Blg00181.4 (mRNA) - B. lanceolatum

Overview
Name
Unique NameBlg00181.4
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000026:307874..327953-

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Blg00181.4 ID=Blg00181.4|Name=Blg00181.4|organism=Branchiostoma lanceolatum|type=mRNA|length=20080bp|location=Sequence derived from alignment at Sc0000026:307874..327953- (Branchiostoma lanceolatum)
CACCGCGTAGCGTGATCACGTGACAGCCGTGGCTCAACGAGGGATTTTGA GAGCAGCAAAACACAAAAATTACCAAATTCATCAAATGAAATTCGTAAGT GATCAGACAAACATTCGAAAATACTTTCAGTTTTATGCTTGAAATGATCC TTAAGTTTGATATGTGGTTATTGTCGGTAAAATGCCCGAAATATCCCAGT GAAAAATTGAAGTCTGCACATTTTGATGCCATCATGCGACGCCATTGAGG GGGACTAGAGTATCCCGGTTTGCGGCGATGTGGCGAAAATTCCGCTGAAT TTCTCCACTAGAAAGGTAAGAAACAGCTTCAAAATCTAAATTACCGCCTA GACAAATACTTGTTCATTTTACTTGGACACGGCATTTGCTGCAAACTTGC AGGATTGTTGATATGCAATGAAAAGTTTGGTGGGGTCCTGCATGGGGGCT AGGGTGTTTGGAGGGTGTGGTTGGGGCCTAGGCACGCACGCAGACGAAAG CGCGCGCAATTTTCCTAAGAAACGTCATTTTCCCTTAGTTTTATTGGATA TTTTGCTCCACATAACCATCCATTAGATATTACAGAACAGCTAGGAATTT TTTAGCTCACAGAAATGTCGCGAATGCCCCAAAAGCGATCGTAGACTACG AGCTGAGAAAGGGAGACCTGCCTGAAAACAAATGAGGCCCTAAATGGGGC CTTTCTCGATGCCCATTATGTGAAGGGTATGGCGGGGTTTGCCTAAATAT CGGGCTTTTGTTGTGGAAGTCAAACAGTACTGTAGACAACACACTTGTGG AACACGAACAGGGCAATTTTTTTGTCTGCTACAAATGTGTGTTGCAGTAA CAAGGAATAATGCCCAAATAATATAAACACAAGCCATGGATCTTGGCAAT TAGAACCAAGGACATGTCCTCGATCTTGGCAAGCCATTAAAAAAAAATTA AGAGAGCAAGGAGGTTGTTGATAGTTTGATAATTAATTTTTCCACAATGT TGCAGCAGTGCTGCACTCAGTTCATATTTGGGACTTTCAGCTCATATTAT TTGAGATTGGCCATGGGGACTAAACAAAAATTTCAAAATTAGTGAGAGAC CATAATGATAATACTTGATACGGTATATAATATTACCTGAAGGGCTTTTT ATTAGAATATTTAATCCTTTGCAGGGGTTTTTCTAGAGGGAGCACACACA GGCAAGGGAGCGAATTCTATGTATTTATGGAAGAATCGATTGTTGAGTGA AGGCTGTATGCTGGATATTTTAGCTAAAATCTGAATTCAACAAGGGGCGC TGGGCTGCAACAAGAGAGCGCAGCGCCCCTCTTTCCCGATTTAGATGAAC CCCTGCTTTGGCAGCCCTGGTTCACAGTGCACCCTGAACATACAGCCAAA GCAATTAAATGAATAAATGAATAAATAAATGAATGACCTTGCAATTTGCA TGTGTTCACCCAGGATATTCCCAGTGAGATTGCATCACAGTAACCATGGA GACCCAGGTGCCACTCCCGGGAGCCCCGATGGCGGCCCAGGGCCAGCCCC CGCCACAACCTCCCCTGCCGTCCGGTAAGCAGCTGACGTTACGGTTTCCT GAGCAGAGCCAGTCGCTGGTGCGCAGCATGCGGGACTTCCAGCAGCACGG GCACTTCTGCGACGTCACCTTCCGTGTGCAGGACGAACTCTTCAGGTGAG ACGTTCCTTCATCTTTGTTTTTTCTTTCTTTTTATCTTTAGGGTAGTTCC TCCGAAGTTTACAAGAACTGATTACCAAGGGAGCCCTTGACAGCATCATA ACAAATTAGGATGCAAAAGAAAAAATATTTTAGCATCGTAAACTTCACAA ATCTAAAAGATTTAAACAAGTCCTCTAAAAGAAAGCAGCAAGATTTTGTG ACAATTTGTAGATTTAATCCAGCTATGTCATTCCAGTATTTGCCTCTCCA TCTCACTGTGTTGCTGAATCATGAAATGTGTGCATTTCCTGTAGATGCCA CAAGGTGGTGCTTGCAGAGCAAAGCTCCCTGTTCCAGAGCATCTTGTAAA ACCCACTAAAAGGAATAAGTGATCAGATTTTTTCATTGCAATCCTGAGAA GGAAATTAGTACACAGTCTCCATCTAGTTCAATTTCATTAATTCTAATGG TACTATGCCTGCATTTCCCGTAGATGCCACAAGGTGGTGCTTGCAGCGCG GAGCTCCCTGTTCCAGAGCATCCTTTCGGACGCCAACCTGCAGCCCAGCG AGGCGATCCAGCTGGACCTGATCGGAGCCAACATCTTCTCGGCGCTCCTC AGCTACATGTACACCACGGAGATCGTCTTCGTGGACAACGATCGCGATGC CCGTGACCTCCTGTCCGCCGCCAGCCTGCTCCAGGTAGGTAACGTGCGTC AGGGTTCTAGCTTGTGCATTTTAGCGTAACGGGCCACCATGCTACTATTT GTAACCATCACACTTGAGTCTCTCTAGTCTTGAACGAGGACATCGGTGAT GTCATCTCGGGAGACAATGGGTTCTTCTGCACCACTCAGTCCAGTCTTCC ATCAGCGATCGAAGCTCTGTTGTAGATATGTCACTGAGCCCAGCATCCAT TTTTAGATTGTCAATGAGGGTTGTGCGTCTCCTGTCCCTTTTCCTCCTTC CCTCTGTTGGCTCCCAGAGGATAAGCTGGCTGGCTGTCAGCTCAGTATGC CGGACGCAGTGTCCAGCCAGTGCCATTCTTCGGTGCCTTATCTTCGGGGA GAGTCTGGTGAGATCACCGTAGAGTGCGGAGTTTGTCATACGGTCCTCCC AGGTGACAATCAGCACTTTTCGGAGCATCTGGGTGTACATCCCGTCGAGC GAGCTCTCGTCCTGTACCGTCAGAGTCCAGGTCTTCGAGCCACACAACAG TACACACTCGACAGTTGAGACGAACACCATCCCCCAGATTGGTCGCTTTG CTACCTCACGATTAATTACCATTACGCTGAAATAAAATCATGACTAGAAG TGAAGTACTAGAGCCTTGTGAATAGTCCAATGGTTTAAGCAGCCCTGCCT CTGGAACAAGAAGCACTGAGTTTGAATCCCGACTGTGTAATGCTCACCCG ACAGGACGTTAAAGGAAGCCAAAAGGTTTCGCCGGGAATCCTACTATGCT ATGCTAAATATACCAAAAAGTATGGTCTCCATCGAAATTACATTAGTCCG TCATAATTCACCGCTATATTATTAATTTGAAAATCGCGGCGTACGCCGCC GCCCGGTGACCTCAGTTGACCTCTACTGCCTCGTGACCCCGCGTGATGAT GTAATTTCGATGGAGACTATAGATTTTGGTATGTTTAGCATAGCATAGTA GGATTCCCGACCAAACCTTTTGGCTTCCTTTAAGCCATGATCCACTGTTA ATTGTGCTTTTTGAAAAGAGGAGGGAAATTTCCCTGGTATAATGAACCTG TAAACAACAAGTGCCTGTCACGACCAGTGGAAGAATGGGTCTTCAATGAG CTAAACTGGATCGATTTCACTTTTAACTTTCACTTCCTTTCCAGCTGCAC CCAGTAGTGGAAAAGCTGACACAGTTTCTACAGGACAAGAATGCAGCGTT GGAGGCAGAGAACAGGGCGCTACTGGCAGGGGACGTCGGGCAGGTATGTA ACAGGGCTCACTAGCACAGTAGTGTAGTATAACTTGAGTTCCTTGTACTT TTCAATACAAGATCCCAATGTCTAGAATATAGCAACTCACTAGCACCACA TTGTACATGTAATATAACTTTTATTAGTTCCTGGTTCTTTCAAAGATCCC CATCTCTGCAATATGGCAACTCACTTTCCCCCAATCTGTTCTAAGAACTG GGTGTATGCAGGCACTACAGTATTTCCTTAGATACTGTCTAAAAGTAATG ACCCAAGGAAAAATAATCTAATCTCTAGTCTAGGAGCTAATGCCTGTCCT TGCTATTTCAGTTAGCGATCCTCACCTTATTTAGGGTACAGTCAACTGCT TTAAGGAAGTGGGTTATGATGATTAGGTTATTAGAAGAATATACCTTTTC TAAGAAATAGATACATACATGTATATGTATATAAGGTACATAAATGGAAG AGAAACTATGTACTTGAAGCCGGTCTACCTCAGTCTTGAAGGGATTGAGC GAGTATACAGATCACAAAAATTACTGTATCACCCCCTTACAGGTACGTCC GGAGATGGTGGATCAGGGGAGCAACACCGACGCGAACAGCGCATTCCCGG CACTCCCCACACAAGGTGACGACGTACATTCGCGGATGTTCAGCGAGATC CTGAGCGGTGGCACCACCAGCAAAGCTGCAGACTCGAGCAAAGAACTGGG GGGAGCCGACCTCAACCAACCCTCCACAAGTGCACAGTCTACAGCAGACA TCCCTCAAGACAAGCCGGAGGATCTGGAAGACGATGGGGAAGAGTCTGAC TTGGACGCCGGCGCGATAGAAGACGTCTCAGAATGGGAGCCAGACAGCCC GGTGGCCCCGCCCACGAAACGCAGGAGGGGGAGACCGCGGAAGGGAGAAT CCAGAGGTATCCGTATCAGTATCTTATATATATAACAGCCCTTCGGTGTA ATGCACCAGCTTTGCAAGCACGCAGTGCGACAGCAGCTGGTTTTATCGCA CTGAACGACTTGTCACACCTAACCTTTGCACATCTAACTGCAAGTGTATC TATCTAATGAGGATGCCCCTACTATACTGGGTGGCAATGAGTTCCACTCT GCGATAGTTCTAGGGAAAAACAAGTTTTTGAACGCTTCCATACTGAGTTA ATAGATCTGGTAGTTGAAGGCATGGCTTTTTCTTGTTCTTTTCTGGGCAG ATACTAAATACTTAGTAGTTGGTATGCCTACCAGGTTATTGGTCATTTTG TCAGACAGTACAGGGATATCATGTTTCAAATCAAAGGATTTGTTGTTGCA AAGTTTTGGTGCCAGCAGGTCTACCAACAGAGAGAGCCATGGGTGTTTGT TCACATAGATTCCATGTGCCAAATTATCCTGTTTTTAGTTGAAGTCATAA TCTTTTAGAATATTTTGATAGAAATGCAGTTTCTAATGATAAGATACATC GTTGTGTAGTGTTTTTGTGATCTTTTCATTGGAAAAAAGGGTTGTTTTGA AACAGACTGCATGAAATAATCCTGCTTGCCCGATCAGGCAGGGTAGCGTG CGTAGTCAAGTGGTTAGCGATCTTGACTCTGGAACTAGAAGCCCCGGGTT CGATCCCGGCTGTGTTGCTCACCCGACATGCACGCTACCGTTAAAGATCG CAGTCCTTAGGACGGGACGTTAAGCCGTGGTCCACTGTTCATTGTGCTTG TCGAAAAGATCTAGGGGAATTTCCCCGGTACGATGAACCTGTAAATAACA TAGCGTCTGTCTTCTCTGTCACGACCAGTGGAAGAGTAGCTCATCTGTTC ATTGAGTTCATTTGAGCTAAACTGGTTCGAGATCACTTTCCACTTTCCAC TTTCCAGGCAAGTGGGGTAGGACATCCACTTGCTCAAACAGCACTTTCAC TTGCCCCGAGCAATCATATACTAACTTGTCCAACCCTGACTGTACATTAT GCTTAAACTTGACTTTTTCCTTCAAGGTAACGCCCGGCCGAGGAAACGTA AGAGGAAGGAGAAGGGCATCCCCGACTGGAACCTGTCCAAGGAGCAGCAG CAGTGGGTGAACCAGACGCTGGAGAGGGTGGAGAAGAGACAGAGGAACTG TCCCGAGTGCGAGAAGGTCTTCAAGATGCCGCTCGACATGAGGAAGCACT TGATACAGGTATGTAGTACAGTATCTGTGTTTCACTATCTCTATCCAATT TTACAATCATATGGGGGTTTGACGTGCTTGCACATGGATGGGGGAGCCCC AGAACTCCTCATCAAGTGCAAGTCTTTTTTGTAGCAAGAGTTTTTATGGC TGGATGCCCTTCCTAACGCCAACCCAAACCCTATTTCTGGGCTTAGGACT TTGTCACTCGATATTGCAGCCATTTGGCATATATTGCAAGTATGATTTTA TTTTGTACCCCAGCTTCAAGGACATGGTTTAATTTACATTTTGTATATTA ATGTATTGCAAGGACCACAGGAAGAATACTAGTAGCTGGTAGTAAATAGT CCAAAGAAAGATAGAGGTAGCAGAAAGTTAGAGTTAGCAGGTACATGGTG CCAGCTAGTTACATTTTGAATACAAAATGTTTGCATGAAAATCCATGTGC TGTCCATAGATAAAGCTAGGTGTTGCATCTGAAGTTTGAAGAATGCGGTC CCAAATGTGACTGAGTTTATATCTCTCCTCATCACGGTTCATGACTGGAG TAGTTGGCTAGTTAGATAACTCTTAGTTGTGCACAAAGAAATGTGGTATC CTGTGTTTTTCCCAACCTGATTAGACTGTTCACGGATGTTCCTTGTTTTG TTTTGTTTCTGTGCAGATCCACTCGCCGGAGCCTCTCTTCTGCTGCCGGT ACTGTCACATGTCCTTCCGCACGTGGATGGGGATGTCTCGCCACGAGAAG GGGCACGAGAAGGAACAGGAGGGCATAGGTAAGGATAGCACGGGGTTTTG CTACTTGGTAAAGTCAAAACGTGCATGGAGAAGTTGACAATAGCTTATAT TCATTATAGTTCAAGGTAGGCCATGGGCAGTAGGCCTCAGCTCCGCGGAC TCAAAACAATAGCGAGTTTGTCTTCCCCGCTGAGCAGTTGCGTAAGACAT CCTACCCCATAGTTATGCAAATACTCCCGACGGCCCCCCGTCGTCCAATG TGAGACAGCCGCTCGGAGGAGCTAACTTCAAAATATCTAAGGGTACGAAA TCAGCATTCCTGGTCACCGTTACCAGAAGGGGTGTCTTCGATCTTTCGGG GGCCAATCTGGACCTATTACTGTCCATTGCAGTCCCCATTTTGCAACGTA ACAAAGTAACAGGATGCTCACAAAAGATGTGTTACACTGAAGATACGTCA TAGTCGTTTTAATGGAAGGTTTAGCATGTTTATCGTCTGATTTTAGCTGG TAAATCTGGCTAGAAGTACGATATCTAGTGAGTACGTAAGAAGCAAATAG GAACGCATGTACAATGCTGGTAGACAAATATATGATGAATAAGATATCTA TGTTCACAATCCTGGCATTTCCAACGCTTATCATAATGATAGCTTAGTTA ATAGCGGTGCCGAAACCCCTTGCGTGCATGGCACCTGCCCGGTCCAATCT GCCGGCCATGATGTCATTGTTCCGTGAACAGCGGTGCCGTGCATACTGCC GGCAACGGTCATGTCGGGAAAAGAAGGATTTTTGGGCGTTACAGAATGCC TCGTATCGTCCTTTGTCATCGGTTTTTTATCAACTAGGTGTTTTCCATGG GTAAATAGGACACCAAACATGAGAATCACCACCAAGCCAAGTGCCTGAGT CGAATGAATTGGCAGAAAATTAGGTTGTTTGAAATGAGGTTTCGTACCTA TCGCTCATTTCTCGCTCCGCGAGGAATTCGCTTGGCGCCCGCGGCGCCAT GGGGCGCCCTTCGGGCGCCCACCTACGAGCGCCCTTCGGGCGCACTTCGG GCGAGGTCGGCTTTCGGGTAAGTTCGGGATCAGCCCAGCCTATCACCCGA TATCCCGGTATATATTCGGTATATATATAGACTCTCCTTCCGAGGCCTAC AGCCTATGGGTAGGGTGCCTTGAATATATGGCCGAACAAGCATTCAAAGT AAAATAAAGGCCTTGACTTGACTGACTTGACTTGATGTAATGCTTACAAT TACACATCTTTCCAAGTAATGAATTAGATTGGACATAAAAGATCATTGTT GGAAATGAAAGATAATGGTAAACTATTTGCCATATTATGCCTTGCATATC AAATAGATTTGTAGTGAAATATATCTGTCAGAGCTCGAAATAGTTGGAGC ACTAGTGTACCAAGGTGTTTCTGTAGTGTTTTGCTGACATTCTATATAGC TGAACTTTTTTTCATGTTGGGCACCCAAAATGTTTTCTGTGTTCCTACAT TTTTATGTTAGGTGCGAGGGTGCACCTATACCCAACAATGAATTTCAAGC TCAGCCTGTAGTGTCTGTCTTCCTTTAGGGATGATATCCTTTAACTGATC ATGAATCAAACTAAGGTGTTTATTCTAGACTCATATACCTACGGTAGGGG TGGATACCGGTTTGGCTTAATATTGAGGTCCAGGTTTAGGTCCAGAGATT TAGGTTCAGGTCCGGACCTGAACGATCCTGTCTAGTAGACATGTTTTGTT TTATCAAACCAATATCAAAAATTGAGAATTAAGACTGACATGCATGGCTA TAAAAGTTTCTTGTTGAGAAGACTTTCAAGACAAACCAGTATTTGATATT TGAATGTTGCAATAATTTTAAATGCCTTTTCTGTCAGAGGGGAGACTCAA AACACTTTTCATCAAACAAAATACGACTCAGGTTTTTGGCTTTCAGGTTT TTTGCACCCGGTTCTTGGATGTTATACAGGTCTGAATCAGATTCAGCAAA TCGGTATCCACCCCTAACCTACGGGCATGTTTTGTGTTGCCAGGTGAAGC AGGTGTGATCGAGGGAACTCCAGAGACGCCCCAGGCGGAGAGAACAAAGC ACCAGTTTACAGACGAGCAGAAACAGTGGATCAGGGACACCCTAGAGGAT GTCGGGAAGCGACAGAAGAACTGTCCGGCGTGTGACAAGGTGTTCGACAC ACCTGCCGCCATGAGGAAACACCTGCTACATGTGAGGGTCTCTTATTGCT GTTCTCTTTTTAAAAAACGATGGAAACTCCAACTGCAGAACTAGCTCTGT CTCTTCAGAATTCTCTCTATTAGTTAGATGGAATAGATACATGGATACAG TTAAGGCCACACCATTTTGATTTCTTGGTTAACGGAATTTTTAAAAAAGA TGCTACATTGGAAAATCAACAGGAAAACAGGATCTCAGAGGAAAGTTTGT ACTTTGGTGCACACAGTATCAGGGAGTGAACAGGGTGAGATGCAAGTTTT CACCCCAGCCTTCTGTTTTCATGATTTTTTTGTGTGCTAAAATTGAAAAT AAAAATCCGTTAACCAAGAAATTAAATTGGTGTGGCCTTAGTTAGATGGA ATAGATACATGGATGTAGTTAAGGGCTCGAAATACCACAGAACAAATAAT AGTGTGATGGCCCGATATATTGTACACACAAGCTAGAGCCCTGACAACAT GGAATAAAAAAGTAAAATCTGATAAGAAACCATACTGCCTCTCTTCAGCT TGGATCTGAAATTCTATAGCTATCTTAATACAACAAAGCCCACAGTCAAA AATTAGGTGCACAGTGTGGGTTAAACTTACCAACTTTAGGTACAGAAATG TGAAAATAAGGTTTACTTGTTATGATTTATGACAACTATATAATTGTTTC TTTCCTGTCAGGTACACTCGAAGGAGCCCCTTTTGTCCTGTAACATTTGT GGGTTGCTGTAAAGATGATGTTTACTTCAATATTCTGATTTATGGAAATC ATATGAATGTTCCCTGCCAGGTCTAGTTGCAGGAGCCCCTATTCTCCTGT TACATCTATGAGTTGCACTTAACAATTACTCTTGGTGCAGAACTGGTACA GAATGTTCAATCTGATTTACGACAAGTATATAATTGTTCCTTTTCTACTA GGTCCACTCAAAGGAGCCCCTGTTCTCCTGTAACATCTGCTCAGCAAAGC TGCGAACGAGCAGTGGACTGCGGCGCCACTCACAGACACACATCCAGAAC AAGCAGCACGTGTGTCCCATGTGTGGCAAAACCTTCAGTCGGAGGGACCA TCTAGTCAAGCATGTCAGGGTCCATACAGGTAAGGAGTGGTGTATGTGTT ATATACTTGTGATATACCTAATGCTTGGGTCACATTTCCAACCCTGGGCC TGGCCGGACAGCTTTTGGGAACGAAAACTATGATATAAAAGACAACAAAA CAGATAAAACTTTTTAGAAATTATTCCATACCATACGCTATGTATATTCT TGATATGCATCTTTTATTCTTTGTTTTCTCAAACAGCCCGGTCGGGCCCC GGCTTGGAAATGTGACCCTAGCATAAGGTTGTGAGGGGGGGTGCTTTTAG AACTTACACATCCAGAACAAGCAGCATGTCTGCCCCATGTGTGGCAAAAC CTTCAGTCGTAGGGACCATCTAGTGAAGCATGTCAGGGTCCATACAGGTA CATGTAGGAAGGGTTTATTGTGTTATACCTGTGGTATACCTACATTGTAT GGTTGGGAGGGGGTTCTTTTAGGCTCTACACATCCAGAACAAGCAGCACG TCTGCCCCATGTGTGGGAAAACCTTCAGTCGGAGGGACCACCTAGTCAAG CATGTCAGGGTCCATACAGGTAGGGAGGGGTGTGTGTGTTATACCTGTGG TATAGCTAAGGTTGGAAGGGGTGTGTGTTTAGGATTTAAACATCCAGAAC AAGCAGCACGTCTGCCCCATGTGTGGCAAAACCTTCAGTAGCAGGGACCA CCTAGTGAAGCATGTCAGGGTCCATACAGGTAGGGAAGGAGTGTGTGTGT TATACCTGTGGTATACCTAAGGTTGGGAGGGGGGTGCCAGTTTGGTTCTA CACATCCAGAACAAGCAGCACGTCTGTCCCATGTGTGGCAAAACCTTCAG CCGCAGGGACCATCTTGTCAAACATGTCAGGGTCCATAGAGGCAGGGGTG CATTGGTTTGGGAGGGGGTGCATAAGGTTTGGAGGGGGTACTACAGTTAG GTTTTACTCAGCAGAACAAGCAGCACGTCTTCCCCATGTGTGGGAAAACC TTCAGCCGCAGGGACCATCTTGTCAAACATGTCAGGGTCCAAACTGGTAG AGAGGCACATGCGTGGGGTTTTCCACTTGCAGTTCACATCTCATTGTTTT ATTATTGATACATGTAGTGAAAAGGGTAGACATACACTTTGGTGTGCAAT GGCTAAACCAAACAGTTAGTTTTGCAGCTTGTGCTTTCCAACTGTTGGTA GAAAAGAACGCAACATGGCCAAAGACCACTGTACAGTCAAACCTGCCCAA GGCGACCACCCGGCGGACCGAGCAAAAACGGTCGCGATGGACAGGTGGTC GCCATGAAGAGGATTCCACTCACATGTTTCCAGGTCAAGTTTTTCAAATA CAGTACGTAAATGGATGGAAAATTATGTGAATTTAGACAGCATGACCCCC ACCAGGTTCAATTCTGATTGACAGAAAGATCCTAAAAAAATTGCATTTTC CGTTATCGATGTAATAATTGTATACCGCTACATCGTGTACAAATTTTCGT CATAATTTTTACTACAAAACAATGGTTGCCTCGAGTCGATGATGTCGCAG CGCCCTCCCGCATTCACATGTTACATTAAATAGTACACACACACACACGC ACATCATCGAAGTTTTAAGGACTAAGACAGATCCCTAGAAAACGCCTGCT GGTCCCAGCCTTTTTTTGGGGCGCCAACCGCTGGATGAAAAGGTCAAAAA GTTTTCGATCTGACAACTAAAAGATGAAATGGAACGGTGTGATTTCGTCG CGCCGCGCCGCCAAGCTCTGTGCGACCGCATCGAAAGGTAAGTCAGTGCA GCAGAACGCACAGAGTCCAATAAAAATTTGTGAGATTCATGGGAATAAAA AAAAAAAAAGAATTTTAATTTTCACCAATAACTAGAGTATTCGTGAATGT TCATACACAAAAGCATCGTGTTTTAGAAAAGTCAGCGGTACGCCAAATCC GGGCCGCCCCAAGTCCAAGATGGCGTCGGGACCAAGGAACAACATTTCTC GCCCGATGTTTTGCCCACCGCGAAGTCATTTTTCGGCGGAATTTAGCAAG ACACAGACACATTTTTGTTGAAAATACAAGAAATAGATAGTAATTTCTGT GAAATCTGACTTTTTGACGCCTTGCACTACGTATTCGTTTTGAAAATTGA GTTTAAACGGAACTGAGTATGCGTTAAACTATAAGATTACGATAGGCACA ACAACATCACAAACATTTGTCTTTACAATGTTTATAGGGGGAACGTTTTA TTAAACACTTCATGGACGAATCGATGCTATAACATTGCTATTCCATATAT TTTTGTCCTTATTTTTGTCCTTCAAAGTCTTGAAAACATTTCCGTGAAAT CCGACAGCAAAATGATCCGATGTCACCACACGCTTGAAAATTAGGCGGCC GCCATGGGCAGGGATTGTGCTCTGTGCGGTCCCAATTCGTGGCGGTCGCG GTCGCGTTGGACGGGTGGTCGCCTTGGGCAGGCAGCTTAATGCTTGTGCC TATGGGGAAAATTTTCGGGACCGAGAAAAAGCGGTCGCCATGGCCAGGTG GTCGCGTTGAAAAGGTGGTCGCCTAGGCAGGTTTGACTGTATTAGATTCA GATTGCACTGAATGTGTTGGATGTGGCTTTTAGATTTGTACAGATGTTTC CACGTCATACCAAGATAGAGTAATGGCTGTTGACCAAATATACAGGACCT GGTAAATAATAATCACTGATCATGATGTTAAAGTTTATTTGTTCATTCCC CAGGAGAGAAGCCGTTTAAGTGCCCCGACTGTGAGCGGCGGTTCCGTACT AAGTGGGAGGTCATCCAGCACAAACGCTACCAGATCTGCAACACTCAAGG TCAGACAGGGTTCTAATCTTAGCCAAACATTCAAAAGGTCTTTACTGCCT TTCAGTACAAGATTTATTTCGTTTAAAGCATTGTACTAATACCATCTGAT AATGACTGTACGTGTACATGTAAATTTACATGCCTGTGAGCATGGTGTCT CAATCGTTTTGTTTTAAGCTGTATTTTGTTTTGTTATGTAAAACAGTACT AAAGGGGTCCAAATCACAACACTATTACCTTCATATTGTGCTAGGTAGAA CACTCCACTGTCTGGTAACTTTCTACATGCAAATCTCTGCAGGTCCGTTC ATCTGTAAGACCTGTGGGCTGGAGTGCCGGGGCGCGCCTTCCCTCCGACT GCACGAGGCTGAACACAACGATGAGAAGCAGTTCCAGTGTGAGGTGAGAG GGGGCTCTGCTGCAACCAAATTATGCATCTTTTTTATCAAAATACGTTAG CAGTGGACATGGATGGGATCGTTAGGGAGGGAGACTGACTTTTGTAAAAA TGGGCATGGCAGTGTAATTTTTGATTACGTCATTATGTGTCCTAAAATTT TTAACGAATCATTATCTTCAAGGTCACTGAGACCCATTCATAATGCTTGG TAAGCAGTATTTTTAAGACCCCCCCCCCCCAAAAAAAATCAGCAACCATA CCATTGTTCTACCTTAAGGGCCAACCATGGCACTCTGGCAGATGATTAGC CTTAATTATGATTATTACCTGTGACAAACAATACTTGTCCTCTTTGTCCC CTTGGGTATGTAAAATTTGTAATTTGTGATAATGATAAAGGGTATTTCCC TCCAGGTTTGTGGGAAAGGCTTCGCCCTTGAGGACAACCTGAAGCGCCAC CTGACGGAACACGCCGACATCCCGTCCGTCCGGGACACGCTGTCGTTCAA GTGCTCGCTCTGCCGCTTCGTCACGACGTCCAAACAGAACCTGAAGCACC ACGAGCTCAGGCACAAGGGAGAACGGGCCTTCCTGTGTGACTTCTGTGGA CAGAGCTTCCTCACAGGTTTGTTGTTTGTTTGTTTGTTTATTTAGAATAT CCATTAGTAACATAAATACCTACCTACCTACCTAGTTTTTAGTCCCCTTG TGGCCTTTCTAGATACTGCAGCAGAACTTCCAGTTTTTTATCTAGAGAAT GCTCTGGTTCTCAAGAAAAATAGGCATAGATTTGAGCCCTCTAGCAGATA CTTTTAGAACTGCAATGGCATTTTAGTTGCTGACTTTGAAACATGTCAAC AGCTGCAGGGGATGGATGATATTAATTTTTGGCGACGCCTTAGGGGCAAG CCTAATAGTATACTTTACGCCCGTTTCCCGGAATTGTTCAGGTATGTATG GAATTTTGTTTGCGCCTGCGTAGTGGCAACATACAAGTATTCCCTGGGGA ATTTGTTTTTCCATTTACTATCAATTTTTTTAACCATTACTCAGGGACCA AGCTGAAGCGGCACAAGTACATCCACAAGTCAGAGATGGAGCGGCCGCAT CACTGCCAGCTGTGCGGGAAGGGCTTCATCCAGAAGAACCATCTCAAGAG CCACATGCAGAAACGCCATCCGGAGTACGGCGGGCGCGGCCCCGTCCCGT TCACGGGCCAGGTGGCCGCCCCCCACCCCCAGCCGACCCACTGCACGCTG TCGGCTACGCTCACCGATGTCCTGACTGTTGATCTACAGCAGCTGGTTAG CAGCACTCACCACCAGTAGTAGTGGAGGGGGAGGATAGTTACAAGTTGTT TAAGGCCCACCAATTGATTTTTGTAGATTGAAAGTTCATCTGTGTTGGTG GACATCATTTTGAAGAAAAGTTGAACCGTTATTTCCAATGTGAAAATTGG ACTTGCTCAAATTTTTGACTGTCCAACTCCAGTGGTTGTGTTTTTTATTT CTTGACAAAGACTCGAGTTGGACTGTCAAAAAGTTGGGTCAAAGTCCAAT TTTTTTACAGTGCTGCCTACCATGGTTTCGTTAGCCAGATGGTTGTTGAT AATGGGAGCTGAATCTTACACACTTGTCACCAAGGTTGTATTGGTTTACT GTTGCAGGGTTAGACAGAAGGTGTAGATTAGATGATATCAATTTGCACCA GTAAGGCTTATACTGTAAGATACTGTACAGACACTGAGGTTAAGGAATGT GTGCAAGTTTTTTTTCCACAATTACAAAGTTGTCCACCTTCTGAATATTC AAAAAACGTACCGGTATTGGCTTTAGGATTTCTGTTGATTTACTCTAGAC GTACAAATAGGCAATGGTTAATCTAACTTAACTAAACTTACTATAGAATT TTAGCCTGGGTGCCATCCTATTTCTACCGGGGCTACCTTAAAAAGTTTTT TAGGGTAGCGAATGTAGGAGCCCTGGTAGAAATAGGATGGCACCTAGGCT AATAGAATTTGGGTAAAAGGTCCAAAAAATAGAAGGTGCACAGTACTTTG AGGTAGTGATGATGTGCACAGTGCAACCTACCAACTTTTGTTTACCAGAT GAACAGTGGTAGAAGAAGCTATTTTGGGACAGTTTGGATAGAATGTAAGA TACTGTACAGAAAATATTTCTTGGCATGGTTAAAAGTTATCTTCTTCATA CCTTTATTTACATAAATTTGCCAGACTTACCAGATAGTGAATTTGACTCA TAGTCTTTTTCAAAATTTGCAGTTCCAACTAGGGTCGAAAAAAGATTTTC CCATATCTACTTCAAAATGTGAATCCCGAGCAATTCAATAGGAAATGGAT TAGCAATTTGGCTAAAATGCAGGAAATCAGAAAATATTGGTCTATAAAAA GAGGAGGCCTATGGGCGAGACATTGAGAATATATTTGAATTTATTGCTGC AACTAAACCTGTATCACAATGAATGTTTTGTCTTTCTGCATTTAACCTAT AATTCCAGTTCCGCAATCATTTACTGATTAGTTCATAACTATATTACATC AATGCATCCAGCTAAATTACCTTAAAAAATGCAAAAGTTAGCCTCCTTCC CAGACTTCTTTCTGGAGCGGTGTCGTTTATTTTTGGGGAAGCACTGATAC GCGATTTTAAACATCAGCGCTCCCAAAAAATGAATGCCACCTATGCTAAG GAGGCCAACTGTTGCATCTTTTACAAAAGTTCAGTTGGATCATAATGTGA CCATAATGTTTAAGCGATAACATTTCAGGTCCAATTTCACACCTTACAAG CATTTTCCTCCCAACATGGTCACCACAGACTTTAACCTGAGAAACTGATT TGTCCTAATACTAGATAATGTCCATATTGTGTCATTTGTAACTCTACTTC CAACAACAAGTTTGCCACTGATATAATCTATCTTGACTAGCCATTTTTAA CAAATAGCTGTTACATTATGTACAATGAGTATATCTACTTCAACACAAGT TCACAGTATTAAACGATTACAGTCCAGTTTGTCCCGGGGTTTATTTTATT TCTTGAAGGGTTGTGGTGACCATTTCAGGTGTTGTACAGGTGCCTGTGCA AATTTGACCACCTACATACAGTCTGTCTGTCTGTTGATAATTGGTACTGA TAATGTCCCATTGTGCAACAAGTTATGTCTCATCTGCATCCAAAGGCTCA CTGAGTCTTTCTTCCTCCTCTACATTTGAAAAATCTAGTAGGCTTTCATG CATCTAACTCTGAGTTGCAATCCTTTTTCAAACACTTGTCTTGCATGACT AGACCAATTAGCTACTCTCCAAGCAGAGGTTAGGCTCTAGCTTGCTACAC TGTCTTGGTTCCTGCCTAGTGTTATAATAAACTACCTGGACATAAATAAG AATATGATTGAAGGAAATTGTTTTTCCTGGTAAAGAGAGTATCACACACC TTAGCCCACACCGCAAACACTATTTATCACTTGACGGAGGCTTATGTCCT ACAAACTATTCTTTTTGCTCATTGTTATTTTTTACTCTCTTCAGTTTCAA ATCTGATGAACTGCCATTACATGGAGTGTCAGTATTGCTGTCTATTGTAT AGATATGTATTGAATGCTTTGCTGAGGTACATGTTTTTGGCCCAGGCATC AAGTTCTGAGTACAATCCTGGCAATTTTTAGTTGTCAATTGTCAGTCACC TTGACAAGTTATGTCATTAAATTGGTTGCCAGTTATGAAAGAACTGGGTG CAATGCAGGTGGGCCTTAATGTTACATTTACATGTATTCATTGAAGCTTC TTGTTAAGCTTGTCCTAAATGTTTAAACTATTGTTACCACTTCCACAACA GAGTGTAAAACAGCAGTTCGTCAAATACCGTTTTGCAGCCACTTTCATCA AGGAGGATCAGTCTGATTGAAACCTTGCTTTCATTGGTTTGTTCATTGAT TGACTTTGATGTCAGCTTGTTTGTTTGAACCTTTGTTTATTCACAAAAAG CTCAAATTGGCACGCAGGCCGCTTTTCATTGAGGTCATGAGGGAAGAGGT AAGGGTCAGATACAATATAGCAGATACTCAGTCATTTGAGTCCTAATAAC TCTATCAACATACAACATAAAGTGTCATAACATGTTAGTGTTCATACTGG TTGTTGTAGATTTCCAAATATCATTAATTGGGTGACTTCCCTCACACACC ATACATGTACATGTAGATTTGTTCCAAACATTTATTTTATAACACCTTTG CCTTTGCTACTTTGTTATACATGTACTGGCAGATCCTCCAGATAGTGCTC AAACTTGCCACACTAAGACTTGGTTAACTTATGTTTTATTTTGTCCTAAA GGCTAATATTGCACTTTTTGTGTTTTGTCCTTTCCTTCTTTAATGGACTT ATCATTGGCATCTATCATTTTCAGGATCTTTGTTTCCATCATGAAGATAT GGAGGATGGTCTCTTGCTGTCAACTTGTTAACTTTGACAGGTGTTCTCCT CTAGATCTTTGGCCTATTGTCACTATACTTGCAATTATTTGTGCATCCAT GTTGGCTTCTTACAGAATAGTACAGATAGCCACCAGTAAGTTAGAAGCAG GTTTAGATTTCCACCTTGATGTTGTTTAAAAGCAAGTTCAGGTAGTCTTA CTGATGTTGCCATGAGTTACTACTAGTAAGTGTGATCACAACCACCCTAC ATGAAAATATTTTCATAACTACATGTTTGTTTCTCAGTGACATATGTACA TGTACCTAATTTGGCATTCTTTTTATATCATCAAGGGCATTAGAATGCTA CCCAGGCCTCTTTGGAATTGTTGGAAGATATAACACCTTTGCTGTCAAGC TTTTCACAAATATTTTGTTATAGAGATGTATAAAAAAATAGATTTGGAAC CGGTATTGATCTTTCCTTGTGGGATAAACATTGTGAAAATTGTTATTGAA TGCTTGCATTGGATTATGATTTGTTACTTCCTGTTACATGTATATATTCA AAATGCAATTTTTAGAAAATACCTTTAATTGCCATTATTGAATATACGGC CAATCATGCGTACAATTTCCATTAACTTGTTACAGATTTTTTGGTACAAT GTTGTTTTTTCATAATTCATCTCTATAGCTTTCTTTGTAGCCTCCTCTAT ATCTTTCTTTGTAAGCTTCTCTTTCTGAGCCTCTGGACCTTTATCAGCAT CATTAGGACTCTTCTTTATGATCGTTTGCCACATTTTCTCACCTTCTTGG AACAGTTCATCACTGTATGGTCTCCCTTGGCGTTCACTTATGCCCTGGAT TAAGTCAACCAGTTTGGCCACCTGGGCCTTAAGGATGGTCACATCTTTAG TGACATTATTGAAAAACACATATCGTCTACCACACTTTTCCAGAGCTTCT TTCATATGACCCTTAAAACTGTTCACATATCCCTCTTCAGTACTTTTGTT TAATTGATCTCTGTGCGTGAACAGGATAACTGTGTAGTCAAGGAACTTGT CTCCAAACATGTACTGAAAGATTTTTACTGATTCAGCCTCTTCCGGTGTG AAACGTCCACATCTGATCACAAGGATCACTGCATGGAGACCATTGTGGAA GATGGTTACCATGCGGCATAGTTCTTGAGTGATACCAGTCTTGTCACCAG TGTCAAATACCCCTGGTGTATCAAGTACTGTTATTTCACGGTCTCCTTTG TCTCTGGTGTGGTATTCACATTCAGCTGTTTGAGATATTGCTTTGTCTGA GATTTCGAAATTATACTTGCCGGTGATGACGTTCCCTGTGTGACTCTTTC CTGCACCAGTCTTACCAACAAGTGAGATGCGAAGCTCATCGCCTGATGGA ACTTGACAATTTGGAGAAAGGTGTGAAGCCCTGTATTTTGTAGATTTAGT TGAAAGTTCATGCACCATGTGAAGGACTTCTTGGACACCACCTGGCTTAG AGTCACTTGTGGGACTGTTGTTGATAGCAACGACCCTGTTGTTTGCCCTC TTAGCAATTTCCTTAATGTTGACAGACAGATCCTTCAGAAACTCTGGGAT GTCCTCCTGCTGAGCATGTGTGACCAGGATGACAAGATGCTCGTACAGTC CATCACCAAACAGCCTGTGGAGGGACTGGAACACTTGGACCTCCTTGTCT ACATTCCTCTCAGAACAGTTGTAGTCCCAGACCAGACAGATGGCATCAAA ACCCTCAGGAACCATCTTCACAGCTCGATCCAGCTCCTCAAACTCAGACT CTGTCATCTCCTGGGAGACTCCGGGGGTGTCGACTGTCATCATTGACCTA CTGGCACCATCAAGCTTTACTAAGCTACTGCCTACCTGTGATTTCTGTGT TCCTCCTTTACGAGTGACACTGAACATCTCCTTATTTAGTATGGTGTTGC CTGTGTGACTCTTACCATTGCCCTTACAGCCTACAAGCAAGATATTCATT GACATATCCTGCAGTACAGCCACCTCCTTCTGATTCTGTACTTTCAAGTT GTTGGGATACTTTGTTGAATGATGCTTGCCCGATGATGAGTCTAAGGAAG AAGAGATGATGAAATACTTCAAAAAACATGTAAAAAGGATACCTAGATTC TGGAGTATCCAGTAACTGCAATGGTCTGGAGATTTCAAATTTTGATTCAT AATGAGCAGCTCTAATGAGGTAATTGAGAATACATGTCCATAGTACCAGA CTGTTCTTTGCATCTCTGGCAGTGTTTTAGTTATTTTTCTATGTAATAGA TCTAGGCTGCTGTGGATTGTTTTAGGGATATCTATTTATGATTTTCTTTT CCCATCTACCGGTACACATAGTAACATATTGTATCATCATGTAAAAAGAA TTTTCACAAAGAAGACACAAGCAGACCACGATGAAGTGATTATGTGTAAA CGACCATGTGAACAGACCCACATGGGCAACCCAGAAAGAGATGGATAGCC ATCTAGGAAGATGGTAACTAGGAAGATGGC

Coding sequence (CDS) from alignment at Sc0000026:307874..327953-

>Blg00181.4 ID=Blg00181.4|Name=|organism=Branchiostoma lanceolatum|type=CDS|length=2217bp|location=Sequence derived from alignment at Sc0000026:307874..327953- (Branchiostoma lanceolatum)
ATGGAGACCCAGGTGCCACTCCCGGGAGCCCCGATGGCGGCCCAGGGCCA
GCCCCCGCCACAACCTCCCCTGCCGTCCGGTAAGCAGCTGACGTTACGGT
TTCCTGAGCAGAGCCAGTCGCTGGTGCGCAGCATGCGGGACTTCCAGCAG
CACGGGCACTTCTGCGACGTCACCTTCCGTGTGCAGGACGAACTCTTCAG
ATGCCACAAGGTGGTGCTTGCAGCGCGGAGCTCCCTGTTCCAGAGCATCC
TTTCGGACGCCAACCTGCAGCCCAGCGAGGCGATCCAGCTGGACCTGATC
GGAGCCAACATCTTCTCGGCGCTCCTCAGCTACATGTACACCACGGAGAT
CGTCTTCGTGGACAACGATCGCGATGCCCGTGACCTCCTGTCCGCCGCCA
GCCTGCTCCAGCTGCACCCAGTAGTGGAAAAGCTGACACAGTTTCTACAG
GACAAGAATGCAGCGTTGGAGGCAGAGAACAGGGCGCTACTGGCAGGGGA
CGTCGGGCAGGTACGTCCGGAGATGGTGGATCAGGGGAGCAACACCGACG
CGAACAGCGCATTCCCGGCACTCCCCACACAAGGTGACGACGTACATTCG
CGGATGTTCAGCGAGATCCTGAGCGGTGGCACCACCAGCAAAGCTGCAGA
CTCGAGCAAAGAACTGGGGGGAGCCGACCTCAACCAACCCTCCACAAGTG
CACAGTCTACAGCAGACATCCCTCAAGACAAGCCGGAGGATCTGGAAGAC
GATGGGGAAGAGTCTGACTTGGACGCCGGCGCGATAGAAGACGTCTCAGA
ATGGGAGCCAGACAGCCCGGTGGCCCCGCCCACGAAACGCAGGAGGGGGA
GACCGCGGAAGGGAGAATCCAGAGGTAACGCCCGGCCGAGGAAACGTAAG
AGGAAGGAGAAGGGCATCCCCGACTGGAACCTGTCCAAGGAGCAGCAGCA
GTGGGTGAACCAGACGCTGGAGAGGGTGGAGAAGAGACAGAGGAACTGTC
CCGAGTGCGAGAAGGTCTTCAAGATGCCGCTCGACATGAGGAAGCACTTG
ATACAGATCCACTCGCCGGAGCCTCTCTTCTGCTGCCGGTACTGTCACAT
GTCCTTCCGCACGTGGATGGGGATGTCTCGCCACGAGAAGGGGCACGAGA
AGGAACAGGAGGGCATAGGTGAAGCAGGTGTGATCGAGGGAACTCCAGAG
ACGCCCCAGGCGGAGAGAACAAAGCACCAGTTTACAGACGAGCAGAAACA
GTGGATCAGGGACACCCTAGAGGATGTCGGGAAGCGACAGAAGAACTGTC
CGGCGTGTGACAAGGTGTTCGACACACCTGCCGCCATGAGGAAACACCTG
CTACATGTCCACTCAAAGGAGCCCCTGTTCTCCTGTAACATCTGCTCAGC
AAAGCTGCGAACGAGCAGTGGACTGCGGCGCCACTCACAGACACACATCC
AGAACAAGCAGCACGTGTGTCCCATGTGTGGCAAAACCTTCAGTCGGAGG
GACCATCTAGTCAAGCATGTCAGGGTCCATACAGGAGAGAAGCCGTTTAA
GTGCCCCGACTGTGAGCGGCGGTTCCGTACTAAGTGGGAGGTCATCCAGC
ACAAACGCTACCAGATCTGCAACACTCAAGGTCCGTTCATCTGTAAGACC
TGTGGGCTGGAGTGCCGGGGCGCGCCTTCCCTCCGACTGCACGAGGCTGA
ACACAACGATGAGAAGCAGTTCCAGTGTGAGGTTTGTGGGAAAGGCTTCG
CCCTTGAGGACAACCTGAAGCGCCACCTGACGGAACACGCCGACATCCCG
TCCGTCCGGGACACGCTGTCGTTCAAGTGCTCGCTCTGCCGCTTCGTCAC
GACGTCCAAACAGAACCTGAAGCACCACGAGCTCAGGCACAAGGGAGAAC
GGGCCTTCCTGTGTGACTTCTGTGGACAGAGCTTCCTCACAGGGACCAAG
CTGAAGCGGCACAAGTACATCCACAAGTCAGAGATGGAGCGGCCGCATCA
CTGCCAGCTGTGCGGGAAGGGCTTCATCCAGAAGAACCATCTCAAGAGCC
ACATGCAGAAACGCCATCCGGAGTACGGCGGGCGCGGCCCCGTCCCGTTC
ACGGGCCAGGTGGCCGCCCCCCACCCCCAGCCGACCCACTGCACGCTGTC
GGCTACGCTCACCGATGTCCTGACTGTTGATCTACAGCAGCTGGTTAGCA
GCACTCACCACCAGTAG
Gene-mRNA-Prot