAAACCACTATACATCACTTGTGGAGGGCCAGGAGAACTTGTAC
CAGGATCTGGGACCACAGTATTTTTAG
Gene-mRNA-Prot
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
Blg00320.0Blg00320.0-proteinBranchiostoma lanceolatumpolypeptide
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
Blg00320.0-exon-Sc0000086-1570713199:1049662..1049735Blg00320.0-exon-Sc0000086-1570713199:1049662..1049735Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1048720..1048943Blg00320.0-exon-Sc0000086-1570713199:1048720..1048943Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1047950..1048218Blg00320.0-exon-Sc0000086-1570713199:1047950..1048218Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1047018..1047159Blg00320.0-exon-Sc0000086-1570713199:1047018..1047159Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1046627..1046827Blg00320.0-exon-Sc0000086-1570713199:1046627..1046827Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1045927..1046059Blg00320.0-exon-Sc0000086-1570713199:1045927..1046059Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1045731..1045767Blg00320.0-exon-Sc0000086-1570713199:1045731..1045767Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1045138..1045293Blg00320.0-exon-Sc0000086-1570713199:1045138..1045293Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1044367..1044513Blg00320.0-exon-Sc0000086-1570713199:1044367..1044513Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1042820..1042859Blg00320.0-exon-Sc0000086-1570713199:1042820..1042859Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1042140..1042388Blg00320.0-exon-Sc0000086-1570713199:1042140..1042388Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1041347..1041639Blg00320.0-exon-Sc0000086-1570713199:1041347..1041639Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1040463..1040601Blg00320.0-exon-Sc0000086-1570713199:1040463..1040601Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1039766..1039843Blg00320.0-exon-Sc0000086-1570713199:1039766..1039843Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1039231..1039320Blg00320.0-exon-Sc0000086-1570713199:1039231..1039320Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1038469..1038610Blg00320.0-exon-Sc0000086-1570713199:1038469..1038610Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1038143..1038167Blg00320.0-exon-Sc0000086-1570713199:1038143..1038167Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1037418..1037573Blg00320.0-exon-Sc0000086-1570713199:1037418..1037573Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1036679..1036950Blg00320.0-exon-Sc0000086-1570713199:1036679..1036950Branchiostoma lanceolatumexon
Blg00320.0-exon-Sc0000086-1570713199:1035658..1035667Blg00320.0-exon-Sc0000086-1570713199:1035658..1035667Branchiostoma lanceolatumexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000086genomeSc0000086:1035658..1049735 -
Properties
Property NameValue
GeneIDBlg00320