Blg00020.0 (mRNA) - B. lanceolatum

Overview
Name
Unique NameBlg00020.0
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000280:328232..341219+

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Blg00020.0 ID=Blg00020.0|Name=Blg00020.0|organism=Branchiostoma lanceolatum|type=mRNA|length=12988bp|location=Sequence derived from alignment at Sc0000280:328232..341219+ (Branchiostoma lanceolatum)
ATGGAGGCGATAACCACTGGTGAGAAGCATTAAACCTTGCAATCTAAAGT AAATATTCTTCAGGTATATCATCATTAAAGTCAATCATAAGGTCCACCCG ATTCCTCACTATAGTCATGTTGTGACCATGTAGTAGACCAGACCTCCCTG AGGTGTTAACCAGTTGTAGGCAAAAACACTGGGTGGTAGAATGACTGAGC TTTCCCGGGCGAGGCAGTTCAGCTGACCTGCAAGCTCACAGACATACTTG TATGGATTATATAGAAAGGTCAATTTCTTTGTTCATCTTTGATGAAATGT TACAAAATGTGGTTGAATTTGTAGTCAAAACAACGTGGTATTTTAGAACA TACACAACGCGTTTGGAGTTGAGTACCGCTTTGAATACTTTTCCTTTTGG CTTTCAGTTCTGATGCAGACAGCTTCAACAGTTCTCGACATGGCACCCGA GCAGGAACCGCCGATTCCAACTCATGTCGACAACCCTTTCAAAAGTGACC TCGTCGACCTCTCGGCCACTGACCTTTCACCCAAACAGCAGCTGAAGAAG TTAAGAGACGAACAGAAGGAAAGAGAAGACACGGTGAGAACATTACCACC TGGCACACCCGGATGGCTTGGATACAGGGTCGAAGGCCCTAACCCTAATT TTGAAGATAATCACTTGGATGATTGGAGTGTGTGTGTGTGGGTGTGTGTG CGTGGGTGACCGAATAGCACTTCCCCGTGACCCCCCCCCCCCCGGGAGGC GGACCCCTCCCACGGGGACCCCTTCGCTAACAGCAATGCATGATGGGCAG GATCAGACATCGGCACCACCCGTGGGTAACGGATGGCAAAAATCCCCATT GAAAATCAATGGGAAAAATGGTGTTCCAGGTGCCAGGGTGGAGGGTAATA CTAAACCTCCACCTGGCACCCCCGGATGGCTTGGATACAGGGTCGAAGGC CCTAACCCTAATTTTCCTTTACAGAACGTTTGAATATGACATCATCACAG TGACTGTGCCCATCGCCATGTCTTTGTCCCTATTTACATTTTAGTACATC AAATCTCAAACAATTCTGTACATTTTAAAATCTTCTAACCACTATCAAAT GTATAATGTTAATAGAGAAAACTACAAGAATAACCCGTATCAATAACAAC TTTGAACTAAGAGCCATCTTGATTCAAAATTTGGACACGGACATGGTGAC GTGGTCGTCATTTCCTACATTGTTGATGAGGAAAGTGGGTACAGACGCTT TATTCCTACATTACATGTTCATGCATGAGAAGCACAAATGACAGGTTTCA TCTCACTGCTTCATTTTATTCCGTGAAATCTAGCAACAACTTGTGGCGCT GTCTCTGGTGGCGTCTTTGGACCAGGTTGCTGACACGCTGCTGACTTTGC AGCCTGAGAATGTAGAGTACGAGGCCAGCTTTGAAACTGGAGAAGTCTCA CTCGTTGTAGCCAAACGCCTCTCAAGTAGTAACCTGAAGCTTGAATCTGG TAACATTGCGGTAAATATTCAAGAGACGACCAGTGCAGAGGAGACACCTA GTGACGTCAAGGTAGGCAAATCCCATCCACGTCGAATCGCTAAAATAAGC TATAGAAAAGAAGTAGCCTTCACTTTTTGACAATTTACATTTACTATGAA AACCATTAAAATATTATCGTGGAAGCTCATCGCGTTGAAAATTTGATCCG TGAATACCTCAGTGTTGTAAGAACTTAAAGGTGCCCTAAGCAATATTAGG GCACTGAAAGTCACATATTCAAAATCGATCTTTTTCTGATTTCTGTCCAT AGTAAGTTTAGATAATACNACTGAAAGTCACATATTCAAAATCAATCTTT TTCTGATTTCTATCCATAGTAAGTTTAGATAACACTATCCCATCGCATAT CGACCATCATGGAGCAAAAATGCAATGTCGTTGTGTGGTGGGAACTCATT GAAAATCTGAGCACTTGGAGGCCAGCCATCATTTCAAATCTTCCGAACAT GCACGATTCTGACCGATAAGTCCCGAACGCTTCCGAAGAAATAATCACGT GGTCATGGCTCAATGTGCTTGGGCATTGTGACGTCACTCGGCCGGAAGTT ACCGAGAATTGTCGACAGAAAACGGTTACGGCTGGATTCTGGGCTGATTT TTTATTCTTAAACGCCCAAAGTATGAAATTATGATGCAGATGTGCTGATA TGGGGAAGTAAATGTTAATTTCAACTTCACCAAACAGAATTGTTTTCCCC AGAATATTTCAAGTTTTACCCCCTGAAATCGCTTAGGGCACCTTTAAGCA TTTTAGGACGTTTGTCGTACGACACTCTTTGTAAGTGCCTCATGTAAACC GGTCCTAAATTTCTTATGTGTTCATTGTTGCTATTTTGATTTAGTTTAAC TGGGTTACTTTTGTTAGGTTTACAGTCTAGTAGTAGCGTTGCCGTCTTTG TTTTGTAATCTTTTTGCAATTTTCTGCTGTTCATGATGTTACTTTTTTTG TACTATTTAATCATTGTACTTCCTGATGTGTCTTTTTAAAGTATTTTTAG GAACAGGTCACGTATAGGAAATACTTATGTTCCCTTGTGTACCCTACAGG TGGCAATTTTTCAGAAGAACCCATACTCCTGGAGCGACTCGACAGGGGGA CAAAACATTTCGTCTCCCGTGGTAGTCTTGAGATTGAACGAGAAGAACCC CGACATAAACGGCACAACCCCAAGGGTAACCCTGGACTTCCGCCAAGTAC ACTCCGATCGGACAGGGCAGCCAACCACGCCACAACCACACATCACGACG GTAACGCCACGCGGCACGAAGGGCAACGGAACAGCTCTGACGTACCAAGC CTTTAGCGTGCCCAGTGATGACGTCATCCCTGTCGTCACCATGACCTGGA GGGATTTCCGCGCGGTCTATCACGTGTACTCCATGGACGGGTCTCGCCCG ACTGTCCAAAAGTACGCCGAGAGAAGGGTGGTACAGGCAGCCGGATTGGA GGCGTGGTTCACCGAGACCGACTTTTCAGTTTCATTTGTTCCCAACACAA CAGCGCAAGGTGACGTGTTGTACGTCGGAGTTCATGAATTAGGTAAGTTT TCTACGGTGTATGCATATGGCATATGGAAGTCTTTCCATCAGCCGTGTAT GACATAAACTCGCAGTTTGATTAGGGGGAAATCTGGTTAAATTGGCAATT TGAATTTTATTGCTTTCTCATCAATGCCTTTGGATAACAAAGAACTAGCT TTACTGACTATTGATAGCTGGGTATGTATAACTTATGAATATGACAACGT CATCAAATTTTATTGCCACTAATATAATTTGTCAAGCGAAAATACAGCAC ATACAACTGTGTTTTACACAGTGATCAAATGATCAAAGATAAAAACGTAC GATCGTACATCATGATATCTACTAATTTTCGGCAGTCACTAGAGAGTAAT TATATTTCAATTCGTCCATCAGTTTATTCATACCTAGGTCCTGTAGACGG CAAAGGCTACAGATTAAGGGTGAATGCTGTCGCCTGTTTGTCTTGGAAGG ACCGGCAAAAGCAGTGGAGACTAGGAGGTTGTCGAGTAAGTCAGGCAAAT GGATCAGTTTGCTGCTTTGAACTTCACCAAAGTCTGTCCCAATATACGTC ACCTGTCAGATACATGTACTAAAAGGCCTCAACAATTGGCTTTCGTATGG TCGTAAAAGACCATGCGGATAAGAAATTGTTTTGCTATTTATGACTAGTA CTTCTTCGGTCAATATTAACCATCATAATGTATGGTAAAACCATAATTTA CATTAACCCTACAGATTCGGCTTTGACTAAACAGTCCTATGCGAGAATGA TCGACAGTCTCTACCACATAGCACCCACGTGTAAGATGATCTGTTGCAAA GTTCTTTTCTCCGGATCCGCTCTATTCCGCCCTGCACATCACTCTAGGTT CTCCTGATTTTAGCTACTTTGACAGTGTATTGTGTCTAACGAGATTGTAA ATTGAAGGCAGCCATCTAACAACCTCTGACTTTCAGGATTGTTTCTAACG CGATTGCATATTGACAGCAATCATTTAACAACATCTGTGACTCATGCAGT CTTTGTAGTCCACGAAAGTGTAACTCATCTATTGATTGTGCTTTCTCGGT TTCTCAAACTCCGAAACGCAGGCTACAGTCCGGTTGAACGACGACGTCAT CAGCTGCACGTGCGACATGGAGTCCAGGATCACGGTGGGGACTTCGACTC TCCCCGTTCCGAACTCCATCAACTTCGTGAACGCCTTCCAGAACTTCCGC AATCTGAGCGACAACGCCGTGGTGTTCTCCATCGTAGTGGCCGAGTTCGC TTTGTACACCATCCTCATGGTTCTCCTGCGAGCGAAATTCAAGCGTAAAT GGGTAGGTGTACTTTCGATTCTAGCTTGTTTGCTTGCTTCTTTGTTTCTT TGTTTGTTTGGCATTGCAGGTGCACCACCTTTAGGCGTAACACACCAGCT TCTGTACAGTAAGTAGAAGCTGCACAAGGCCGGATAGTACGATTTGATCA CACCGAAAAAAAACCCAACTATTTTCGATCAGTGTGATGGGTTCTTTGAC GTGCTCGAGGTGTGGCTTTTTCGCAAACACTGGACTTCCGATTTTACCTT CCATCCTAAAGGACGTCCCTACCCGAAACTAGTTTCTCATTATTACCTGA GTGGAGTAAGGAAACAGGCGTTAGGTGCCATTCCCAAGGGCATGCCGCTG AGGCCTGCTAGAGATTCGAAGTCAACAAATCTAACCACTAAACTATTTGT CCATCAAATTCAAAGGATTGGATGGTAAGTTTTGATCCAGTCACACCGTT AAGGACCCCAGCAACTCATTTCGATAAGTGCGGTGGGTCCTTTGACGTGC TCTGCAGTATGTGTGGCTGTCCTCAAACACAAGACCCCCAACTTAACATT CCATCAAAAAGCACATTCCTGGCCGAAGCTAGGTTCTTATTTTCACCTGA GTCAAGTGAGGAAATAGGTGTAAAAAGCCTTTCTCAGAGGTGGTTGCGAT GGTGCTTACTAGAGATTTGAACTCAAAACCTTTAGTCAACAACTTTGACC ACGAAACTACTTTGCCATCAAAGGAGAAACTTTTCACGCTGCCCAAGGTG AGTCTGATCCCGCCAGACAGGATGCCTGCATCGCACGTCTATCAGGTAAC CGTCACCACCGGGTCCATGTTCGGGGCAGGGACTACGTCACGGATCGGCC TCAAACTGCACGGGTCAAAGGGCACAACTCCGTTAAAGATGCTGAACCCA GGAGGAGAGGTCGGTGTCAATGTCCCCTTAACGTGCTTGTAGTAGCTATA ATTATAGACACTTAATGTGCTTTTTAGGCAAATCATTGACAGTAGTCTCT GTCAAATTGAGGTATTAGTACTTATTTCTCTATGTTGTGGCAAAAGAAAA TAGTATTTTTCGTGCATTGTTAGAGAAAGAACTATGCGACTCATTCTTTC TTTGTTCATTCAGATGATCTTAAAAGTTGTAAATATTTTCTTTAATACTG TTCGATGCTTCAAAGATTCTGTCATGTACTTCTTATTACGGCAAAAATGG AGAATGGAACCTTAATGTCATATCAAAGTAAGTAAAAGTTCGCGATAATA TCATCGTTTCTAATTCCAGGCTTTGGTTCGTGGAAGCACTTTGCATTTTG TCATGCCTGTGCGAGCGTCACTCGGAGAAGTGACGTCATTGCACATCTGG CACGATAACTCTGGGGAAGGCGACACGTCATCCTGGTTCCTCCGAACACT GCTCGTCAGGGATGTCGAGACAGATGCTATGTAAGTCTTCAAAGACTTAG ACCATTGTCAGACATATAGCCGATCATATTCTTCCGACCTTCTAGATCTC CTAACCATGGTTGGGAGTTAGTCGTGAGCAGGGTCTTTTGTGTTTGGGAG TTGATCAGTAAGGTCGCTTTCCAGTCTTTAAAAGTCTTTAAATATAATTG TTTGAAAAATCAAAGTTGAGAAAGTAATATTCTGCTCTGCATGTGATCAG AGTAGCGAACTGGACCTGGAATAGGATGGATTCCAGGCTACTCTCAACCC AGGGCTGAGCTTGATTGGCAGCAAAGTCGTAGGGAGGTCTTGAATGTGTG GCAGGGGTTTAAAACAACCTCTAGTATATTCAATTTGACCTCATCAATTC TTGCCCGAGCATGTTGGCATGTATTGCAATGACAACTAAGCTCATTTTTC GACTGTCCTTCATCAGACTGGCCTAGGTCTATCATATATTCTTTGTATGT AAAGAGAATTCAGTCAATCAAAGGAAAGACCTTAACCCCTTATATCTAGC CTCCTTCGCAAACTTCCTAGAACGGTGGAGAATATATTTTATCCAGAGAG GCGGTCGTCCCTCGGCGAAATAACTCCCTCGGCGGCAAAAGTCCCTTGCC GGCATTAGAGAACCCTAGGGCCGTGTAAGAAAACGCCCCCCCCCCCATAT ATACGAAGGAAGTCTGCGAAGGAGGCTACTTATATCTACCATGTTATTTT ACAGGTATTACTTCATCTGTAACAACTGGTTATCGGACAACCAGGGGGAC TGTGAGGTGCAGATGGTGGTTCACGCAAGCACGCAGGAGGAGCTGAGATC CTTCCCGAGCGTCTTCAGCGAGGCCACCAGGGACGTGTTCTACGATGCCC AGCTGTGGGTCTCTACCCTTGTAGCGTCTCCAGGTCTGTGACACTTTCTT TATTACTTAACCTTCTCCCTGCTGCCCGACTCTGTAACCAATAGGGAATT GGATGCCAAATGACTACTTCGGTGTACATGTGCTAAAAGTAACATTGTGG TCGACCGTATACCTTCGTAGCATCTCCAGGTCTGTCACACTTTTTGCATT ACTTATGTGTTTTTAAAGACGGTAAAATCATTCCCACCTCTTTCAGTGAA AAGGAATAGTGCCTATCTTCGTTTCTATAGACCTTGGGTCATACAGGTCA TTACTGTACAGGGGCTAGTCGTCTGTTCCAGCATGTCCAGGACACGAGAT ACAAAATTCAGAGGTTTCCAATGCAGTACTAAATCTAAATATTTCTTTGA TAGGCCAAACCCAAAAGCATACTGATGATCATACAAATCCACTCATAGCT TCTTGAACTAATTAGCTGCTAACCACACACGCTATCAAAAATACAACCTT CTTGGCGAAGGTAATGTTATCCCCACGCACGAAAGTCGTTTTATGCGAGA CTTGGATGAAATCCGCAGGTTCCAGCTTCACCCAGGCCCAGCGGCTGTCC TGCTGCTTTACTCTGCTGAACACCATGATGCTATCCAGCGCCATGTGGTA CAGGGGAAGGGACACAACTGCTGGCACGACAGTGTACAACCTGGGGGTTG TGCAGTTCACAGCAGAGGTAATGTCACCAGCAAACTTCCTTCAGATCTTT CCAATCAAGTTACAAAACACCATAGCAACCTTCAAGTAAACTGCCTACTT AGACCACTTTTCTACTAGTTGGTGATCGCAGAGTGACCAAAGCTGGATTT CTGTGACACTGGACTTTGTAAATGGACTGTGGTGAACGACGTTAAATACG GTTTAAAAGGCAAAAACATACAGCACAGAATGAAATTGTAATTCAATCCA TACGACTGTATAACTGCATTTTATTTCCAGACGCTTCAAGTGTCCACTTG ACACTTTTCATCAGTGTTCATAACGTCTGAAAATGAAATTCGTTAATCCA GTGGTATAGATTGAATTACAATCTTATTCTTCATTTTTTTCTTTTGGGAT GACTAATATTCACAAACGTAATATACAACATAATCTATGAAATTTGTTGT TTCTTGTTAAGGAGCTGTGTATCAGCCTCATGACTGCCTTGACCGTTGCT CCCATCAACATGATGATTGTGAAGCTGTTCCGCTTGGAGGCGCCGCTGTC CGTCAACACTCCGGAGATGGTCATCCGTACGTCACAAGGTATGCAAAATG CCAGTAGGTAAAAGGACTGTTGAAACATTCCCTTACCCACTCATTGCAGT ATAAATTCTTAGTTCTCCACTTCACTTCAGTGTGTGCACTTATTGTACCA GCTGGTGCGCACAATTAATGGTACAAAAAGGAGACGTCCCCCCCCCCCAG TTGGGGTGGAAGCTCTAGCATTTCGCATTTTCGGGGACCCTCAAGTCAAG GCGCGAGGACGCCGCTGTCAAACTGGTCAAACAAATGCCCCAAGATAACA GCCCCCTACACGAATTCGCCCCCCCCCCCCTGTAGATCCGCAGCTACTGG ACGGTCACTCAGGAACAAACACAACATCTCCATCCCCCCAGCAAGAACCT AAAGATTACAGGACTCTTTCCTACATACGGCAATCAGTTTGTACAACAAT TAGTAGCGCCTAATGTGCAATAACGCTTGGATGTATATATTGATATATTT TATATATTGTATTGTATATTATAGGTGTTTTCTATCTTATTGTGTATATT TAGTGTCTGACCAACAGAGGCCATGTAAATATCATCGCCATTCAAGCATG TTATTTTGTCTGTAAGTTGTGATATTTTGAATAAAGAATTACGAATCAAG AATTAAGAGTTAAGCTTTACGTCTAGTTTTACATTTCATACTAAAGAGGC AAACATTCAGCAGAAAACTCTATTTGGAATTATGTACAGTATGGGGGGGG CACACTTGTTCCATTCTTTTGGGAGATCCTTGCATTACTATACTAACAAC AAACGGCATATTTCAAATTAAATATCTACCTTGACTTGTTTCGGATACAC ACAGGACTGTCTGTCTAAATCAAATCACTCTCTGTTGACCCCAGGATGTG TCCGGAGGTCCCTGTACCGCCTGGCCCGGTACGTGGCGTGGGTGACCGTG TTCCTGGTGTCCACCAGCTCCGCGTTCTTCGTGATTCTGTACAGTATGGA CTGGGGGAAGGAGAAGAGTGACTCCTGGATGAAGGCCTTCATTCTGTCCT TCATGGGTTCCAGCTGTGTCATGGACACTCTTCAGGTGATGTACCATTTA TCATGATTACTGTTGACATATATTATGTCATCATCTAACTACGATAGAAG GGAAAAGCTGTAAATTCGTCTACACATTTGAGAGAAGAGGCATAGTTGTT CTTTTTATCTCTTGGTATTTAACTCACGGCATTTCACCCGAATGTGGCTC GAGCACTACCAAATACATATACATGAAGTATCGGCAGTATTATTACCAAC AATACAGGGATTGTCAGATCTCACTGTCTTGTAAGATTTGTTCATTGAGA GACGTTCAGATATACTTAGCTTTTTTTTTTACTCCTATATATCAGATCTT TGCGATGGCCGTGTTTCTGGCAGCCGTGTGCGGCCTCCCGTTCCTCGCCA AGCCGCCGGCCATTCGGAAGAACAACATGCAGCTGAACCTGTGGAACACG ACAGGTGGGAGGTTTTAAATCTCTGAGGATAACCTTACTTTTTAAACCAC TTGTTTTTTTTTATTTTCGTGTATCAATCAATCTTTAAGGGTAATGTCAG ATAACTGGGTTCATGATTTGCAACTTGGACGGGGTGCCTTCGCAAAATCA TATCAGGATACACAAATGGATACAAACATAAAACAAAACATAACCTTCTC GACGAAGGTAATGAAAAAGAAATTATGTTGTAACAGTAAACTTACTCAAA CTTAGGTCATTAATAGTACAAAATGAGATAAAAAAATCAATTTCACAAAC AGAACATACAAAAACATAGTTTTTGGTGCAACACACGTCACTACCAGCGG ACTAGCCCCCTGCTGTAGTGCTGTAGTGTGACCGAAGAGCTATAGAAATT GAGATTAGAACGTTTGCAGAAAAGGGCGTGAGAACGTTTGCAGAAAAGGG CGTGCCGCACCATCATGGCAACGACTACACCCGTTATCAACACGCACTTG AACACCTTGGACTTTCAACCCTCGCTGCCAGACGTGAACAGTTGTGCATG AAGTTCGCTAGATCCCTGATGGACTCTGAGTTCAGGGATTGGTTGCCACC ACCTAGGGCTCAGATCACTGGCAGAGTGACTAGGAACAATCACAAACTGA ACTGTAAAAACTAACCGGTACTTGAACTCCTGCATTCCATACATGACCCG CCTTATCAACAAGTATGATCAGTGACTCGTTTTTCTTGTAAATGTGTCCA ACTTTTTAATTAAGATACACTTATCTTAAATATGCCAGTTTTAAGGTCAT GCGAATACGCATGCTATCGGACAGTATTGCGCTGTCTACACAACTTAAAC TTGTTGTTTTGATTGATTGATGATTGATATGTTTGTAAATTGGTTTTAAT TCAGTGGCAACACTGCGATTTCCAATAAAGTTATCTTGTATCTTGTATGA GCGCCACTCCTACGCCTGGGTCACTTTAACTTTAACAGGGCAAGCTTTCT TCTTCATGCGATCTTTATCATTCTACTTCTAGTGCCGAAGAAGGTCTATC CACCTGCCAACGCGAATCTCCAAATGGCTAAAAAGAAAAAGGACCTGAGT AAGAAGTCCGCCTCGGTGCTGATGGATTTTCTTCTCCTGTTTGTCTTGGT GGGGGTCCTGTTCTACATCGCCCAGGCGGGGAACGATGAGATGGCCTTGT ACGAGACACAGGCGCTTTCAAACAGTGTCCTACAGGAACATCATGCGGTA AGTAACTTGTGCAATCAATCACATCACAATCAATCAGGTTTTGTGTCTTT AGTCAGAGTTGTTGACTCAGAACCTGGAGGTACTGATTTCGAATCCCTGA CAGTTCCCGATGTTGTGCCCTTGGGAAAGGCTCTTCATTCACTCTACTCA GACATGAATGAGTACTTAGCTTCGGCTAGGGACTTCCCTTGGGTACGACA TTAAAAAGAGGTCCCTTGTAACTAGCCAGTAGGCTTAAACAACACTTTGT CTGCTACAATGCACTTCAATTTTGCATGTTGCAATTGTTGTGCAATAAAC TTTGACATTAAGACTGACTCGTTGTGTGTGCACGTACAGATCAGGACGCC GGACCAGTTTTACTCCTGGCTTCAGGAGACCCTGTTGCCGACCCTACCCG GCTGCCTGGTACAACGGCTGGAAAATGAAGTTCTTGGACCGGCAGTTTGC GCAGAACACCGAGTCCTTCCGCCTCGGTCCCCCGCACCTGGTACAAGTTA GACAACTTCCAGGTCAATGTACTTTTTCTTACAATTCCAATGACTGATGT ATGTATGTGTGAATGTATGTATGTATGTATGTATGTATGTATGTATGTAT GTATGTATGTATGTATGTATGTATAGATGGATGGATGGGTGGATGGATAG ATGAGTGGACGGATGGATGGATGGATATATGAATTGATTGTTAGACTATG AAACATTATGATGTCCACCTTTGAACTTCAAGGTAGATTTTAACATGGTA TCCTTTTCATGACTGCAGGTACCATGAAGCCGGACAAACCCGCAGGTCTT GGCTGGGCTCTTCTCGCGGGAAACAAGTCGGACAACTGCTGGCGATTTGA AGCTCCGAACCTTGGCAACCACCAGAACCACAGCTCCGTCTGCACAAACT ACCACTCTCTTGACTTCCCTCTAGACTCTACCACTTCTGTTTCTGTCTTC AGTACTTTAAAACACTTTGAGTACGTCGACAAATACACAGAGTCTCTGAC AATTGAGATGAACTTTTACAACCCCAGTCTTAAACAGTTTAGCGTTGTGA AGATTTTTGTGTCTCATCCTGGGATAGGGAACCTCATGCCAACAGCAACA ATCACGGCGTTCAGAATGTTCCAGTACGAGAGTGGTTATGACTATGTGAA TCGACTCCTGCATATTGCCTTCACTATTCTCTTCCTCGTCATGCTTTCTA AGACAATGAAGGCAGTGAAAGAAGAAGGCTGGATATATTTCATCTCACCC TGGAATATTCTCGAATGCGCAGTCCTCATCGGAACAGTCATGATCATCTC AGTCTTTGTCAAGCGATACGCCGTGGCGTCTGCTACACTCAATATGGTTG GTGCAACCAATGGTAGGTTCCACACGTCACTAGATATCTCTGTCGGGAGG GCCTTTTTAGTTTCTTGCTTACACTGCACGAAATGGCCACGTATCCTGAC GGATCCGACGTATCCGGAATCGGGCCTCATGGCGTTTCCGAGCGAATCCG GAAAAATCCCAGTTCACTGCTCGGATACTGAGGTGCCCGCAGATCCGACC AATTCCGACGCCGTATTCCTCTGGATCCGTGATGCGCCTCGGATACCCGA AAATATTTGTGCGGATCCCTCGTTTTTTTGTATTTGGAATGTTCGGATTG TTTGTATGTCGGTAGTTGTTTCGGATCCTGACGAATAAATACACACGGCA CGGCATGATCTCATTTCCTGACGAATCCAGCAGATCCGGAATTACGCATT ATAGCAGACACGGAACGTTTCCGATTGAATCCGATGCACCTCAGATCCGA CAATTCCGGCGCCGTATACGTCTGGATCCTTCATACGTTTCGGGTACAGA TACGGAACGTTTCCGAGCAAATTCAGACAAATACCAGGTACAGCTCAGAT CCGGCAATTCCGACGCCGTATACGTCTGGATCCGTGATGCGCCTCGGATA CCTGAGGATATTTGCGCGGATCCTTCGTTTTCAGATATTTGTCAATATGG CAGAGATAATCGGATTGTTTGTTTGTCGGTAGTTGCTTCGGATCCTAACC AACAAATACACACTGCACGGCATGATCTAAGATCCTGAAAAATTCAGCGG ATCCGCAATCGTGCATCATAGCAGATACGGAACATTTCCGATTGGATCCG ATGCACCTCAAGTCCAANGCACCTCAGATCCAACAATTCCGACAAATCCT GACGTTTCCGGAATACGGATTCGTGTCCAATCTCCCACAAGACACTGCGT GTCATGACGTCAGGCGCGAGAAACGGTTTTGTCGGTGA

Coding sequence (CDS) from alignment at Sc0000280:328232..341219+

>Blg00020.0 ID=Blg00020.0|Name=|organism=Branchiostoma lanceolatum|type=CDS|length=3366bp|location=Sequence derived from alignment at Sc0000280:328232..341219+ (Branchiostoma lanceolatum)
ATGGAGGCGATAACCACTGTTCTGATGCAGACAGCTTCAACAGTTCTCGA
CATGGCACCCGAGCAGGAACCGCCGATTCCAACTCATGTCGACAACCCTT
TCAAAAGTGACCTCGTCGACCTCTCGGCCACTGACCTTTCACCCAAACAG
CAGCTGAAGAAGTTAAGAGACGAACAGAAGGAAAGAGAAGACACGCAACA
ACTTGTGGCGCTGTCTCTGGTGGCGTCTTTGGACCAGGTTGCTGACACGC
TGCTGACTTTGCAGCCTGAGAATGTAGAGTACGAGGCCAGCTTTGAAACT
GGAGAAGTCTCACTCGTTGTGGCAATTTTTCAGAAGAACCCATACTCCTG
GAGCGACTCGACAGGGGGACAAAACATTTCGTCTCCCGTGGTAGTCTTGA
GATTGAACGAGAAGAACCCCGACATAAACGGCACAACCCCAAGGGTAACC
CTGGACTTCCGCCAAGTACACTCCGATCGGACAGGGCAGCCAACCACGCC
ACAACCACACATCACGACGGTAACGCCACGCGGCACGAAGGGCAACGGAA
CAGCTCTGACGTACCAAGCCTTTAGCGTGCCCAGTGATGACGTCATCCCT
GTCGTCACCATGACCTGGAGGGATTTCCGCGCGGTCTATCACGTGTACTC
CATGGACGGGTCTCGCCCGACTGTCCAAAAGTACGCCGAGAGAAGGGTGG
TACAGGCAGCCGGATTGGAGGCGTGGTTCACCGAGACCGACTTTTCAGTT
TCATTTGTTCCCAACACAACAGCGCAAGGTGACGTGTTGTACGTCGGAGT
TCATGAATTAGGTCCTGTAGACGGCAAAGGCTACAGATTAAGGGTGAATG
CTGTCGCCTGTTTGTCTTGGAAGGACCGGCAAAAGCAGTGGAGACTAGGA
GGTTGTCGAGCTACAGTCCGGTTGAACGACGACGTCATCAGCTGCACGTG
CGACATGGAGTCCAGGATCACGGTGGGGACTTCGACTCTCCCCGTTCCGA
ACTCCATCAACTTCGTGAACGCCTTCCAGAACTTCCGCAATCTGAGCGAC
AACGCCGTGGTGTTCTCCATCGTAGTGGCCGAGTTCGCTTTGTACACCAT
CCTCATGGTTCTCCTGCGAGCGAAATTCAAGCGTAAATGGGAGAAACTTT
TCACGCTGCCCAAGGTGAGTCTGATCCCGCCAGACAGGATGCCTGCATCG
CACGTCTATCAGGTAACCGTCACCACCGGGTCCATGTTCGGGGCAGGGAC
TACGTCACGGATCGGCCTCAAACTGCACGGGTCAAAGGGCACAACTCCGT
TAAAGATGCTGAACCCAGGAGGAGAGGCTTTGGTTCGTGGAAGCACTTTG
CATTTTGTCATGCCTGTGCGAGCGTCACTCGGAGAAGTGACGTCATTGCA
CATCTGGCACGATAACTCTGGGGAAGGCGACACGTCATCCTGGTTCCTCC
GAACACTGCTCGTCAGGGATGTCGAGACAGATGCTATGTATTACTTCATC
TGTAACAACTGGTTATCGGACAACCAGGGGGACTGTGAGGTGCAGATGGT
GGTTCACGCAAGCACGCAGGAGGAGCTGAGATCCTTCCCGAGCGTCTTCA
GCGAGGCCACCAGGGACGTGTTCTACGATGCCCAGCTGTGGGTCTCTACC
CTTGTAGCGTCTCCAGGTTCCAGCTTCACCCAGGCCCAGCGGCTGTCCTG
CTGCTTTACTCTGCTGAACACCATGATGCTATCCAGCGCCATGTGGTACA
GGGGAAGGGACACAACTGCTGGCACGACAGTGTACAACCTGGGGGTTGTG
CAGTTCACAGCAGAGGAGCTGTGTATCAGCCTCATGACTGCCTTGACCGT
TGCTCCCATCAACATGATGATTGTGAAGCTGTTCCGCTTGGAGGCGCCGC
TGTCCGTCAACACTCCGGAGATGGTCATCCGTACGTCACAAGGATGTGTC
CGGAGGTCCCTGTACCGCCTGGCCCGGTACGTGGCGTGGGTGACCGTGTT
CCTGGTGTCCACCAGCTCCGCGTTCTTCGTGATTCTGTACAGTATGGACT
GGGGGAAGGAGAAGAGTGACTCCTGGATGAAGGCCTTCATTCTGTCCTTC
ATGGGTTCCAGCTGTGTCATGGACACTCTTCAGATCTTTGCGATGGCCGT
GTTTCTGGCAGCCGTGTGCGGCCTCCCGTTCCTCGCCAAGCCGCCGGCCA
TTCGGAAGAACAACATGCAGCTGAACCTGTGGAACACGACAGTGCCGAAG
AAGGTCTATCCACCTGCCAACGCGAATCTCCAAATGGCTAAAAAGAAAAA
GGACCTGAGTAAGAAGTCCGCCTCGGTGCTGATGGATTTTCTTCTCCTGT
TTGTCTTGGTGGGGGTCCTGTTCTACATCGCCCAGGCGGGGAACGATGAG
ATGGCCTTGTACGAGACACAGGCGCTTTCAAACAGTGTCCTACAGGAACA
TCATGCGATCAGGACGCCGGACCAGTTTTACTCCTGGCTTCAGGAGACCC
TGTTGCCGACCCTACCCGGCTGCCTGGTACAACGGCTGGAAAATGAAGTT
CTTGGACCGGCAGTTTGCGCAGAACACCGAGTCCTTCCGCCTCGGTCCCC
CGCACCTGGTACCATGAAGCCGGACAAACCCGCAGGTCTTGGCTGGGCTC
TTCTCGCGGGAAACAAGTCGGACAACTGCTGGCGATTTGAAGCTCCGAAC
CTTGGCAACCACCAGAACCACAGCTCCGTCTGCACAAACTACCACTCTCT
TGACTTCCCTCTAGACTCTACCACTTCTGTTTCTGTCTTCAGTACTTTAA
AACACTTTGAGTACGTCGACAAATACACAGAGTCTCTGACAATTGAGATG
AACTTTTACAACCCCAGTCTTAAACAGTTTAGCGTTGTGAAGATTTTTGT
GTCTCATCCTGGGATAGGGAACCTCATGCCAACAGCAACAATCACGGCGT
TCAGAATGTTCCAGTACGAGAGTGGTTATGACTATGTGAATCGACTCCTG
CATATTGCCTTCACTATTCTCTTCCTCGTCATGCTTTCTAAGACAATGAA
GGCAGTGAAAGAAGAAGGCTGGATATATTTCATCTCACCCTGGAATATTC
TCGAATGCGCAGTCCTCATCGGAACAGTCATGATCATCTCAGTCTTTGTC
AAGCGATACGCCGTGGCGTCTGCTACACTCAATATGGTTGGTGCAACCAA
TGATACGGAACATTTCCGATTGGATCCGATGCACCTCAAGTCCAANGCAC
CTCAGATCCAACAATTCCGACAAATCCTGACGTTTCCGGAATACGGATTC
GTGTCCAATCTCCCACAAGACACTGCGTGTCATGACGTCAGGCGCGAGAA
ACGGTTTTGTCGGTGA
Gene-mRNA-Prot