Blg00019.0 (mRNA) - B. lanceolatum

Overview
Name
Unique NameBlg00019.0
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000280:105306..106999+

Legend: polypeptideexonCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Blg00019.0 ID=Blg00019.0|Name=Blg00019.0|organism=Branchiostoma lanceolatum|type=mRNA|length=1694bp|location=Sequence derived from alignment at Sc0000280:105306..106999+ (Branchiostoma lanceolatum)
ATGCCCATTGGTTGGCTCGTAGCTGCTACCTCTGCCGTGGCTGTGTTGTA TTCAACATACGGCATGTACCACGGAACGACTCTCCAGACGGAATCCGAGA ACGTACTGTATCTGACTGTCCATCGTACCGTCTGGGCCATGGCGCTTGGT TGGGTGGTTGTCGCGTGTTTTCATGGATATGGAGGTACAACATAGTTCAA ATATGATACCTAGTCATTATTACAATGACAATGCAACGCAATAAAGATTG AAGAACAGAAACTTTCCTAACGGCAACATAAGTTGTGTTAGAGCCATATG TTGACATGTAACAATTGAAGTTTGAATTTGAAAACGCAGAAATCACTTGC GATTTCACACAACAGCAATTGGTGCATGAATATCGCAGGAAGGTAAACAT TCGCGTCCATAAGGCCCAATCACTGAAATCACCATGTAAGAACTATTGTA TTGACAAGTACAGACTGTTTGTTACATCAGATCAACAGTTTGCATCGATC GTGTTGTGATGTACTTAATCCTCTACAGGAGTGGTGGACACCATCCTCTC CTGGGACGCCTGGGTGCCCCTGAGCCGACTGACCTACTGTGCCTACATGC TACATCTCCTGGTGATACATACAGTCTACCTTATCAGGGAGGTGCCCATC CACTACACCACATCCACTATGGTACGTAACGTTGATATTCAAGTCTGTAA AAACACGAGTTCGGAGACCTCAAACCTCCATGAAATATTTGAGCTTTTGT GATGTTTTTGTTTTACAAATTAGTCTGCAATTAGTAACCTATTCAGAACT AATGATGTTAACCTTTTCAAATGATGTATCGTTAATGTTTCTCACTAATT ATGCAAATAAGGGTTTCACTTGCATAGATTATCTTTTATCTTTTAAGTTA GCAAATAGTATTATCTTATGAAATATGGCTATCATTGCATATCTTCATGA ATTATGTGAATGAGACCCTGATTTACACGATTTATTTTTAACAATGTTCA CCAAATATCATGAAGATCCATCCACAGTTTATCGAGTTATGCTGTTAACA AACATACACACTCTAGCTCAGACCACAGCCACTCCACTATGGCACCATTA CCGAAGGCTGGCAATACCTACAATAGCACAAAATTCCATAGCAATACATC AAAAGGGTCTTGAGCCACAAGGAGGCCAAAATCAACCTTGACCATCAGGT TCACACCTACCTACGTACCAAATATCATTCTTCTTCTTGAGATATTGCGC CGGAACCGAATGCCTGCACACAAACAGAGAACTATACCTCCATCTTTTAA TGGAGGTGATAACGAAAAGTGACGAGGGCGAACATGCACGTACATGCAAT CTGTCTTCCTGCCTTTGCGCTATTCTGAACGAAACGAGTTGGAAGGGGAA CACTGAATTGATTGACAAAAGAGACAAAAAAATTAGGGTTTTATTGTTCA ACTTAAACACCATGCATCACATCCCACAAACTAAAGCAGGACTTGGATAT CACAGAACATTTCATAGGGCAAATTTAGTCTATCGTTTAACTATAATCGG TTGGCTGATTGTGTCCATTTGACTTTATTCCAGATCTATTTCTTCTTGGG ACACTTGACTCTGTCCTACGGTTTGGCCTTCCTTGTGTATGTGGCAGTGG AAGCGCCGTTGATGGGACTGGAGAAAATGATCTTCAACAAATAA

Coding sequence (CDS) from alignment at Sc0000280:105306..106999+

>Blg00019.0 ID=Blg00019.0|Name=|organism=Branchiostoma lanceolatum|type=CDS|length=402bp|location=Sequence derived from alignment at Sc0000280:105306..106999+ (Branchiostoma lanceolatum)
ATGCCCATTGGTTGGCTCGTAGCTGCTACCTCTGCCGTGGCTGTGTTGTA
TTCAACATACGGCATGTACCACGGAACGACTCTCCAGACGGAATCCGAGA
ACGTACTGTATCTGACTGTCCATCGTACCGTCTGGGCCATGGCGCTTGGA
GTGGTGGACACCATCCTCTCCTGGGACGCCTGGGTGCCCCTGAGCCGACT
GACCTACTGTGCCTACATGCTACATCTCCTGGTGATACATACAGTCTACC
TTATCAGGGAGGTGCCCATCCACTACACCACATCCACTATGATCTATTTC
TTCTTGGGACACTTGACTCTGTCCTACGGTTTGGCCTTCCTTGTGTATGT
GGCAGTGGAAGCGCCGTTGATGGGACTGGAGAAAATGATCTTCAACAAAT
AA
Gene-mRNA-Prot
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
Blg00019.0Blg00019.0-proteinBranchiostoma lanceolatumpolypeptide
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
Blg00019.0-exon-Sc0000280-1570713199:105306..105453Blg00019.0-exon-Sc0000280-1570713199:105306..105453Branchiostoma lanceolatumexon
Blg00019.0-exon-Sc0000280-1570713199:105834..105976Blg00019.0-exon-Sc0000280-1570713199:105834..105976Branchiostoma lanceolatumexon
Blg00019.0-exon-Sc0000280-1570713199:106889..106999Blg00019.0-exon-Sc0000280-1570713199:106889..106999Branchiostoma lanceolatumexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000280genomeSc0000280:105306..106999 +
Spatial Expression
in the tripal_feature_cv_term.tpl.php
Properties
Property NameValue
GeneIDBlg00019