Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

Blg00160.3 (mRNA) - B. lanceolatum

Overview
NameBlg00160.3
Unique NameBlg00160.3
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000026:1280565..1294185+

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Blg00160.3 ID=Blg00160.3|Name=Blg00160.3|organism=Branchiostoma lanceolatum|type=mRNA|length=13621bp|location=Sequence derived from alignment at Sc0000026:1280565..1294185+ (Branchiostoma lanceolatum)
TCGTTCCTTGCGCCCGCACACAAAATGGCGGACATAACTTGCCAGTCTGG TGAAGTCTGTTTTCTTCTTCGAATTTAGCACCCCAAAAACCTCTGTCTGC CTCTAAATCTTAGACAAGTGGCTGTCCTAGCGTCTCAGGATGGGAAACAG CAGCAGTACGTCTCCAGAAAGAGGTAAATGTTGGTTATTCTGAGGAGAAA ACTTGTGTCAGGAAACCGCCATGTTCATTCCTGTCCTATGTTTTCACATC CGCATGACGTAACTGTCTAGTGATTTTTTCTTTCCATGACTTTTGTCCAT TTATGTCAGAACAAAAACCTACATAATTCTGTTATTCTGTCAGACCGTGT GTTGTAGGCTTTAGGTACATAATACGTCTGTTATATCTTTCAGTGAATAG AAAAACACATGGAAATTTTACTCAGGCTAAGATTTCACAAAAGATTATTT CACTGTTTGGATGAAAACTGGTCATCATTTGTATAATTTCGTGGGTCGTC TTGTCATCTGTATGTGTTTGAAAATCAAGGAAGAAGCTTGAGTTCTGCTT TGATTGTATTTAATACTTCTAAAAGTCTAGCTGACATGACATTTTTTACT CCTATTGAATATTGTACCTTGCACATGTGAAAGTTCAAAGGTTAAATCAG TTTCATATTGACTAGAAATCTCATTTGAATACTGTAAATGGCTATAGCGT AGCATGGAATTAATCTCGCAGTAGGATGGGGAAGGATTGTTTGTGGTGTT TGAAGGTCGCGTTGGAAACAATTTACAGTAGTAAATAAAACTGCGAGTAT AAAACCTTTGTGAACATTTTATGATTTATGGTAGACTGCATGTAAACAAG AGATGAGCCACCCTTTTTAGTTAGGTAATTATAAATGATGCACCATAAGA AAAAATCAAAAATAAGAGAATTCATGACACATCATTCTTGAAAGTGAAAG TGATCTTGACCCAGCTTAGCTCACTGAAGAGCTTATCTTCCTCGGGTCGT GACAGAGAAGACAAACACTATGTACACTATTTACAGGTTCATTGTATAGA GAAAAATTCCCCTAGCTCTTTTCAACAAGCACAGTGAACAATGAACAGTG GACCACAGCTTTACCTACCTACCTAAGGATTGTGACCCTTTTCAGTAGCA TGCATGTTGCTTGGGTGAGCGACAACAGATGGAATTCAAACTGCATATTG GTCCTAAGGCTGGGTTGCTAACCACTGGGACCATGATGTTATGGTTAATC TCCAAACAGATGTTGAGACGTGAGATTGTAACTTTTTCAGACTGCATGCA TGTGTCAGAGAAGTAGAGCAATCGGAAAACATTAAGATCTTTCAACCGGA CATCTGCTTGAGAATAAGGTTGAGGCAATGTTAAGCATTTGTGTATGCAC TAGCAGATAAACAAAGAAATCAGTGAATTATCAAATGTAGATTTGATCAA ATTGATGATCCATTCATAGAATGTACAGTCATGAGCTTGCAAGTCAAAAT GGAAAGCTTAGAAGCTAGAAAGAAAGTACATTCAGTTACGTTTGCAGCAT AGAAACATGGCAGCATGGTGAAAATGAAGTAGTGTGTTTAAGTTCAATAA AACAATACATGCAGGTCCAAACTGAGTCCAAAGGGATTTAGTACATGAGC TATATTACTGCATGGACATACAGAAATTTACCAACAGTCAACATCCAATC CCAGGACAAAAAAAAAACAGTCACAGTACATCCATAAGTACTTAGGCCAC ACCAACTTGATTTTATGGATGACATCCTCTGGAGACCCCAAAAATAATGC GGGCGGGCGAAAAAAAGAAAAATCCAGCAAAAAAAAAAATGCTGCTAAAC CACAGGACTACTAGAACACAGTTTATTTGTAGGAGGCACATGTAGGTTGT CTTGTTCATCATAGCAGACTCAGCGCAAGTGATTAATTTTTAATATATTG ACAAGAACGACCAAAGAATAGTATACTATTAGAAGGTATTTGGCTCCAAG GACTGTGGATGATATATGACTGTGATGAGACACTCATATCATATACACCC ATAAGGGCAGTTTCAACATACATGGCATTGAACTCCATATTAAGCATTCC ATGGTTTACGCTCACAAATCCCTCTGCCAATCCCTCAATTCCTCTCCCAT GTCTCTCATTGTTGCAAAAGAAACGTGTGAGAGCCACTCTGGATAGGTCG TGTTTGAAATTGTCTTGGCGATACTCGCTGGCCTCCGCGATCCTCTTGTA CAACTGTGCAAATGCAAAGTCCCCCTAGCCAACATCGATGGCATACTAAT CCACAAATACGCCCCAGTTTTCCGATAAGCCGGTACAGTGCTAGCCTTTT GCGGCAATCTAAGTCGGCAAGTTCCGGAGTTCCGTGTAGCCTTGGAGGAG GTGATTTTTTTTTTTTTGAGAACAGGCGAAAATCAATGCGCGCGCGGATG TCATCCATAAGATTAAGTTGGTGTGGCCTTACCTGAAACCAAAATGAATA GAGTAGAAATTTAAAGTTTGCAAGCAAATAGTACATGTACATAATGTTAA CCATCATGATTTGGTCTACCCTAGCAAACTACTGCTCACTGATTCGAATT CTTACTCAAACATGCTCATACGTGCATATATGGTGACCAGCCCCTGTAGA TCTGTCCTGCCACTTGCTACCAAATCTAATCAACACTAATTTTAATATGA ACAGGGTGTCTGCTACTTTACCTGTAACCATGGTGACAGTCATGCGGTCC AGGTCATGGAAATTGATTGTTTAGAAAGAAGTTAGAGGAAGAAATGAAAG AACAATGTTTCACTTCTGTGAAGTTAATCATAATAATCAAATCCCCTTTA ATCAAATTGCCCTCTTTGGGTCAAAGGTCGCACATAAAAACCTGTTAAAA TCTAGAGGAAGTACTCCAAGCGTCTGTTATTACAAGGCTTGTAAAGATAA GATTGTTCTAAATTGAAACACTTAAAGATTGTCAGTTTCAGTTTCCTGTA CTGGCAATACAATACAAATGCTCTCTTGTAATAGATTCTCTGTATAGATT GCTAAAGACTTTGTTAGAATTAATATGTATGAACTATGATAATGTTTTAA GTATTCAGTTTGTATCTGGATTCCAGCTTATTTGAAAGTGGAGCCTGTGA CTTAGTGTGATGTCAGTGGTGATAATAACAAGGGTAGACTGTTGCATAGT TCCAATTACGTCATAAAGATAAGAACACCTTAATTTGTGAGGAGACAGCG TCAGTTGGTTGGTGACATGTTATTACCATTCGGGAGTGCTGCAGTGTAGA AAATGGTGTTTGTTTTTCATGTACAACAAGCTTGGCCAGGTAAGCAACTT ATAAATTTTGTTGTAATGATCAGGTCTAAGATACATATATACAGTTACTA TAACTTTCTTCAAGCGTATCCATAAATTGTTGTTCTGGGTAGACTCCTAA CAATAGCAACATACCGTACTTAATTTTACAGTTGTAAAACTGTTGACCTA AATACTGTAACAACTATCTACAGAACTTTGTTAACCTTTTTGTATTTACT GTCACGAATACAACAGTTACTCAAATACTGTCTCTTAAACAAGGCACAAA TACCGTCTAGTACTAGTAGTATACAGTCATGTGGCTCCATATCCATTGTT TTATGAGAACATTGCACTGCGGAAAAAAATCAATTGGCTATGACCTACAT ATGTAGAATGTACATTGTATATGTAGAGAAGGGCTGTCTCTAGCTTGACA TTTTTTTTCTCTCCCACTCATGCAATTGGGAGCTCAGCAATGTCACATTG ATTTTTGTAGAAGTCAGCCACTTCCAAATATTTTTCATTTCATTGACACA TCATTGTGCTGTTTATTTTTGACTGATGACTTGTAAGGATCAGATTGTGG CCTTTTAAGCCCGGATATTCTAGCCTGGGTGCCATTGGATGATTCTATTT ATACCGGGGCTGATGATCCCATAGAAAGTAAATACTGGAGCTCCCATACT CTCGCTCCCTCGGAAAATTTTTTTTGAGGGAGCGATTATGGGAGCCCCGT TAAATTAGATAGGATCGCACCCAGGTTATGTAAAGTCTGCTGCTATTACA CACAAAAAAAACATTAAAATATGTTAGCAGATCTTCAGACAATTATGTTA CGTTGTTTTTCACATATAAATTAATTTGCATACAAATGTACATGATTACT CAAGCAACTTGATAAAATTTTCAAAATTTTATCCAGTTGCTTTAGTAGTT ATTTCTGGCGTATCTTACTACCTGGATGTCTAACTTTCATCAACATACTG AAGTCCTATTTGGGTTGATATACCATAAATCTTGAAATGTTTTCAGTGGT TTTATTTTCATGGCAAATATGAATACAAGTACAAATAAGCGGTGATTTCT CCACCTTGAAATCACAACACCACGATGAAATTGTGACTGTACTGCAGAAT TTTAACCGTTTTAACCTGGAACTAAGAACCCTGTGGAATCCTCCTTTTCC CCTCCTGTTGCGAAGACCCTGCAAGAAGAAACGAAAATAACCTTCATTTC TATTCTTGTTCCAGAATCAGATAGGAACGACACGCCGGTCCTGGAGAACG TGTACGACTCCCACCGCAGGAACGTGTGGCGCTTCCACCCGACGTGCCAC GGCAACAACATCTCCGTCTCCTCCGACCGCCAGACGGCGCGGCGGGCCGA GAGCTTCTGCAACGCCATCGTATTCAGCGACCGCCCCTTCCGCATCCAGG AGAAAATCCGGCTGAAATTCACGCAGACGACGGACGGATGGAGCGGGGTG ATCCGTTTTGGGTTCACCACGCAGGACCCGAACACCNGGGTGATCCGTTT CGGGTTCACCACGCAGGACCCGAACACCATCCAGGCGACGTCGCTGCCGA GGTACGCGTGTCCCGATCTCACGAACTTGCCGGGATACTGGGCCAAAGCC CTGCCGGAGAGATATGCGGAAAGGAACAACATCTTGTGCTACTATGTGAG GAGAGATGGGAGTGTTTGCTACTCAGTGAATAACGAGGATAAGGGATTGT TTTTCGCGGGAGTGGACACGTCATCACCGCTGTGGGGACTGGTGGACGTC TATGGGAACAGCACAGAGATTAAGATCATCGGTAAGACTTTGTACGATTT ACAGGTTCCTAATTCGCAATTTGGTAAAAGATTTACAACATACATGCAAA ATTCCATGATGTATTTTAACTGTATTCAACATGTGCACACTTTAGTTTTG TTTGTTATTGATTTATGTTTGTTAGGTCTGGTGAATATGTAGATTTTGTT AAGTCAGATAAAGATATACATGTAACGTTACATGTACATTGTATCAGGAT ACACGCAGTTGGTGTCCACTTACATGTACAATGTAGGTCAATGGCGGAAA CAAATTCCTATGTCAAAGAGATGAAAGACTTGATCAGAAAAGCTGATATT AATAAAAATGTACATGATTTTGTATAGTAGCAGGCTTTTTTTATGGTCCC AAGTAAAAGAATAGTACTGTGTAAAAAACCACATCGATATATCTTAATTG TTTGATAGTTGATACCTACACCCAGCCATAACAAGATCCTTGGAAAAAAT TTCCACAGATTCTCAGGTAGAGCTGTGTACCTAAAAAAATTTTAGGTACA GGTACAGGTACCGGTACACGGGTTCAGGTACAGGTCCGGACCTAAACCTG TACCTGAACTACTAGTTTAAATTATGGTCGATCTTAAACAATGAAAGAAG CATGTTTGAACGGCACAAGTGCTAAGACAAGTTTGTAGTGCCTCCACTAC GTTTAACCACGGCATTGCAATGTTTACATTTTTCTGTGTTTCCGACAGTT TCCCCCATGCTCTTTGTCATATGTTCCGAAACTTTGGAACGCGGCATGTC AAATTACCAGTCTGATCAGGCTAGCATGAAAACAAAACTGACAGGTAATG AATACAGTAGAGTGCAGCTACCCTACTAATAGACCAATCAAACCACAGAA AAATGATTGCATCAGGCCGGTAACTGTTTTCAACCAATCATATCGCTAAG TGACTGGCGGCAACTTGTTACAGTTATGGGCCGCGGCATGATAGTAGGCG GTATCAGTTTCACTTTCAGTTCTGACAAAGTCACCAACCCCCAACATCAA AAGAAACCTCACTTATAGCACAAGTGTTAAACAAGTAAATTGTCTGATAA TACAGAAGGGAAAAAATATACATTGTGGGAGATGTAGTGCATAATTTTCT TAGTATGGGTGAGAAATCCCAAGCCCTTTGTGCTTCAATGTTGCCTTTTG TGAAACAAAAGCACTGATTAGTTTCTCAGAGTCAGCCACAGAACCCCGCG CCGGTGTGTCTGGGGAGGCGTGGCCACCGTCTCAGAGCATGGGCCACGTG TGTTTATTTTGGGTGTTGCCAGGGAGAACTGGGCTTGCTGGAGTCTGGGG AGGTCTGGGAGGCGTGGTCAACGATTTAGCTCACGTGCCACATGTGACTG TTGCCACTGGGAGTTGGGTATACTGTTTGCAGGGGGAGCAGTGTGTTTTT GCACACTGCTTTAAAACTTTTTGTGACAATTACAATGTCTAGATTATGAC TCACTGTTGTCTATGCATGTCTACAAAGTAATCTACTATATTGAAGTGCA TTGTGCACTTATACAATTCTGATATTGGAACATTATTTACAGTACAAAGA GATGTTTACCCTACTAAGTAACTTGAACTGTTCCGGGAATTCTGGAGAAA CACAATCTGGCTGGAACGTGATGAATGGGCATGAATGGGCACTTGTTGGG AAGCAAGTGTTGCTTTGTGAATGGAATTATACCCCACTCCCTGTTTTAAA TGTTACTATTCTTGAGGTAGGCACTAGCAATGTTGTGGTCTGTTCCAAGA AGTATATATGCATGTATAAACAGTGTAACAGTGTAAGTATATGTTTGATT TTGGCCAGTATCGGTACAGTACCGATATTACAACTTCCGGTATTTTTGGA CCTGTACCTGATTGATAATACCGATACTGTATCGGTACTGTGTACCGGTA CACAGCTCTATTCTCAGGACTTCTGGGTCATTCAGTATTCAATAGAATCT GATGTAAAAATGCCTTACTGCACAATGTATTTCAATTTTAGAGTAACCCT ACGTATGTATTCATCCAAATAATATTTGATTAAACATTAGATGTGATATT TACTCTATTAGATGGAGACCAAGAGGAGGACCCTAATGATGCTGGTGCCA TGGCGCTGGACCCCTCTGATATCGCTCTGGGTCGTCTCGGCCTCCTCGAC ACCAACAACCCTCTAGAAAACTTGACCTTGGAGTCGGAAGGCACCACGGA CGAAGTTGACGACAACTACCCGAACCTCCATCGCCTCCCCGACATTCTAT CCGACGTCTGGGGCATCTCGCGTGACTTGCTACAGGAAATGCAATTCTCC ACCACGAGCGGGGCCAACGTAATCTTTCGGGAAAACAGAACGGTCGCCAA AAGGCGCGGGAACGAGTTCTGCAAGGGGGTGACTTTCACGAGCCGGCCTC TGGAAGTAGACGAGACAATATTTGTCCAAGTTATCGAGGTCACGCCGAGG TATCTCGGCGGTCTCGCGTTCGGCGTGACGAGTTGCGATCCACAGCTTCT GAACACTTTTATCGACTTGCCCGACGACTCGGAAAGTCTCATGGACCGCC CGGAATACTGGGTAATCTACAAAGACTTGTCAGTACCGGAGGAGGGAGAC CAGTTAACGTTCACGATAAACAGCGAGGGAGAGCTGCGACACCACGTGAA CGGCGTAGACAAAGGCGTTTTGATCCACGTGGACGTTTCTCAACGACTGT GGCTAGTTTTCGACGTCTATGGAAGTACACAAGCAATTAGAATATTAGGT GAGTATGATCATGGCCATGACTTGAAGTGTGACATAAAGATTTTGATACA TACATTTTGATACATACACAAGAACATTGTAGAATTTCATACATGACTTT GTATCTACTATTTTCTTTCTTTTCAAGGAACATTGTCCGGACGGGAAGGG AACCCATGGTCGTCCGGCTTGAGCTCTGGTCAGAGCAGTGAAATATCCAG ATCAGACCCGTTCTTCCCCCCTCTTCCAATACCATCTACTACAGAAGTAA GTACTGTACTGCATGTACTAGAACTATCTCTGGGCTCTACATAGCCAACT GTTTGTAAAATTCTATTATGTATATGTAAGTTCTTCAGTGGTTGTGTTCA CAAACGTGATTGACTGCTGCATTTCCAAACTATTTTGGCAATACAGTTGG ATTAAAATGATCAAATAAAGTCTCAAAGATGAGTTTAGCTGGATGTATCC TCTTACAAGTTACATGTATGGTACATGTAAGTAAGTTCCACCATTGCACT ATGTATTTCGATTAACAATTGAAAAGGCTCGTAAATACATTTGTATATTG TACTTAAGTAGGGCAGTCAGAGATGGCCAACTTTACCCCCTCAGAAGCGT ACATGTATGTAAGTGCCCTCTGGCAGAGCATACAGAAACTGCATTACAGA GAATCTCTCTCACACACACAGACAGACAGACACACACATGTATGCACACA GACAGACGCACACACTCACACATTTACACATGCAAAGATACATTTTGTAC ATGCATACACACACAGATACTCTCACACACACACACACACACTCACGCAA CCTTTTGGTGAAGAATATATTTATAACTGTTACAGTGTTGCAATTGTGTG ATGTTTTTTCTTCTGTCCAATAGCTGGAGGACATTACGGACAGTTCCAGT GCCAGCGTCCCAACAACACACAACCTCCCCCCTCCCCCCACGGTGGGGAC CCGGACCACGGGCAGGAGCGACTGTACCATCTGCTACGACCGCCCCACGG ACAGCGCCGTCTACCCCTGCGGACACATGTGTCTGTGCCATAAATGCGGA CTGCTTCTAAAGCGCCAGCGGGGTGGCATGTGTCCGATCTGTCGTGGCGC CATCAGAGACATCATCAAGATATTCAAGGCCTGAATTTTTTTTCCTTGCC GTATTCTTGTCATTGAACACTTTCTCTGTACAGGTTTCTTCTCAACATGT CAAAGTTCCCACTAAAAAGAGGTTCTTGCCCCATTCAAATTCGATTCCTT AGATTTCAAGCCTTTGAATTTTCACCTAAAAGCATAGCACATGGACATGG CCTAAGAAAGATACTGTAAATGTGCTTTAAGTTTGCTCAAAGCTTCGAAC ACCATTAGTAGATTTAAGTTGAAATGCTTTAGGAGAACAGAAAAATAGGT AGAAATGATCTAAAAGATCTCAGGTCATAGAACTTCTCAGTGCTGGTGGT TGTCATATTAACAAAAAGAAAAATATAATTATCAAAAAAGGTCCAGGTAT ATAACTGTAAACAGGTAGACTGTGTTTTGGGTCGTCATGTTGTATTCATT GTGTGGAAATGATTACCATAATCAGTTNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTGGCAGA GCATACAGAAACTGCATTACAGAGAATCTCTCTCACACACACAGACAGAC AGACACACACATGTATGCACACAGACAGACGCACACACTCACACATTTAC ACATGCAAAGATACATTTTGTACATGCATACACACACAGATACTCTCACA CACACACACACACACTCACGCAACCTTTTGGTGAAGAATATATTTATAAC TGTTACAGTGTTGCAATTGTGTGATGTTTTTTCTTCTGTCCAATAGCTGG AGGACATTACGGACAGTTCCAGTGCCAGCGTCCCAACAACACACAACCTC CCCCCTCCCCCCACGGTGGGGACCCGGACCACGGGCAGGAGCGACTGTAC CATCTGCTACGACCGCCCCACGGACAGCGCCGTCTACCCCTGCGGACACA TGTGTCTGTGCCATAAATGCGGACTGCTTCTAAAGCGCCAGCGGGGTGGC ATGTGTCCGATCTGTCGTGGCGCCATCAGAGACATCATCAAGATATTCAA GGCCTGAATTTTTTTTCCTTGCCGTATTCTTGTCATTGAACACTTTCTCT GTACAGGTTTCTTCTCAACATGTCAAAGTTCCCACTAAAAAGAGGTTCTT GCCCCATTCAAATTCGATTCCTTAGATTTCAAGCCTTTGAATTTTCACCT AAAAGCATAGCACATGGACATGGCCTAAGAAAGATACTGTAAATGTGCTT TAAGTTTGCTCAAAGCTTCGAACACCAGTAGTAGATTTAAGTTGAAATGC TTTAGGAGAACAGAAAAATAGGTAGAAATGATCTAAAAGATCTCAGGTCA TAGAACTTCTCAGTGCTGGTGGTTGTCATATTAACAAAAAGAAAAATATA ATTATCAAAAAAGGTCCAGGTATATAACTGTAAACAGGTAGACTGTGTTT TGGGTCGTCATGTTGTATTCATTGTGTGGAAATGATTACCATAATCAGTT CGTTTATCTTATCTTTGTTGAGTCTAATTTCATTAAATTTTGGTGGAAAT ACAATGTACATTACATCAACTTACAATAAAAAATGTTACATTTTGTATAT GAAGGGCTGAATTGCCAAATTTAAACTACGTTTAACTTTAAACGAACAAT ATAAAAGGTATATCAGTTCTGCCCTATCTATTTAACAATGCAGAGTTTGG AAAATCCTTTCATCAAAACTCAAACAATCACTTATAATACCAGTAATGAT CATGGATAGATTTGAGATCTGTCTATTAATGATGATTAATCTACAAGAAA TTTTATGAAATATAAGTTTGTTGTAATTTTGAAATTGTTCGCACTTAGAA TAGGTTCATTTTACAATGTATCTGTTGTTTCTATTGTAAATCAAAATTGG TTCACGTTGCATTTGTGACTCATATTTTTGCTATGTGAATTGTTTGTTAA ATATAAGAATTTTTTTGTCATTGAATGAATATTGCTTTTTGTGGATGTAT CCATGTGTTTAGGCCATGCTAATGATTTATTTCATTGCTTTTCTGAAATA TTCTTTAGTATCAAATTAGTAAAAGGTCAACATAAAACAGAAGGGCTTTG AGGAAAACTTGAAGCTGACTAAATTGACTTACTAAATCTAAAACTGTGTA CCAAGATACAGAACCAACATATTGAATTGGCTTGGCCAAACTGAACAACA AAGCCTGTTACACTGTAAATTTTTTTTTGCAAATCAATGTTCCCCAGAAA TATAGTAACTGTTTCATTGTGTGCTGTATGATGGTGTACAAATTCGTAAA AAACGCTCAGCACAAAAAGTCCTAAAACTTAGATTTGATCAATCATATCT CCGTTGTTATTTTTATTATTGTTTAGTATTATGTATCATTAGAAAGCTAA TTATTACCCTTCATTTTTCATGATCCTACATTAAAAATCGAACACCAGAG TTTACCATGTGAGTGTGCCACAAGACAAAATAGCGCCAAAATTCCCCTTC CAACATAGTGTCTGACCTTTCCAAGAGAATTGCGGCGATTTTCAAGGCAT ACATGTACCTCCAACATATTCATGGTGCTCACTGCAGAAAGCATGATCAT AACAAATATTGTTTGAAGGGAAAATATACAAGCTTTCTGATCATATACAC AAAATACAAATGGACATATCTGATCAAGGGAAATTTCAACACTTCTTTTT TGTGTCCTACGTAGCTATATGATTGATAAAATTTAAGTTTTTAAACATTT TGCATTGAGTGCACATTGGTGAAACTGAGGTATGACTATATATTTACCAA GAGAAAAACTCTACTATTGTGGAATACAAACATATTCACGCCAGTTGAAC AAACCCTACCATTGATATTTCAAGAGGCTGAAATTTGAGGAAGAACAACT GTATGTGCTGTCTAGCGATAGATCACTTAGAAGTCAGTTTATTTTATGTT CATGCAATATGCTATAATGTGCCATCTTGATCTTTAACATCAGCCAAGTA AAAATGTTAAAAGGTAAGGCTTTGTAGAATGTACCCATGCATTTGGGAAC TTTATGTTATTCTGGGAAATGGTTATCCAAAACATTTGTTGCAAAAGAGC ATTCTTGTTTTCATTCAATGCTTGATGCCCATATACACCAATCCCATAGC CCTGCCCACCTCCATCAAAACATGAAAATGCAAATATTTTGATGGACAGG CAGCCACTCTCTCATTGGTCCAACCACTAATTGCCATGCTACCATTGGTT GAACTGCTAATTGTAAATGACAGTCTATTGGATAGTGCATTGAACTTTGC ATTACTTGATGTTCTGTAATAGATTATAAAGTTTTATCCACAGTGTAAGG GCTATTGTAATTAAAAAGAAGGAATTGCATTTTGAAATGAAAAGTTGAGA GCCTATATGCCATGCATTTCATACGTTACAGAAAGATTAAATTCAAAATG AATACAACATTTTTTCCTTCCCCCTCCCCCAACTTGTGAATCAAGCAACT CTATAATATACTAGCCATTTCTCCATTATGTTACATTGAAAATGAAACAC TGAATGTTAAAGCCACCAGCTTTAATCATTTTAAGTAGTACTATAATTGT AGTCTTTACATTGTTGTATGTATGCTCACAGCGCTCTACTACTATTGAAA CACTTCAAGTTTTTGATATGAACTTTGTACAAAATGCTGTGTTTCCACTT ACAGGGGAACAACTATCTTGCATATCAGTGAATTGAGGCCTTTCTGTATT AATACCACTGTACAGTGAAGTAATACGTATGCCATATTTCTGTTTATACC TGTGCTTGAATGACACATAAAAAGGACAGTGGGCTATGCTGTATTATAAT ACATGTAGTAAAGCTTATTATATGTGGTGACAAATACTGTATTTTGTTGT AAGACCTGTAAAGCATTGTGAATTTAGCAGATACATGTATAGAGCTTAAA TTTCTGGTAATAAATGGTAAGTAATATTTGGTACTTTAAGTGAAGCTGAT TTGTAAATTTGTTTTTCTTTGATTGTAAAAATGCTATCTTATGTCATTGG TACAAGTGAAGAACACCTGGGTTACTGGTCCTCTGGCTAGCTATATTATA TTATATGGGCAATTTGCCAAATGTGTTGTAATAAACTGCAATAAAATCTA TCTTTCCAATTTTAGGCTGTCATTGTTTAATTACTTTTTTTAATCGTATT AAAGTTGGCATTCATAAGTGTTAGAATGTTTATAAAAAACCCTTGGTCAC TAAATTCTAGGATGTTTCAAGTTTTCTTTGGGGGTGGGGCATTGGATTCA TGTTTAATGAAGAAAATGTAG

Coding sequence (CDS) from alignment at Sc0000026:1280565..1294185+

>Blg00160.3 ID=Blg00160.3|Name=Blg00160.3|organism=Branchiostoma lanceolatum|type=CDS|length=1668bp|location=Sequence derived from alignment at Sc0000026:1280565..1294185+ (Branchiostoma lanceolatum)
ATGGGAAACAGCAGCAGTACGTCTCCAGAAAGAGAATCAGATAGGAACGA
CACGCCGGTCCTGGAGAACGTGTACGACTCCCACCGCAGGAACGTGTGGC
GCTTCCACCCGACGTGCCACGGCAACAACATCTCCGTCTCCTCCGACCGC
CAGACGGCGCGGCGGGCCGAGAGCTTCTGCAACGCCATCGTATTCAGCGA
CCGCCCCTTCCGCATCCAGGAGAAAATCCGGCTGAAATTCACGCAGACGA
CGGACGGATGGAGCGGGGTGATCCGTTTTGGGTTCACCACGCAGGACCCG
AACACCNGGGTGATCCGTTTCGGGTTCACCACGCAGGACCCGAACACCAT
CCAGGCGACGTCGCTGCCGAGGTACGCGTGTCCCGATCTCACGAACTTGC
CGGGATACTGGGCCAAAGCCCTGCCGGAGAGATATGCGGAAAGGAACAAC
ATCTTGTGCTACTATGTGAGGAGAGATGGGAGTGTTTGCTACTCAGTGAA
TAACGAGGATAAGGGATTGTTTTTCGCGGGAGTGGACACGTCATCACCGC
TGTGGGGACTGGTGGACGTCTATGGGAACAGCACAGAGATTAAGATCATC
GATGGAGACCAAGAGGAGGACCCTAATGATGCTGGTGCCATGGCGCTGGA
CCCCTCTGATATCGCTCTGGGTCGTCTCGGCCTCCTCGACACCAACAACC
CTCTAGAAAACTTGACCTTGGAGTCGGAAGGCACCACGGACGAAGTTGAC
GACAACTACCCGAACCTCCATCGCCTCCCCGACATTCTATCCGACGTCTG
GGGCATCTCGCGTGACTTGCTACAGGAAATGCAATTCTCCACCACGAGCG
GGGCCAACGTAATCTTTCGGGAAAACAGAACGGTCGCCAAAAGGCGCGGG
AACGAGTTCTGCAAGGGGGTGACTTTCACGAGCCGGCCTCTGGAAGTAGA
CGAGACAATATTTGTCCAAGTTATCGAGGTCACGCCGAGGTATCTCGGCG
GTCTCGCGTTCGGCGTGACGAGTTGCGATCCACAGCTTCTGAACACTTTT
ATCGACTTGCCCGACGACTCGGAAAGTCTCATGGACCGCCCGGAATACTG
GGTAATCTACAAAGACTTGTCAGTACCGGAGGAGGGAGACCAGTTAACGT
TCACGATAAACAGCGAGGGAGAGCTGCGACACCACGTGAACGGCGTAGAC
AAAGGCGTTTTGATCCACGTGGACGTTTCTCAACGACTGTGGCTAGTTTT
CGACGTCTATGGAAGTACACAAGCAATTAGAATATTAGGAACATTGTCCG
GACGGGAAGGGAACCCATGGTCGTCCGGCTTGAGCTCTGGTCAGAGCAGT
GAAATATCCAGATCAGACCCGTTCTTCCCCCCTCTTCCAATACCATCTAC
TACAGAACTGGAGGACATTACGGACAGTTCCAGTGCCAGCGTCCCAACAA
CACACAACCTCCCCCCTCCCCCCACGGTGGGGACCCGGACCACGGGCAGG
AGCGACTGTACCATCTGCTACGACCGCCCCACGGACAGCGCCGTCTACCC
CTGCGGACACATGTGTCTGTGCCATAAATGCGGACTGCTTCTAAAGCGCC
AGCGGGGTGGCATGTGTCCGATCTGTCGTGGCGCCATCAGAGACATCATC
AAGATATTCAAGGCCTGA
Gene-mRNA-Prot
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
Blg00160.3Blg00160.3-proteinBranchiostoma lanceolatumpolypeptide
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
Blg00160.3-exon-Sc0000026-1570713199:1280565..1280737Blg00160.3-exon-Sc0000026-1570713199:1280565..1280737Branchiostoma lanceolatumexon
Blg00160.3-exon-Sc0000026-1570713199:1285129..1285695Blg00160.3-exon-Sc0000026-1570713199:1285129..1285695Branchiostoma lanceolatumexon
Blg00160.3-exon-Sc0000026-1570713199:1287776..1288462Blg00160.3-exon-Sc0000026-1570713199:1287776..1288462Branchiostoma lanceolatumexon
Blg00160.3-exon-Sc0000026-1570713199:1288592..1288710Blg00160.3-exon-Sc0000026-1570713199:1288592..1288710Branchiostoma lanceolatumexon
Blg00160.3-exon-Sc0000026-1570713199:1290661..1294185Blg00160.3-exon-Sc0000026-1570713199:1290661..1294185Branchiostoma lanceolatumexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000026genomeSc0000026:1280565..1294185 +
Properties
Property NameValue
GeneIDBlg00160