BlTCONS00000023 (mRNA) - B. lanceolatum

Overview
NameBlTCONS00000023
Unique NameBlTCONS00000023
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)

Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000000:169904..321929+

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>BlTCONS00000023 ID=BlTCONS00000023|Name=BlTCONS00000023|organism=Branchiostoma lanceolatum|type=mRNA|length=152026bp|location=Sequence derived from alignment at Sc0000000:169904..321929+ (Branchiostoma lanceolatum)
GGACAGGGCACCAAATCGAGGATATGCTCCTGGATTGCAAGTACAAGGGG GAGCCCTGCAGCGCAAAGAACTTCTCAACTGTAAGCACTTTCACTTTCGC TTTCTTAATAAGTACCTGTAGTGTCTTTAAGTTAGAGTTTGAACTTGTAG TGTTTTAAGTACAAGGGGGAACCCTGCAGCGCAAAGAACTTCTCAACTGT AAGCACTTTCACTTTCGCTTTCTTAATAAGTACCTGTAGTGTCTTTAAGT TAGAGTTTGAACTTAAGTAGTGTTTTAAGTACAAGGGGGAACCCTGCAGC GCAAAGAACTTCTCAACTGGAAGCAATTTCACTTTCTATATGCTCTTAAA CTTTCACTTCCTTATTTAAAGTAGCGTCTTAGTGTCTGAACTTAAGTAGT GTTTTATTAAGTGCAAGGGGGACACAGCAGTCAAAAGTACTTTTCAGCTG TCATTTTCCCATCCTCAAGACGTCTTAGATACACTTTCACTTTCACTTCC TTAAGTCGTGTCTTAGTGTCTGAACTGAAGTAGAGTCTTAACTACAAGGG GAAACCCTACAGTGCTAAGAACTTCTCCACCTTCTCAACCAAGTCTTATC CCTCAATTGACTGCAGTTCCTTAAGTAGTGTCTTAAGTCCTAGTAACAGG TACAAGATGCCCCTCTGCGGTGCCAAAACCTTCTTAACGGTAACTCTTAT CCTTCATCTCAACGCAGTTCCTTTAGAAGTGTCTTTAGCTGTAAGTCACT TTCTGTATCTTAAGTACAATTGCTAACTTAGAGAACTTTCCAACTGTAAG TCTTGTCTTTCATCTGCAATCAGCTCTTTAAGAAGCGTCTCAAGTCTTAA GATTTATCACGTCTTCCCCGGACACGACCTTCTTCATCAATGTCTTCAGT CTGAATGTCACGTCCTCTCCAGACACAAGTACCTTAAGTAATGTCTTAAG TCTAAAGGTCATGTCTTACCGACAAAGCGAAAACAGAGTGGTGCATCTTC AAGTAAAGGAGCCAACCATACTGAGTTATGGGTGCTTTACAGACGAGCAC TGATCCACACTGGAGATAAACCCAGTCACTAACCAAATGGGACTTTAACA GTCCTGTAGTCATCCACACTGGTGAGAGACCTGTCTGTAGTTATCCACAC TTGTGAGAGACCTACCTGTACATTGTAGCTATCTACACTGGTGAGAGACC CGTCTGTACATGTAGCTATCTACACTGGTGAGAGACCCTTCTGTAGTTAT CCACACTGGTGAGAGACCCAACACATCAGCATACTTGAAGGTTCAATTTT TGAGCAACTGCAAGGCTATAATTCTATAAGATTCTAAGATATCATAAGAA AAGAACAGGTATATTATAACTAAGGACATTGTAAGGATAAAACTAGAGAT AACAATTGTGCATATGTTATACTTTATGTTGAGTTCTTAAGTACCAACTA CTGAAAGAAAAACAAGGCTTAAATCCAATCTACTTATCTATGTTATCATA AATCCACCATAAGCTGCGAGGTCCATCCATACTGCAGCCTGATGACCGCG GCATGCATAATTCTGTGGGATCTGGGACTGCAGGACTGATCATGAGATGG GAGAGTTAGACTAGATAATTCCAGCTGAGATCCACAGTGGAGATGAACCC TCCCCAACTTTTGCGATGTAACTAGTAAGGAGATTGTGAGGCTGAAACTA GTAGAGATAACATCTCTACATAATGTTTCACTTTTTAAGTGTTGTTCGTC AATAGTTCCGACAGAAAGAAAAACAATAATTCTGTGCAATCTGTGACTAC AGGACTGAGATGAGAGAGTTAGACTAGATAACTCAGACTCAGATCCACAC TGGAGATCAACCCTCCTGTCAGAACCCTGCCAACTTCTGTGATGTCACAC CAGGTCATGTCCATGCAAACAGAGGTCTCACTTCTGTGGGATCTGTGACT ACAGGACTGAGATGAGAGAGTTAGACTAGATAACTCCGACTCAGATTCGC ACTGGAGATCAACCCTCCTGTCAGAACCCTGCCAACTTCTGTGATGACAC ACCAGGTCATGTCCATGCAAACAGAGGTCTCACTTCTGTGGGATCTGTGA CTACAGGACTGAGATGAGAGAGTTAGACTAGATAACTCCGACTCAGATTC GCACTGGAGATGAACCCTCCTGTCAGAACCCTGCCAACTTCTGTGATGTC ACACCAGGTCATGTACATGCAGACAGAGGTCTCTCCAAGTATAGAAAAGT GAAAGCAATATTGATTCAGTTTAGCTGATTGAAGAGTTATACTTCCACTG GTCGTGACAGAGAAGACAGACGCTATGTACAATATTTACAGGTTCATTGT ACCGGGGACATTCCCCTAACTCTTTTGACAAGCACATTGAACAGTGGACC ACGGCTTAACTACTGGACTGCAACCCTTTCCAGTAGTTTTTCATAACTTT CCTCACTCCACCCAAGTGTAAAACTGGGTACCTGACTTTGGTTGGGGAGG TAAAAGTGGTGGAAGGAGAGGGTTGGGCTGTGCCTTCCAATACCGTGCCC TAGACACAGTGGTAACAACTCACTGCCTCTACAGCCTCAAAAGGGCTGTG GATCTACCTTTACGGTTGGGTACTGGTATCTAGAACCTGACTTTGGTTGG GACCATCTTTACCCTTTTTACGTTAGGTCTCATCCACTGTCCATGCAAGC AGCACTTTCTCCCGGCAGTTATGACTGGAGCAGCCCGAGTGAAGTGAAAG TGATGGGTGAGCAGGCAGGAGATCTTATCTCCCCTCTTATCAGGGGGAGC AGAGATAGTTTCACTTTCACTTTTACAGCAGGCTGAAGTGTCGACAAAGC AGTGCCTTTAATCTGGCTGCAGATCTGCAGTAGTTGATAGGGTTTAGACC CACAGTGGGGAGGAACCACCACCACTGTCAGGCTTAGGGCTTAGACTCAC AGTGGGGAGGAACCACCACCACTGTCAGGCTTAGGGCTTAGACCCACAGT GGGGAGGAACCACCACCACTGTCAGGCTTAGGGCTAAGCCGGTATCTTAC TGGGCCTGTTTGCAAAAGACGTTCGCACACGAGCGCGAACAAACGCCAAT TTGTTGCCAATGGGCATTATTTGTTTCATAAATTGGCGATTCAAAAATCT AAACTGGCAAAATGGTAAANGCTTAGGGTTTAGACCCACAGTGGGGAGGA ACCACCACCACTGTCAGGCTTAGGGCTAAGCCGGTATCTTACTGGGCCTG TTTGCAAAAGACGTTCGCACACGAGCGCGAACAAACGCCAATTTGTTGCC AATGGGCATTATTTGTTTCATAAATTGGCGATTCAAAAATCTAAACTGGC AAAATGGTAAAAATGGTCGTGAAATAGGCACCAAATTGACCGATGGGCTT CGAAAGGCACAATTTATTCTGTATAAATGAATATGACTCAGTTTCAAGTT TTCTTTATTTGAGCCTTTGTTTGTTCATGAGAAGCTCAAATCTGCTGGCA GGCCTCTTTTCATTGAGGTCATGAGGGAAGAGGTAAGGGTCAGATAAAGT ATGAAAAAGATGTGGCCCAGTGAGATGCTGGCTTTAAACTCACAGTGGTG AGTAACCTTAACAGCTGGTAGAGAGAAAGGGAAGGTGAAAGGCGGAGAGA AAGTAAAAGGGAAAGGCGGAGAGAAAAGGAAAGTGAACAGCAGAGAGAAA GTGAAAGTGAAACGCTCAGAGACAGAGAAAGTAAAAGAATGAGAAAAAGT GAAAATAGAAGGCTGAGAGAATGTGAAAGTAAAAGTAAAAGGCTGAGAGA AATTCAAAGGCAGAAAGAAAGTGAAAGTGAATGGCAGAGAGAAAGTGAAA GTGAACGGCGGAGAGAAAGCACCAGGTGCAAAGTTTAATCTTCCTCCAGG CCAATTCCGATTTTATCACTCTCCATTATCAGGGATGGGGTCAGGTGGGG TGACTGGGCAGGGAGTGTGACGCCAGGTGTGCAGTGAGAGTGAAATGAAA GGGAAAGTACTACCTGATGTGGATTTCCCTTCCCACTCTGAAATACAGGT TAGACATCCAGGTAGAGCATTACGTAACACAAAATAAACAAGCAACTGGA TAAAATTCTCTACAGAGTCAGACTTTCAGATGGCGGCCAGTTAGTCTTCC CACTGATGTCTTTCCCATCCCTTCTCCCCCAGCATTAGTTATTCTCTCCC CCCCCCATGTATTTCTCAACAGCCATCCAAGAGCATTGGCTCACCTCCCC CACACCCTCATGTATTTTCCAACACGCCCCCACCAGCATTAGTAGATCCC CCCTCCCCTCATGCATGTTCCAACACGTCCCCCCTCATTAATGAACCCCC CTTAAACATGTTCCAACTCATCCCCCCATCACTAGTGAATCCCCCCTCCT CTTTTGAATGACTTTCCCTCCGACTTGTTCCCTCATCATTAGCAAATCCC CCCAGCATTAATGAATCCCCCCAGCACTAATGTATCCCCCCTCCCCTCAT GCATGTTCCAACACACTTCCCCCATCATTAATGAATCCCCCCTCATGCAT GTTCCAATGCTCTCTTCCTACCCACTCAGGTCCCCTTTGATGTTCGAATC ACTTCTAAACGACTTTCCCTGCAACTTGTACCCCCAGCAGTAATGAATCC CCCCTCATGCATGTTCCCACACGTCCCCCCAGCATAAGTGAACCCTCCCC CCCTCATGGCAAAAAAGCTTGTAGAAAACCTATTTCCCTACTTCACACAT TTCAGTACTGTACAAAAATTCATATTCCTAATGCGACTAGACAAACCTCC CATTGAAAAACACGTCTGTTCTTTTATATCTACTATAACCGAAAAGCGAG GAGAAGTAGAATTTATCTAATGATAGTCATATTCNGGGTTTTCGGAGCCC ATTTTCCCCACCGCGCTCCCGCCGATGCCTTTAGCAACCGAGTTGTTTGT AATTAGGGGTCTGCGTGACGCCCGGCGGGATTTCTGCAAGCGGAAATTGC CGCTGAGTTTTCCTGTGAAGGTGGTTTGGGAATGAGTGTGGAAGTTCATC TGTGTTGGTTCAAAAGCCTTCGAGTGCTTTCAGATTGGGCAGGCCGGAGG TTTGACCACTCCTCTGACCAGTGGAGTTTGGTGTGTCCAACCTCTGTGTG TTTGAAAGCTCTAGAACTGTTTCCTGGCTGTTTAAGTCTGGGGCCCCCGG GGGAGCTAGTCTGTGGTTAACAGGCTATTAAACAAATTCATATGTGTTCG TAGCACAGAAGTATTTTTGAATTGGATCAGGGCAGTGAAGTTGTGGTGTT TCCAATCTCTCTCTGTGTTTGGAAACATCTCAAGTGTTCCCCACTGTTTA AGTCTGGGGATCTGGTCTGTAGTTAACAGACTGTTGAATCTGACTGACAT ACTGGATTTTTCATGGACATTCATATGTGTTGAAGAAGTGTAATTGTCTT TGAAGCCTTGAAGTGTTTTTGAGTTTGATCAGACCAGTGGAGTTGTGGTT TGAAGTGTTCCCCACTGTTTAAGTCAGGGGATCTGGTCTGTGGTTAACAA GCTATTAAACTTGGATGTCCAACCTCTGTGTGTTTGATAACATCTGAAGT GTTCCCTACTGTTTAAGTCAGGGGAGCTGGTCTGTAGTTAACAAGCTATT AAACATGGATGTCCAATCTCTGTGTGTTTGATAACATCTGAAGTGTTCCC TACTGTTTAAGTCAGGGGAGCTGGTCTGTAGTTAACAAGCTATTAAACAT GGATGTCCAACCTCTGTGTGTTTGATAACATCTGAAGTGTTCCCTACTGT TTAAGTCAGGGGAGCTGGTCTGTGGTTACAAGCTATCAAACATGCAAGTT TGTATGTGTTAGTAGTGATGAAGTGTTTTTTTATTTCCAATCTCTCCGTG TGTTTGAAACCATCTGAAGTGTTCCCTGCTGTTTAAGTCAGGGGGGCTGG TCTGTGGTTAACAAGCTATTAAACTTGGATGTCCAACCTCTGTGTGTTTG ATAACATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGAAGCTGGTCTGTG GTTAACATTTAGCTATTAAACATGGATGTCCAATCTCCGTGTGTTTGATA ACATCTGAAGTGTTCCCCACTGTTTAAGTCAGGGGGGCTGGTCTGTGGTT AACAAGCTATTAAACATGGATGTCCAACCTCTGTGTGTTTGATAACATCT GAAGTGTTCCCTACTGTTTAAGTCAGGGGAGCTGGTCTGTGGTTAACAAG CTATTAAACATGGATGTCCAACCTCTGTGTGTTTGATAACATCTGAAGTG TTCCCTACTGTTTAAGTCAGGGGAGCTGGTCTGTGGTTAACAAGCTATTA AACATGGATGTCCAACCTCTGTGTGTTTGATAACATCTGAAGTGTTCCCC ACTGTTTAAGTCAGGGGAGCTGGTCTGTAGTTAACAAGCTATTAAACTTG GATGTCCAACCTCTGTGTGTTTGAAACCATTTGAAGTGTTCCCTACTGTT TAAGTCAGGGGAGCTGGTCTGTGGTTAACAAGCTATTAAACTTGGATGTC CAACCTCTGTGTGTTTGATAACATCTGAAGTGTTCCCTACTGTTTAAGTC AGGGGAGCTGGTCTGTGGTTAACATTAGCTATCAAACATGGATGTCCAAC CTCTGTGTGTTTGATAACATCTGAAGTGTTCCCCACTGTTTAAGTCAGGG GATCTGGTCTGTGGTTAACAAGCTATTAAACATGGATGTCCAACCTCCGT GTGTTTGAAACCATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGGATCTG GTCTGTGGTTAACATTAGCTATTAAACATGGATGTCCAACCTCTGTGTGT TTGATAACATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGGAGCTGGTCT GTGGTTAACATTAGCTATCAAACATGGATGTCCAACCTCTGTGTGTTTGA TAACATCTGAAGTGTTCCCCACTGTTTAAGTCAGGGGATCTGGTCTGTGG TTAACAAGCTATTAAACATGGATGTCCAACCTCCGTGTGTTTGAAACCAT CTGAAGTGTTCCCTACTGTTTAAGTCAGGGGATCTGGTCTGTGGTTAACA TTAGCTATTAAACATGGATGTCCAACCTCTGTGTGTTTGAAACCATCTGA AGTGTTCCCTACTGTTTAAGTCAGGGGATCTGGTCTGTGGTTAACATTAG CTATTAAACATGGATGTCCAACCTCTGTGTGTTTGGAAACATTTGAAGTG TTCCCTACTGTTTAAGTCTTGGGAGCTGGTCTGTGGTTAACAAGCTATTA AACACAACTGCAGGGAGGGAGGGAAGTTTTCCATTACCGCCGCCGCTTAC GTGCTGACCCCTTTTAACCGGAATCCGCCACCCCTCCGACAAACAGCACG ATGAAAGGAAGGGATGAATCAAGTCGCTTTGATGATGACAGCACCGTGGT TAGTTAGAGGAGAGGTGCGGAAGACAACGTGAGAGGAAACCTGAGGCTTA AGTTCAGAAATGAGACAGTAAGATGTGAAGAAAGAAAGCATCTTCTTAGT GTGATGGGAGGGAAGAAAACATCTCCAAATTAGTGTGATGGGGGGATGAG ACAACAGCGGGATGAAAAGGAGAAATGAATCAAGTCGCTTTGATGATGAC AGCACCGTGGTTAGTTAGAGGAGAGGCGCGGAAGACAACGTGAGAGGAAA CCTGAGACAAACGAGACAGTTTAAGATATGGTGGAGGAAAGCATCTCCTT AATAGTGTGATGTGAGAAAGAGATTTTCAGTCTGTGGTTAGTTAGAGGCT GGGTGTGATGGGTGGGGGGAGACAACGTGACAGGAAACCTCAAAAGTAGA AAACTTTTTTGCCGTGTTAAGTGAAATATATTCGTCAGTACAGAATGAGT TCGTTAACATCAGAAGTCGTCAGAGAAAGAGGGCGGTGCTACAACTTTGC CGGTGATCCTCCGACAATGACAGACCGTTTGCCAAACTTGTTGCCAACTT TCCTTGCACCTGATTGCAGCGGGTTTGAACCAACTCCAGACGCCCGGGTT TAGGGCTCAGCTCAGAACTCACGTCTCTGATTAAAGCTGTGCCTTCTGCC CGAGGTTCAAACAACAACGATCTGTCTTTCATTGCCTCTCGGGGGCGAGG GCGGTCATTTCAGCTAGTGCCTCTCTCTAGTCTTGGGGATATTTGCAGCA AATGCACTCATTTGAACTAGTGGGTCTCTCAAGTCTTGGGAAAAGCTAGT CATTTAAACTAGTGGCTCTCTCAAGTCTTGGGAAATCCAGACATTTGAAC TCGTGGCTCTCTCAAGTCATGGAAAACGCACTGTCATTTGAACCAGTGGG TCTCTCAAGTCCTGGGAAACGCAGATATTTGAATTCGTGGCTGTCTGAAG TCCTGGGATATCTGTCCTTAAGTGGACTTCTGTAGGACTCGGGGTCCGTA ATGGCACTTCAGCCGGATCTCAGATGAGCTTTTCACGGCAAAGTGGGAGT TTGGGCCGCTTTTGTTCCATTTTGTTCCAGTGAAAATGTGCTTAGCTGGA ATAACTGGGCTGGGCAATGTGGGATCTACATGGGGGGCTGGCCTGGGGTG TGCACAGCATGGACAAGTAGGGGGGTCTTGGGAGGGGGTACCTGGGAGGG GTGTCTAGGGAAGGGGTGCCTGGGAGGGGGTGTCTTTCATGGGAGGGGGG TGCCTGGCAGGGGCTGTCTTGGGAGGGGGTGCCTTGGAGGGGGTCATGGG AGGGGGCACCTGGGAGGGGGGTGCCTTGGCAGGGGCTGTCTTGGCAGCGG GTGTCTTGCATGGTAGGGGGGTGCCTGGGAGGGGGGTGCCTAGGAGGGGT TGTCTGGCAGGGGGTATCGGACACCTACCTAGAAGGGGCATTGCTGTGTG TGTGGCATGTGCAATAAATCTAAGCCGTTGTTCTGATCCTTTAACCATAA CTCCTCTGAAGCTGTTGTTTTGTGATCCTTCTACATTTATCCTCCATAAG CTGACAGTTATTCTGACACAAATCCTACCTCTGCACAAATCCTACCGCAA ATTCCACCCATCCAATCATTCCTGCCAGTGGGCTTTCCTGAATCTGCTCT CCTGAGACCTCACACAAACTCCAAAAGTTGAGCTGCTGCCAGGCCAACAA GATTAGGCCCCCATTTGCTGATTATTTCTGCCAATGATGCCGCTTTTTGA TGGAGATTTGTAAGTTTTCGTTGGCTTCTCCGTTGATCTGTCAGCGTCCG TATGTTCAATCATCTCTGATCCAATTCTGAAACTCATCATGATTTACAGG CGTCTGTATAACTGTGGACACAGTCAGTGTGTGTGGGGGGGGGGGGGGAA TGATCTGGTCTTTTCAAACAGTTTACATGAAATTGATGAAAATGTATTTT CAAAAGCTTAAAAAGACAAAGCTCATAAGGAAAATCAACCACCTGTGCTC CCAAACAATAAGTGAGATAGAAAAAGGTTTAAAGCTGGAGACAGCCCTGT ATTGGTCATACATGCATATATGCATATATCACAACACAATGCACATTTTC ATGCAAGCTCATCTGCATGTGTTGGTAGTAATCATAGTACAATGCTAAAC TTTCTTCTTGAATATCTGAGTGTTGAGTGTTGGAAGAAAGTTGAGCATTG TACTACAATGCACATTTATTTATTGCACAGAACACACATCTCTACACCAT CTTCACACAGACCAGAGATGGGATCGGTTGCTACACCACTAAGTAGTGTC ACTTCAGATTAACAAAGACATTCCATCTCACAAATCATTTTCATTTGTTA CGTCAAATAGCTTTACATCATTCTGCTTCAAGACTCCGTTCTGTAAAATG AAACGTACCTGCCAATAATAATCAAATAATTTACTGTGCTTGTAGTAGCT GTAAGGGTATGGAGCGTTTATATATTCAGTAGCAGTTTAGATGTGTACTA GTAATTTTTTTTTTGTTCTCTCAGATTTTTTGACAGACCAGGTAAAATTT GTGTCTGTCCCAACACGCAAATTTCGGGCTGGTACCTCAGTTGATACGGA ATACTCCGTGTTGTATTCCATATGTACACATGACGAATGCATATTATTAA CTAAAGGTGCATGTATTCTGCGCAATGGTTGATATACAAAGTGTATGGTA TATACATGTATGTCCAACTTGTGGTATATACATGTCCAATGCATATGGTC CATGTACATGTAACTTGTGGTCTGTGTAATGGTACATATGCATGTATTGC ATGTACGTCCCCTGCCTCCCAGTCCGACTATGTTAAAGTAAAGGGCATCG CCGGCTTAAGGCTGAGCTCCGAGCATCGATCTGCGGTATATTTGTAGTCC CTGCGTTTCCCCTGATTGGGCTCATTAGCATATCAAACGGCTTCCCCTCA GATATGGGAGAGAGTCTAATGGTGGCCATTCCCACCGCCAGGCCTGTCTA TAACTTCCTGTCCCGGCAGTGGCCTGTGTATTCCAGTGGTTAGCGGCCCT GCCTCTGGAACTAGAGGTTACGAGTTCGATCCCGCTGTGTTGCTCACCCG ACATGCACACTACTGGAAAGGGTCGCAGTCCTTAGGACAGGACGTTAAGC CATGTTATACTGTTCATTGTACATGTCGAAAAGAGCTAGCGGAATTTCCC CGGTACAATGGTTCGGTGTAATATAACCAGCTGCTGCCGCGCTGCGTGCC TGCAAAGCTGGTGTGCTATGCCGAATGGCGGTTATACATAGGTCTGTCTT CTCTGTCACGACCAGTGGAAGATTAGCTCTTCTGTGAGGTAAACTGGATC AATAGCACTTTCTATCATTCCTTTCTTGTGTAATGATGGGCGCTCCCAGG AGGCCAGGCTATCCATAACTCCCCCTGGGAGCTTAGATGCGGAAGGTTCG ATTTAGAGAACAAAAGACACATTTTTGCCGGTCGGCACTCTTTTGGAAAC TGGGCTTAGGCCACAGGAAGTTTATTTCTTGCTTTATATCAGACATAATC TTTTATTTATTACTACTTTTATTTGCAAATTCATGCCCATAGGCTAATTG CAAGGTTACAAACAGTAGAAAATGTAGCAAGGGTACAAACAGTATAGAAA CATTCTAAATAATTGTAGTATCAACTTGAAAACAGAGCCTGAAAGCTGTA CCTTGTGACACACAGTTTCATGGAGTGATTGTGCATGTAGTAAGATGCAT GTTTTCCTCCCAGCTTTCTGCTTTCATCTTGACAACTTGTGAAATTTTTA TTTCCAAATGTCCAAGAACCGAGGAAGTGAATTGGTGTGGCCTAACTTCC TGTGAAAGCCCAGATGTGGTTTTCGGATTTAAAGAACAAAGGACGCATTT TTACCAAATGACAGAATTCTGGAAACTGGGCTGGGGCCACATTAATTTTA TTTATTGGTTCTTGGATATAAAAGACAAATTCTAAGTTTGAATATTAACT TGATACAGAGCCTGAAAGCTGCACCTTAAATTGGTATACCGGTACATACA GTTTCAGGGAGTGAATGTGCATAAAGTATGAATTATGATGCAAGTTTTCC TCCCAGCCGTCTGCTTTCATCTTGACCACTTGTTAAATTTTTCTTTCCAA ATATCCAAGAACTAATGAAGTGAGATTTGTAGCTTATGGCATGCTGCTAC ATGTATTTGAAAGCATGATGCTTATTTGTCATTCCATGTAGTGACATGTA CCTATGATACAATCAGACCAAAAAAATGAAGTAAATTGGTGTGGCCTAAC TTCTTGTGTGAGCTCAGATGTGGATGTTCAGATTTAGAGAACAAAGGACG CGTTTTTGCCCAATGGCAGTCTTCTGGAAACTGGGCAATTATTGAGAATT GAGATGGAAGTTTTTTCTTCTTCTTTTTGCTGCATTCAATGATTTCTTTA TGCAATTATCTTATCAGTGTACTCATCCAAGCAGAAACACAGCATAAAGC TGCCAGATCGGGTACGTCATTTTTTTTAGTAACTGGCAGTGAGCAATCCT CAACTCATTTCCTTAAAAACCACTAAAACCATAAAGCCATATTAATGTAA TACTCAGTAGGTCTTGCCCCTACCAATTTGTGTAAGATAATCAATGTTGA AAGTAGATTATATGAGTAGATTTTGATGACCCTACACTGACGACCTGTCA CACCTAACCTTCGCACATCTGACTGCAACCATTGTTGAGTGCTATTTAAT GAGAATGACCCTACTGACAATAAGTTCTTAAATAAACTATCATAGATAAG AACTCATTGTCAGTAGGGATTTGTCATCTATTGGTTTGGCTGTTCAGCAC CCACCAACAGGGCTGCCCAACTACCTTTAAGTTAGTTCTAGGACCCCCCT CCTCTAGGGACTTCTCCGATTGGCCGAGATATCCACCCTCAGCTTCATCA TGAGCAATCTCCATCATCAAACCCAGCCTCATCAAGCTCAGCCTCCGTGA CCCACTTTCCTCCAGCTGATGGAGGCTGCAATTAAACCTTTCAGTCCCCC ATTTATTTCGACATGCCGCCGATGCTGTAGCATTTAGAGCCGCTGATGTT GTAGTGTTTAGAGCTGACACAGACATGATGTAGCTTTGTGTGACAGGTAG TTCAGTGTAATATAACCAGCTGCTGCCGTGCTGCTTGCCTGCAAAGCTGG TGTGTTACGCCTAAGGGCTGTTATTCCAGTTATATAGATACAGAAGCTGA TAGGGTTCATGTATAGACGTACAGTGATGATGATGTAGCATTGTAGCAAA GTAGCATTATTTTCCACTGACAAACAACTGGTAATGTAGTATAATTTTCA GTGACAAACAGCTGATAACGTAGCTTTATTTCCACTGACAAACAACTGGT AATAGAAAAGAACTTCAATGCGCGACAATAATAATGTAGCATTATTTTCC ACAAACATACAGCTGATGATGTAGCATCATTTTCAGACAAACAGCTGATA ACGTGGCTTTATTTTCAGTGACAGGCAGCTGACAGCGTAGCTTAGAGGAA AACAGTTGCAGGCAGTTTCTTGAACAGGACCTGATCGTTGCATTTAAAGC TAGAAGTCTGGTTCATTACCAGACAATGGGACTCAGGGGGGGTCTGTTTT AAGTAGCGCTGTGAACTTTTTGGTGTAAATTCCCTGTCAATAAAGCCTAC ATATAAACTGTTCCTGGAATCTGCTCCTGGAATCTGTTCCTGGAATCTGC TCCAGCCAGTCGGATATCGGATTCTGCTTCATACAGGCGATACTGTCCAT ATCACAGTCCCACACACTATTTGAGTAGCGCTGCGAGGCCTGTTGGTGTG AATTCCCTGTCAATAAAGCCTACATATAAACTGTTCCTGGAATCTGCTCC TGGAATCTGTCCCAGCTAGTCAGGTTGAACAGGAGCTGATAGTTGTATAT AGAGCTAGAAGCCTGGTTCAGTACTAGACAATGGGACTCGAGAGGGTTTA TTTTAAGTAGCGGTATGAACCTGTAGGTGTAAATTCCCAGTCAATAAAGC CTAGTACATATAAACTGTTCCTGGAATCTGTTCCTGGAATCTGTCCCAGC CATTCAGATATCGGATTCTGCTTCATACAGGAGATACTGTCCATATCACA GTCTCACACACTATTTGAGTAGCCTGTTTGTGCAAATTCCCCACCCAATA AAGCCTACATATAATCTGTTCCTAGAATCTGTCCCAGCTAGTTGGATTGA ACAGGACCTGATAGTTGTGTTAAGAGCTGGAAGCCTGGTTCAGTACTAGA AAATGGGACTCAGGAGGGTTTATTTTAAGTAGCGCTGCGAGCCTTTTGGT GTCAACTCCCCCCCGTAGTACATATAAACTGTTCCTGGAATCTGTTCCTG CACTCTGTCCCAGTCAGTTGGATATTGGATTTTGCTTTATAAAGCAATAC TGTCCATATCACAGTCTCACATGCTGTTTAAGTAGCACTGTAAGCCTGCT TGTGTAAATTCCCCGTCAATAAAGCCTAACATATAAACCGTTCCTGGAAT CTATCCTGGAATCTGTTCCTGGAATCTGTCCCAGCCAGTCGGATATCGGA TTCTGCTTCATACAAACGATACTCTCCATATCACAGTCTCACACGCTGCC CCGCGTCAGTGCAATAAAACATGGCACCAATTCCCAGTCACTGATAACAG AAGCCTGGGAGATTTTGATCTGATTTATTTATTTGGCTGTAAAAAAGCAC CATAACAAAACCTCAAGGAAGGCTATTACTAAGGGTTAGCCCTGTTAACT GAACATTATACGAAATCCAATCCAATCTTTCACAAAGCACATTGAGACGT TTTTCTCCCTCAGTCTCTATGAGAGCTGTACAAGGAAGGCAGTGGAAGAT GAACTGCATTTTATCTGTTAATGTCCATTATACTATTCTGAAAGAAGTAG ATTTTTCATAGAAATCTTTCAACTTTGCCCAAGCTTTTTATACCTTACCA ATCAACCTGTTTATTTTCAAAACATTGGACAATTCGCCTTCCACTACATG TATAGAAAAGAAGTCAAACCCTTCAAATAGCTTATTAGTAGAAATAGATT TAGAATAGTTGTCATTTTGCTCTTAATTCATTGATATATTCCTTCTCTTT AAGCATGCACACGTTGTATACCAGTGTTTTGCTTGCTTTGTTTGCCATTA GCCTCGGGCATGGTTTTGCAATAAAGTCCATCATGTGTTCCTGCCTGCCC TGTGCCAGGCTTGCCTGGGTCTGAATCCCGCTTCTGGAAGTGATTGAATA ATTTCCCCATTCATCAATCTGTGTGCTGTGATAGCCGAAGTAACCAACTT TGCCCCTTAGAAATGAACGAGAAAAAGCGTTATTGGCACAACAAATAGTG CAGTGACTTCTGTACGGCCAACTAAAAACTAAAAAAAAGATATAGGAAAT TAATCTTACAATTCTACTTTTAACTTAACAATAGTGGCTAACATAGTACA TAATATCCTAACACAATCAGGTGGGGCTTAACGCAAGTTTCAGTATCTTT CCTGATAACAAAGCAATATTTTTTGTACATACCTATTTTTGCATTGTAGA CGCCAAATGTAAAGATATAGTCAACTCTATTGGTGGTCTTGAGGTCTTTG AAATCTGTTGTACCTAAAGAAAGAAATGTGATGTCAAACACAGGACACAC TGCTTTGTGATACCGCCAAGTTATATTCTTGCTTCACAAACATTCTAAAA TGAAAATTTAGCAAACAGTTTGCACCAAGGTACATACTTTCCCCTCAGAC TCTGTTTTCAGGTCGATCTTCGAGTTTAGATGTTCTAGTATTGATTTCTT CTGCCAGCTCATTCTAGTGACGCTGAAGAAGAGTGATGGATGTCACTCAA AACATCTGAAAGCAATCTTCTTATCTTATTTAGTTATAGAGATTAAATTG TCTTCAAGATATTGCTTACCAAGATGTCTAACATTCATCAATGTGCTATC AAGTCTAGAATTCCATTTCTTTTAGAATACGCGAATCAACAGATTAGGTC GGTGTGGCCTTCCCACCCGCACATAGCGCTGTGCTATCAGGAAATGTAGG TTTGTGATAACCCAAAGCACCGGGCAATTTCCCCCTTATCTGAGTCCACT GAGACAATTTTAGGAGGTTTTCAAATTTGATAAAGCAGGGGGACACATTC GTAACTGCCTCCCGGTTGTGGAGCTATTGATATAAACAGAGCCGGCAGAT CTAGCAGGTTTGTGTAGGATATGTTTTGGGAACATTGAGCCATAGCCGAT TCCCATCCACTGTACAGCTAACTGTCACTAACAGCTAAGACATGTTTTAC ATGTGATTGCATGGCCTACAATTCTCTCTGTGGTTATACATGACAGAAGT TCTGAGAGAGAAATGGTTTATTGTTTCATATTAAAAAAATCCATTACAGC ACAAGTGCTGAATTGCAGCCTTTGTACAAATGTCCATCTTTTACATGTAC TCAGGACTTAAAAGGCATTACTCATTAAATATCAATGATTCTGATATTTC CTGTGCCCAGTGCACTAGTGGTGTGATTATAGAAACCATTCATACATGAT TATATCTCCCCCTAGGGGCCTCCTGTGTCACGGTTTTTAATCATTGTTTC ATCAGTTTTTCTGTACGGAGATTAGTGAGAAACGGGCAATTATGTGGTTT TATAAGAGCTTCCCGTCGGCAATCCTGCCAATGTGATTATAACAGTTTGG GCTTTACTCGATTGTCTTGAGATATGCTCCCCTGGCTGCAGATTTTTTCA GTCTGAAGACAATTCAGTCTCTACAACTGGAACAAATTTGGAGATAACTT CCAGACATTTTGAGTGACATCCATCACTCTTCTTCAGGGTCACTAGAATG AATTTACAGAACAAATACTAGTTTGTCGTACTGGGAAAAAACTGTTCGAA AATGTCCAAGCTGCTGTAGTTTGTTGTACAAATTTCTGGGCTGCAGTGAG TAGCTTAGATGAGAAGTGGACCATGGCTGGCTCCAGGACCCGTCCCAGGA CGGAAAAGTGCTCATTGGGTCGGAAAAAAGGCAACCCTTTGTTCCAAACA TTATGACATGAAATTGAGAAAACTTTATTTTTGTAAGCCTAAAATGAATA TGATGAAAATAAACAGTGTGTGCTCCCAAACATTCAGTGGGACAGGAACA TGAATTGAAGCCGGAAACATCCCGGAAGGAAACTATATTAACTTGAAGAT ATATTTAAATTATGGTTTTTATTGGTCAGAAATTACCAGTGCAATGCTTT CTAGTGCTGAATTGGTGCAGGGTTTACAATCACATAATATACATTATCTT TGTATTCCCTGATAGTCCTCCCATGTTTTCTCCTGAGCTGGACTGCAGTC CCAGCCAGAGGTCTATCAGGCTAGCAGGGTTATGAAGTGGACTGTCTATC CCATCTAGAAGTCCTCCCATCCAGAGCTATTATGACAGATTGAGGTTTAG TTGATCGATAGCGGTCCTCAGAAACGGCCATTTCCACCTGCAAACAATTG GGGCAATTATAATGACCGCTCGCCGGCCGGCATTTACAGCGCATAGATTC TGCCCCCGCGGCGATCGGTCCGGTATCTGTCTAAGGTTTCCGGCAGGCTG CAATACGGTTATTTTTGTGCCATCTTCTGTGTTCATTTAAAATATTCCTT GGCACTTCCTCACAGTTTTTATTTTCAGTGCCTATTCAGCTATTTCTGCA GTTAAACATTTGGAGCCAATAGTTTCTGCCCCTGCAGGGATTGGTCCGGT ATCTGTCTAAGCTTTCCAGCAGTCTCCTATAGTGTTATTTTTGTGCCATC TTCAGTGTTCATTTGAAGTCTGTTCTGAAATATTCCTGGATATTTCTTCA CAGTTCTAGCAATGCTATTTACAGTGTCTATTTAGTTATTTCTGCAGTTA AACATTTAGAGCCCATAGATTCTACCCCAGGGCTGTATGTCTGGTATCTG TCTAAGCTTTCAGGCAGTTTGCAATATGGATATTTTTGTGCCATCTTAAG TGTTCATTTAGAATATCCCTTCGTACTTCCTCACAGTTCTAGCTTTGCTG TTTTCATTGCCTATTTAGTTTTTGTTCTAAAGTTAGACATTAGAGCCTAT AGATTCTACCTCCACTGCTATCAGTTTGGTATCTGTCTAAGGGTTCTGGC AGTCTTTGATAAGGTTATATTTGTGCCGTCTTTTCCGTCATTATGTTTTT GGTGAGGTTCGAGCATTTGTGTGGACGTTAACACGAAATTTGAGAATGCC TGCTAGTGGGTGTTTTTTTTATTACCTATGCTATAAGGTTATGTTTTTGG TCCTGTTCATGTGTCTGTGTGGGTGTGATTATGAGAACTCGAGAACGCCT TGGTCGATTCTCTTTTATATTTGGCATGGGGTAGGTCTTCTTTGCTGTTG TTTTTATAATTCTTTAGTGTTAGTCTGCTGTGAGCTCTGTGATATTCCTT TGATATTTCTAGCTTTGCTCTCTTCAGTGCCTATTTAGTTGCTTTTCCCA CCTTTTAGTTTTTAGTTCCAGTTGTACTTTGCTTGCCTGACGTTTTGTTT TAAGCTCAGAGTGTTTTTTTTTTCATTTGTGCAGTGATTTTTTATTCTTA CAACTGTGCATGAGTACTTTATAGTGGTTAATTACAGCTATAACTGTGCA TCACTGCAGTCACTATGACTATACAGTTATGCATTTGTGCGGCGATTTTT CACTGTTATAAATGTGCTTTCCAGCCGTGTCTATCTATGATCATAACTGA GTGTGTCTGCGGCTCTTATTTACAATTGTAGCTGTGCATTTCTGCTGTGG TTATTTACAGCTATGGATGTGCCTACCCTGCCATAGCCTGATATATGACG CCATTTATGCACCACTTCTTTTCATTCTGCTTCACTTAGCCACAATCTGG CCTGTAAAAAACATTCTCTCCGAGATTTCTGGATACAGGGAGCAGCCATA TCACAGCCACACGTTATTCACATTACAGATAGTGTGTACAAATGTATGTA TTGTTCCTTCATACTTGTAGATTCCTGAAAAATGCCTCTTTATAGACATT TGGTTTCCCAACACCACAATCTGGGCTGTAAAAAAACATTCTCTCAAAGA TTTCCGGATACAGTGAGCAGCCATACCACAGTTATTTACATTACAGATAG TGTGTTCAAATGTATGTATTATTCTTGCAGATTCCTGAAAAATCCCTATT TTATAGACATTTTATATACATATCATAGCCCACAAGTTATTAACTTTACA GACAGCATGTAAAAATGTGTCATTCATCCATAGGTGCAGTTTCCTGATAA ATTCATCTTTTTATAGGCATTTGCAAACAGCACACACTTGATTATAGGCT GTACAAATGGCTTCTGGAACATGCTTTTATCTGCAGATTTGGGGTGGCAC CGGCTAATGGAGCCTCGGGTGCTTAAGCCATTTCATCGCAGATTTCTGAT ACGCCCCATCAAACGTGGCGTTCTGACAGTGTGCTTCAATAGCGGAACAT TAAACATTCAATACACAGTAAATTCAGGGTTAACCTCTCCGGAATACAAT GAATAAATGCAGAACTCGCAGCGCTTNTCTCCGGAATACAATGAATAAAT GCAGAACTCGCAGCGCTTTGAGTCAATAAGCAGGACCAAATTCAGTCTAT CTGAACTTGCTGTGAACTGGAGATTGTGTTGTGCCTCTCCAGGGTGCTGG AGTTTGTGTTATGCTGTTTGAACAGTTTTCCTGAAGAGTGGAGATTGCTC GGGCACCTTGAAGTTTCCGTTGTGCCTCTCCCGGGTGCTGAAGTTTGTGC TTGTTTGTTTGTTTGAACCTTTGTTTATTCATGATAAGCTCAAATCGGCA CGCAGGCCGCTTTTCATTGAGGTCATGAGGGAAGAGGGAAGGGTCAGATA CAATATAACAGAGATACACAGTCATTTGAGTCCTAATAACTCTATCAACA TAATCATTACATGTTTATGGTACAACAATATACAATTTCTACAACATACA ACATAAAGTAGGGCGAAAGCTGGTTCATGGTCCGTGTCCGTTCGTTTAGT TCATTTCCGTTACTTCNCCGTTCCGTTGCTGTGCTGTTTGAACAGTTTTC CTGAAGAGTGGAGACTGCTCGGGCACCTTGAAGTTTCCGTTGTGCCTCTC CCGGGTGCTGAAGTTTGTGCTTGTTTGTTTGTTTGNTCATTGTGCCTCTC CCGGGTGCTGAAGTTTGGGTTATGCTGTTTGAACAGTTTTCCTGAAGAGT GGAGATTGCTCGGGCACCTTGAAGTTTGCATTGTGCCTCTCCATGGTGCT GAAGTTTCTGCTGTGTTGTTTGAACAGTTTTCCTGAAGAGTGGAGACTGC TCGGGCACCTTGAAGTTTCCGCTGTGCCTCTCCCGGGTGCTGAAGTCTGT GCTGTGTTGTTTGAACAGTTTTCCTGTAGATGGAAAGCTTCAGGAGCACC TTGAAGTTTCTGCTGTGCCTCACCTGGGTGCTGAAGTTTGTGTTATACTG TTTGAACAGTTTTCCTGTAGATGGAAAGCTTCAGGAGCACCTTGAAGTTT CCGCTGTGCCTCTCCCGGGTGCTGAAGTTTGTGCTGTGTTGTTTGAACAG TTTTCCTGTAGATGGAAAGCTTCAGGAGCACCTTGAAGTTTCTGCTGTGC CTCACCTGGGTGCTGAAGTTTGTGTTATACTGTTTGAACAGTTTTCCTGT AGATGGAAAGCTTCAGGAGCACCTTGAAGTTTCCGCTGTGCCTCTCCCGG GTGCTGAAGTTTGTGTTGTGTTGTTCGAACAGTTTTCCTGAAGAGTGGAG ACTGCTCGGGCACCTTGAAGTTTGCATTGTGCCTCACCTGGGTGCTGAAG TTTGTGTTGTGCTGTTTGAACAGTTTTCCTGAAGAGTGGAGACTGCTCGG GCACCTTGAAGTTTGCATTGTGCCTCTCCAGGGTGCTGAAGTTTGTGCTG TGTCGTTTGAACAGTTTTCCTGTAGATGGAAAGCTTCAGGAGCACCTTGA AGTTTCCGTTGTGCCTTTCCTGGGTGCTAAACCATTAGCTGTTATAGACG TGCATCTTGCCAGAAGGCTTGTACTTAAACAGACGCCTTGATGATATTAC AGCAACTCGGTTGTCGAGTGTTTGCCCCTCCCAGAGGGGGACAATATCGA CTGTCTCAGCCGTTTTAATCTGTCCTCACCTGGAGCGACGACATTAAGTG GTTTGGGATGTGGAATTTCACCGCCTTATCTTCAAAATGTGCCTGAAAAT TCCACAATCTGGAGTCCCCACATGGTTCAACGCTTCCTGGTAACGCTTCC AGCTGCTAACCTGTTACCGTGGTTACTGTAAACAGAAACAATATTAGTAG AAGGGACCAGCCTGTCACCATGGTTACTGTAAACAGAAACAACATTTGTG GGAGGGACCAGCCTGTCACCATGGTTACTGTAAACAGAAACAACATGGGG TTGTCAAACCTTAATTGATAATGTTTAGCCATGAATCCTCCTCAAACAGT CAACAAGCGATTTCATATTTATGATACTTATACATACAGTTCATGCACAA GTCAGCATGTATCATGCACATTATGTGATTCCCCTAGTTGCTAACAGTCC TCAGCAAATATATGGGATTGTTGAAATGTTGTTGATGCCATAGATTCTCA TTAAACAGTCAACAAACATTTCATATTTGTGACACATACAGTTCAAGCAC AAGTCAGCATATATTATGCCTAGTTGCTAACAGTCCATAGCAAACATGTG GGGTTGTGGAAGTCCTGCTGGTGTTAAGCTATAGATCCCTCCTGAAACAG TCAAGAAGCAATTTCATATTTATGATACATGCAGCTTGTGTACAAGTTAG CATATATTATGCACATTATGTGATTCCTAATAACTAGCAACAGTCCTTAT AACAAGTGTTGTTGAACTCTTGTTGATGATGTTTAGCCGTGGATCATTCT TAAAAGTCAACATGCAATTACTTGCTGTGACACATGCAGTTCATATATTA TGCGCATTATGTGATTTCCCTAGTTTATTCATCTATTGTAAAATGCAACA GTACATTACACCGACTCTCAAGGCAGCGTAGCTGATACTGGAGAGTCGAC ATGTATGGACAGACAGATACATAAGCAATGGGAAATTTACACAACACAAG TTTAGATACAATGCTACATTCAATCAATAAACATCAGCCTACAATCCAGT TTAACATTGTTGAGTCATATGATGAAAATGCATTAGATACATTATTATAT ACAGTCCTTCGCAAACAACTGGGGTCGTTGAACTCCTGTTGATGATCTTC GTCAGGTGCCTTTTTGATGAGTCCCATCGGAGCAGTGAAAGTAAATCTCC CCTTACTGCTCGGTTGTGTTGACGTCAGCAGCGCTGATGGTGAAAGTGAA AGTGAAATGTGCGGGATGTCCCAGATGGGTTTCGTTCTGCCTGACTTCAG ATCAGGTTTCAGGAGGAGGAAACTCGTCATGTGTGATACACTGTTCCCCG CATCCGTGCACTTTCACCACCACTTTCACTACCTGTGTTCTTACCTGTGC ACTTTCACTACCTGTGTTGTGTTTGTGTTACCGGTTTGTGATGCATGTTT GGGTTAGTTTTCTGTTGGGTGGTATTTATTATGCCCACTTCTAGAGGTAT CTGTAGAAAAGTGATATCTATAGTCTTAGGAAAGAGATATTTGCAGTCAA TAGTAAATCAAAGTAGATGGGTAGCTGCTCTGAGACATTTTGACAGCAGG ACTAAAATAGTGCACACAAATGAAGCTAGCATTTGGTGGTATCAATTGTT CTTCTGTCTACTTGATACCTGTAGTCTTAGGGAAGTGATATTTCCAAATC ATTTTGACAGGCAGCACTTACTGGTGTGTTACGCTGAAGAGCGGTTAAAC CGACTGTACAGATACAGATGCAGATAATTGTGCCTACTGCAGTTCGCAGA CATGAATTGATAATGCCTATAGTTGAGAGACATTCCGACAGGCAGCACTG AGTCTAAAGTAGTGAGGCTGATGTTCGGTGGTAATAATTGTGCCTACTGG CTACCTGATATTTGTAGTCTTAGGGAAATGATATCCAAGTCTTAGAGAAG TGCTATCTGTAAGTCTTATTGAATTTCGAGTGTAGGATGTCAGACATGGA TTGATAACTGCTTACTGTAGAAGAGACATTCTAACAGCAGAACTAACTCC AAAGTAGTTCCTGGCAGTGTTAGTTTTATGTATGGTATATCTGTAGTTTT AAGAACTGATATCTATATTCTTAGGAAAGTGATATCCAAGTTTTAGAGAA GCGATATCTGTAAGTCTTAGTAAATTCCGAGTGCGGATCGCAGACATGGA TTAATAACTGCATACTGTTGAAGAGACATTCTGACAGCATCACTAACTCC AAAGTAGTTCCTGGCAGTGTAGTTTTAGGAGCTTATATTTGTAGTCTTAG GGAAGTGATATCCCAGTCTAAGAGAAGTGATATCTAATTCCTAGTAAATT TGCAGACACAGACTGATAACTGGGTACTGTAGAAGAGACATTCTGACAGG CAGCACTAAGTCCAAAGTAGTTCCTGGCAGTGAGGCTAATGCGGGCAGAC AGTGATGGAATGTCGCAATTTCCAAATCAATATCAGAAACTGCGTCTGAG ACAATAGAGAAGATGGAGATCATTTTACGCAGTCTGTCTCGGGCCACACC AAGGATTCGGTGGTTCTGGGATGCAGAAAAAATAATACTGAGCTACAGGG ACACTGAAAACAGAGTCTAGCTTACAAAAATCCATATCACTACTAAAATC AACAAACCCACTTACGATGAAAAACGTGGGTCTCTTCATTTTCCACTGCC TTCAAAAAAGAAGTCAAACCCAACCATAGTCAACCTTAGTTAACTTAGAA TTTTGACAGTAGTCTAGATAACTATTTTTGATTCCCATGTATTTCCATGT ACTTGTTTGTCTGCAATTAGCCTTCGGGCATGAACTTGCAATAAAGTTAT TATTATAATTAAAGGGCCAGGTTGATGCCTTAGTGCACACAGTTTAGGTA CTTCTCGTAATTGATAGATCACCAACTTGTCTTGTTTACATTCATTTTTC TTTTATCTATTTTGTGTTTATTTATGTCCGTATGTTGTCATTGTATCTTA CTCTTGTTTCATATTCATGTATTAGAGTAGAGGGCATTACATAAGCAATT TTATGTCATGCCTGGGCCTGATACGGGTGTTCCGGACCGTGTGATAACTA TCCGGATCACATAGGGTTCGGGAGGGTTATCACACAGGCTTCCATAGAAT ATTTCGAACGCATTTCGAACGCGCCGGCTGTGCGGCCGTCGGAAATTCAA ATACTGGATTCGGAGATTGGAATCAATGTTGCTACACTTTCTTGTTCGAA GACACAAAACTCCCTCAACTTCTGGCGCATTCCGCATTGAGATGTATGTT ATCTCGGGTGAGTATGACCAAGGTATGACATAAATAAAATACAACACGTT GTATTCCGCATCACCCTCGGTCCCAGCCCTCCCGCGGGTCGGATCGCCCT CCGGCCTACGGCCGTCGGGCGATCCGACCCGCGGTCGGGCTGGTACCTCG GGAGATACGGAATACCCCGTGTTGTATTCTATATGTGCTGTTTGCCCTAT ACTCTTAAAATACAATGTGAATGAAATAAGATAAACAGTTTATACAGCTC AGCCCACATTGCAGCCAAATGCTGAATCACGTAGGGAAACTTTAGTAGGT AAAGTCTTGCATTAAAACAATGACTGTAGTGATAAGCCTGTGCTGTTGTT CGTAGCAGTCTGAATCCCTGGAGCATGAATCCCCAGGGAGCTCGTGACAC CGCGGATCACAAACCATCTGTTGGCGCTCTTTAATATTCCGAGATTCCGA TCTGCGGAATTCCTCCCGGAAACTCGACGTGACCCCCAAATAGACGCTAA GCTATCCTCCGCCTGCACCGCGACCTCTGACCTCGCTAGCAAATCGATAC GTTTCATCGGCATGGCAACGGGACATCCCGCCGGCAGACGGCTCTGACAG GCTGGGCTGATAGTACAACCTGGGGGAGGCACTTTCACTTCCTGTTTACC TGGCTGGGGGGGGGGGGAACTTTCACTTGCATTTTACCTGGTGGGAGGGG GCACTTTCACTTTCTCTTTACCTGGCGGGAGAGGGCACTTCCACTTTCTC TTTACTTGGCATGGGGGCACTTTTACTTTCTCTTTACCTGGCAGGAGGGG GCACTTTCACTTTCTGTTTACCTGGCTCCCTGTATTGCTGTCTGGCAGTG GAGAGGGAAAGTGGTCCCATTACTTGTGCGAGAGTGAAAGTTAGACAGAC GGCCGGTCGCAGCACCCCTAACTGCTGCCGTCCCCAGCCAAGCGTGGCCC TTACGAGCCGGCCAGGCGAGCGGCCGTGCGCGGGGAAGTGGGGAAAATTG GACGCCATCTTTCATATCAGGGAAAGTCCTGAATGTCTCCAGCCATTATA TTTCAGGCTGGACTGACGGAGGAAATGAACATTTCCTGCTGCCCGAAGCA TAACCACACATTCATAACCTCAGTTGTGCACCTTCTCAGGCATAACCGCA CATTCATAACTTCCCTGGTGTAGATTCACACACATCGGGGAACATCTCAC TGAATCTGAGGTGTGACTTCCAGCTTGTCAGGCACGCGGCTCAGCCGGTT ATATAACATCAAATGGATAGTCAGACCTGCCCTAAGCATAACTTTTCATT CACAACTTCCCAGGTATAAGCTCACGTGCACATGGCCACAGCTGGTTATT TAACATCAGCCCTGCCCTAAGCATAATCTTATTTTACTTTCATAACTTCT CAGACACGTGGCCATGGTTAGTTAGATTACAGCTGGTTATGTAACATCAA ACTGTGTGTCAGCTGTCAGCATGTATTACTTCCAGCTTTACTTTCATCCA CCACATGTAAGTGGTGAGACTTCTGCAGTATATGTCAGGGTTCAGCTCCA CTGTGGGTAACGGGCTTGGAAAAAACCTGTCTCTCTGTGTACTAGTCGTA GCACAGATGACAAGTGAAAGTTTATGGTTCTGTACACTGTGTGTAAGTAA TGAGATACCTGCAGTGTGTTCTGTAGTCCTTACATTATCATGGTTTATCC CCACTGTGGGTAAAACCTTGTCTCTCCTTGTACTAGCTGTAGCACAGATG ACAAGTGAAAGTTTATGGTTCTGTACACTGTGTGTAAGTAATGAGATACC TGCAGTGTGTTCTGTAGTCCTTACATTATCAGGGTTCATCCCCACTGTGG GTAACGGGCTTGGAAAAACCTTGTTTCTCCTTGTTTCAGAGCTGACAAGT AATTTCAAGTTTCTTATTTGTTGAGTGGCCTTATAAGTACAGCATAGAAA GTTGTCCTTTCCTTTACGTATCTTTACCTGTTATTAAGTGAAAGTGAATC CGAAGTGAAAGTGGTTCATTTGTGCAATTGTTAGATTTCCCGCTCAGTAT TGATTCCAGCCGGCCCCGAGATGGAAAAGAAAACTTTCTCCACGGGTGTA CTTTCACTTTCATGTCACAAAGAACACAATCAATCCCCGCGATGGGAAAT TCTGGCAAGTCATTTTCCACGGTTCCTCACCAGCGTGGAAAATAGGCAGA AATAAATAAAACCAGACAGGCCTGAAATCAGCCGGCTGGCCCACTGTTAG GGACCATTCACTTATCAACATGGGGGAGGGAGGAATCAGCCGGCTGTCCC ACTGTTAGGGACCATTCATTTATCAACATGGGGGAGGGAGAAATCAGCCG GCTGTCCCACTGTTAGGGACCATTCATTTATCAACATGGGGGAGGGAGGA ATCAGCCAGCTGGCCCGCTGTTAGGGACCATTCTCTTATCAACATGGGGG AGGGAGGAATCAGCCGGCTGGCCCGCTGTTAGGGACAGTTCCTTTGTCAT CATGGGGAGGGAGGAATCAGCCGGCTGGCCCACTTCTAGGGAACAGTCAT TTATCCATGTGGGGGAGGGAGAAATCAGCCGGGCTGTCCCACTGTCAGGA CTGTTCATTTATCAACATGGGGGAGGGAGAAATCAGCTACCCACACTGGC GAGGGGCCACTCATTGAAAATTCTGAGGGATGACTGGTGAGGGACTGTTC ATAAGTCACCATGAGGGATGAAGCTGCCGGTAACCCACACTGGTGAGGGA CCACATCTGGGAGAAAAACAACCGAGTTGATACCTGCCGGCCCAGACAGA ACCAGCTCCTGTGTTACCTGATCCGGGTTGGCAGGTTTCCATATCAGACT CACTTTCCATTGAGCAACTTTCACTGCTGAACAGCTTTCCCCTGGCAGAG ACTGGCTTCCCCATAGTTTGTGATTTGTAAGATTGTTTTACATTTTTATT TACAAGGAGTGTAACCTTCACAACTATCATTACTGTCAAATTAGATCATG TCAAGTGAAGTATTTTATATCTATTCCTTGTAGTTTACATTCGTGTATGG CCACTCGATGTATGAGGTTGGAGTTGGAACTTCCGTACGGATTTCTTTCT CTGTGTTGGGACGGGGGACGATGTAACACTTTCACTTTTACATGTAGAGT CCATGCACGTAGAGGGACGGGGGGACGATAAAACACTTTCACTTGCAGAC CAGTACTCCATTGCTCACGGCGGGAACTGTCCGGCGCGAGCGTGTGGAAC TCTAACCGCGGCCCCCCGGGAGCGCCGATATTGACCCAACAGGAACGGTT AGCTTCCCGCGAACGTACCGGTCGCCATGAGCCGACACCCGGCAACCCTG CTGCATCTGTAAACAGCAAGGATCAATAATATTGATCCTGGCATTGGTGT GGGCGATACCCACACTGGTGGGTAACCCTTCATAGTGTTGTCAACACTTC ACTTTACTTTCACTTTCTTTGTTCAGTCAAGTCACGTACAAGTCAGGCCA ACTTTGACCTATTTTCAGGTAATCTACAATATTTCTTAAAAACAAAACGG CAATAATAATAATTGACATACTCCATGCACTAGGTTTCCTTGGTGATGTT TCCATGGCGATGTGGAGGCTGTTGAACCAGATAAGTTTCTCCTGTGTTTG CTGTCAATGTTTCCATGGCGATGTTTCCGTGGCAATGTTTTCATGATGAT GTTTCCATGGCAATGTTTCCACGGTGATGTTTCCTTGGCGATGTTTCTGT GGCGATTTGGAGGTCGTTGAACCAGATAAGTTTTGCCTGTGTTTGCAGTC GATGTTTCCGTGGCGATATTTCTGTGGTGATGATTTCCCATCGACACTAA TCCTGCCTGAAATGCCGCTATAGATTTCACAAGCGCCTGCCCAAATAAGG CAAGCCCCCATCACTGTTGCACCAAATCATCAATACTGCAGGAAGGAGAA ATAGCTACATCTTAGGGGTGATCCATTATATATGCACGGGGGGTTCTCCA TTTTACATGGGGAGGGGGAAATAGCTGCATCTTAACCATTTGAGACGATT GCACTGTAGATGCTGGGTTTCCATGACAACAGTAGTCCATCTGTGGTGCT GTTGGAAAATGTTTGAGAAGATTGTACTGTAGATGCTGGGTTTCCATGAC GACAGTAGTCCATCTGTGGTGCTGTTGGAAAATGTTTGAGAAGATTGTAC TGTAGATGCTGGGTTTCCATGACGACAGTAGTCCATCTGTGGTGCTGTTG GAAGATGTTTGAGAAGATTGTGCTGTAGATGCTGGGTTTCCATGACGACA GTAGTCCATCTGTGGTGCTGTTGGAAGATGTTTGAGAAGATTGTACTGTA GATGCTGGGTTTCCATGACGACAGTAGTCCATCTGTGGTGCTGTTGGAAG ATGTTTGAGAAGATTGTGCTGTAGATGCTGGGTTTCCATGACGACAGTAG TCCATCTGTGGTGCTGTTGGAAGATTGTGCTGTAAAACATTGATGAAACG TCAGGCACAAACGCCGCCGGGCTCACAGAAATCCCACCTGACCTCTGACA CGACCGACACAAATGCCGCCGGGACTGCGGGAATCCCGCCTGACCTTTAC ATGACCTTTGGATGGCAGGACTGATTGACGGGTGAGCGGGTTCAGGGTTG TCATGACGATATGGGGTAAAAACCACGGGTGTAGCTACAGTTTACCACAG GGTTATGAAAATATGGTTACATGAGGTAAAACCCACAACTAGCCACAAAC CAGATTTGTAGCAAGTTGTGCTGTGATGTCAACCTAAATGCTACATCTGT AGCAGTTTGTACTGCATGTCGGCCATGACAGATTCGGCCTGGTTCGACCT CCATCAGTTTTAGAAAGTTTGATTACGGGAGAGATTGTCGCAGGGTCTGA CTGATGCGTTAGCTTACCGCGGGAACCTCGCTGTAATGAAATCTCTTTTC TAACATCATTCAGCAGGCAAAGCAGCCACTTCCATGGCTCACCCCGTTTC CATGGAGATGGATGCAGCCTCCTCCATTGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCGCTACATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCGCTACATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGCAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGCAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGC CTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATT TCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGA GATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATG TAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCC TCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGC TCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCA TTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATG GAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGA TGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCT CCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATG GCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCC CATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCA TGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATG GATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGCAGC CTCCTCCATGGCTCACCACATTTCCATGGAGATGGATGTAGCCTCCTCCA TGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCAC CCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTC CATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGA TGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTA GCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTC CATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTC ACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCGCTACATT TCCATGGAGATGGATGCAGCTCACCCTGTTTCCATGGAGATGGATGCAGC TCACCCCATTTCCATGGAGATGGATGCAGCCTCCTCCATGGCTTGCCCCA TTTCCATGGAGATGGATGCAGCCTCCTCCATGGCTCGCCCCGTTTCCACG GACATGGATGCAGCCTCCTCCATGGCTCGCTACATTTCCATGGAGATGCA TGTAGCCTCCTCCATGGCTTATCCCGTTTCCATGGAGATGGATGTAGCCT CCTCCATTGCTCTTTCTGTTTCCATGGTGATGGATGCAGCCTCCTCCATG GCTCACCCCGTTTCCATGGAGATGGATGTAGCCTCCTCCATTGCTCTTTC TGTTTCCATGGTGATGGATGCAGCCTCCTCCATGGCTCACCCCGTTTCCA TGGAGATGGATGTAGCCTCCTCCATTGCTCTTTCCGTTTCCATGGTGATG GATGCAGCCTCCTCCATGGCTCACCCCGTTTCCATGGAGATGAATACCGT TGCCATGTGAGGAAAGTGATCACTGTAGGTACATAACACTAGTACTGTGT CTGCCCGCTGAAAGCCACCAGGAGTCAGAGTGTTCCTCTTTGGCAATCAA TGGGAGGTCCTCACCCAGTATAGCCCCCCCCTTATGATAAATGGGGGGTC CCTGCCCCTAACCCCCCCTTATGATAAATGGGGGGTCCCTGCCCCTAACC CCCCCTGATGATGAATGGGAGGTCCCTGCCCCTACCCCCCTTATGATAAA TGGGGGGTCCCTGCCCCTAACCCCCCCTGTTGATGAATGGGAGGTCCCTG CCCCTAACCCCCCCTGATGATGAATGGGAGGTCCCTGCCCCTGCCCCCCC TGATGATGAATGGGAGGTCCCTGCCCCTGCCCTGCGCTAAAGCCGAATCG ATAGCTCCCAATGGGGATGAGCCGCGATAGGAAAATAACTGCACAGTTTA TGGTTGGGGGGATTTATGCTGGGCCCTTTGTAACCCTCCCGTTTCCCCGA AACATGTGCAGAAATGATGATAAGGTTTCTCTGGCTGCAGATTTCTGCTT ATGGCGCCGTTTTGGGGCTGCATAATGCTGTTTTCTCTGGTAAATATGAA TTTCAGGGTAAAGTGCCCATTTGTGGTGTAAATACAGTTTTCATGTGTAA AATGCCACTTTGTGGTGTTTTTCGGGTAAATGCGGGTTTCAGTGTAAAAT GCCCATTTTGTTCTACAGATAAAAGCCATCGCCTGCAAACACGAGTAGTA AAAAATACTTTCCACCAATTTTTCACAGAAGGCAGATTTTCCCTGCAGTG TGTAAATATTCAGGCCTTCTACCTCCAGCCTTTCCTCATGTTTGGGTGGA GTTTGGTGTCTACTCTTCTGGTGTAATTTGATAGCTCTGCTGTGATGTAA TCCGAGTTGTCTCCCGTAATTTGCTCCAGTGATAATTACAGACTTGCTTT GACCTGGGAGATTTAGCGGAAAGATCGGCTGATAGACTGAGACCTTGTTC CTCCATCTGTGGTGATAAAGTGGCGAACTTCTCCCAATCCAATTTAGCTA TACACTTGTTCTTGTTCTGCGGCGAGAAAAAGATGCAATTTTCCATTCCC TCCCGTCTGCTCCAAGGAAACCCTCCGGAATTTCATACAAATTCCCTCAT TTCTACCTCTTCAGCCTCTAATCAGGAATTTCAGGCGGAATTTTCCTCCC AGCTTGTGCTTTAACTGCGGTGATATTCCGCAGTGCGAGGAAAGAGGAAT GGATTTTCTAGTCGTCAAGTCGGCTATCAAGTCTGATCTTTATAGAGTAA CTAATTGGATAAACTCAGCTTTATTTTTAGTGGACATAAAAGATCTGCGC ATGGCTGGTGTCTGTTGGTTTCCTCACTCCTGATCCCCCTTGCACCCTCA GAGGAGGGCCTGCATGGGGGGGTCCCGACAACACTCTACGCTAAATTCGG AGGGCCAGCTACGTAATACGCTAAATTCAGAAAGCCTCCCTACGCTCTAC GCTAAATTCAGAAAAGCCTCCCTACGCTATACACTAAATTCAGAAAAGCC TCCCTACGCTCTACGCTAAATTATGGAGTGGTCGGCAACGCTCTACGTAA AATTAAAACGGCCGATTACGCTCTACGTAAAAGGGGCATGCAGGCCCTCT CAGAGATGTAAAAATCACCTGCCACGATATAAAAAATTGTAAGAAGGGTG GTGATATGCCGGGGTTCTTTTGGAATGCTTTAGAGGATGCTGCAAAACTA AAGGAAGTATGACTGAAGTTTTCTGCATCATGCAGGAAAGGCAGAGAAAC TTTCGGTGTTTGAGTGATTTCCTCTCTCCTCAGCGTACTTCCATTTTGCA CCAGGGCTGTCTCCAGCTTGATATCTTTTTCTGTCCCACTTATTGTTTGG TAGCCGATTTTGTAATTTTCATTGTTGAATGTGTCATTTTAAGCTAAAAA GAAAATACATTTTTCATCAGTTCTATCTCACGAAATGGATATTTTTTTTC CGTTCCAAGAAGCAAATTTCTGTCCTTGGACGGAAGGACGGGTCCTGGAG ACAGCACTCTGGGAGATCTCCTGCTACAACTGAAGTTTTAATTTCTGCAT CATGCAGGAATGACAGATCTAGAGAAACCTTCGGTGTTTGAGTGATAAAC TTGGTAAAAAGCAGAGGCTCCAAACCTGCCTGCCATGTCCCGTGGAACTG ATACGACGACTTTTGTGTGAGGAGTTGTTGTTTGAATGGGTTGGAGCCTG GACGTTGTATCTATAGGGAGAGAATCGGCCCTAAACAACCCGAGTAGTTC CGCCCTGTTTGCCTGAGATAAGGAAATTGCTGGTGCTGATTAGCATAAAT TTGCATCAGGAGTCTGCTGAGTTAAGCAGGTTGTTGAAATATGTGGCTTA CGAATTTCCCGTAAAAGGTCGAGAGAATGCTTTGAATTTTTTTTCTGTGT CACATTTGTTATACTGTAACTTAATTTTAGCTTATTTAACGGTCACTAAT CAACTGCTAAAACTTCATTATCGCAAATTTTTGATCACTAATATTTGAGA CAGTAATGTTTGTTCCCACCGTTAAAATTAAATTCAGTGAACTACTCCCT TTCCCCCCAACCGCTAAAATTACTGACCGCTATATTAAAGTGATTTACAG TATTGTGACATGAAGGTTTGTTGTGGACATGTCTAGTCATGTGTGTTTCA TTGAGCAATTGATAGACGCAATATTTTAATTGAGGAGCAGATATCTTAAA GAAGATTGCATACATCTTTAAAAGGCGCCACCAGGCGATATGTATTTCTG GTAAATAAACAAATAAAACAACACGAATTAAGCAGACTGCATACATCTTT TATAATTATGACAAAGTTTATTGCAAGTACAAGCCTGAGGGCTGATTGCA GGTACAAGCAACACATACAATAATGAAAAACTATATGATATTAAGGGCTA TATCCAATGTACATGGTGCTAGTTTTGTAGGTTTTAACTTCTTCTTTTGA GGTAGACGAATATACCTACGTCTTTTAATATCATATGTGGGTTCTTTGAT TTTAAAAGTATACTGTTATCTCATGGTCAGCAATAGTGGGAAAGTAAGAA TGAATTTTGGACACGCTTGTACATAATTGCTTACGTTCTTATATCCTCAT AAAATGTTGAGATGCATACACCTTTAAGCAGATTGAACACACCTAAACCA AACAATAGAATGTCTGTTGGTAGTGAAGATTGTGTTTTGTGCTGCTCCCC ATGCTGTCAGTCTCGTCAGTTCTAAAGTGCTCATTTTGCTCCTGGCAGGA AACTGGCAATTAATCCAGGCTAAGACGGAGTTAGACATTATATCCCGAGT TCCCGGAAAATGAAAGTTCTTGTTGCACAACAAAGGACTATCCTGCCGGC ATGAGTCTTAAAGTTTCCTAACATTGAAAACCTTTTAATTTGTCAAAACA ATCGGCAGTCTTTGATACCTTTTATTACTTTAACAGTTCAGAACAAGCGT CTTTTAGGAACCTTAATATGCTTTGCACATGACTTAGTTTTATTGCTACA TTCTGTAGAGGGTTCAGTATCTAATTATTGCTACATTCTGTACAGGGTTC AGCATTATTGCTACATTCTGTACAGGGTTCAGTTTTATTGCTACATTCTG TAGAGGATTCAGTATTATTGCTACATTCTGTACAGGGTTCAGTTTTATTG CTACATTCTGTAGAGGATTCAGTATTATTGCTACATTCTGTACAGGGTTC AGCTTTATTGCTACATTCTGTAGAGGATTCAGTATTATTGCTACATTCTG TACAGGGTTCAGCATTATTGCTACATTCTGTACAGGGTTCAGTATTATTG CTACATTCTGTACAGGGTTCAGCATTATTGCTACATTCTGTACAGGGTTC AGTATTATTGCTACATTGTGCACATGACTTAGTATCATTGCTACATTCAG TACAGGGCTCCTTATCATTGCAACATTCTGCAAATTGCTACTTCAGGTTT AGCCTTGACTGTTTCTTCCATTTCCAAACTTAGGAGAGAATAAAAAAACA ACTCTTATCATTGCTACATTCAGTACAGGGCTCCGTATTGTTGCAACATT CTGCAAATTGCTACTTCAGGTTTAGCCTAGACTGTTTCCTCCACTTCAAA AGCTGGGAGAGAATAAAAAGATGAAAAAACTCTACTCTATCATTGCCACA TTCAGTACAGGGCTCCGTATTGTTGCAACATTCTGCAAATTGCTACTTCA GGCTTAGTCTTGACTGCTTCCCGCATTTCCAAAGCTGGAGAGAATAAAAT AAAAACAATTGGCTGGAGGAACGTTCTGATCCCTTTTCATTACCGGCGTC GCAGCAAAGCTCCTCATCTTAAGTTGGGGGCTTAAGGAAGCCCAACGGAC GGGAGTCTGATCGGAATCTCGCCTTTCGGGTCCTTTATTTCAGGCAAATT GCTCCCCGCATGGCAATCATGCTGCGACTCACCCTGATGCTACTAATGGG GGGGGGGGGNGCATGGCAATCATGCTGCGACTCACCCTGATGCTACTAGG GGGGGGGGGGGGGGCAATATCGTTTGTTGGTTCTCAGACCTACAAAAGAG GCCTGAAGTCAGTGGAGGGAAAGTCAGACTCTGTACTAAATAATCACCAA TGAACCAATATGAAAACAGAGTCAGATGGGAAACTTTGTACTAACTAATT ATCAATATGAAAACAGAGCTCAGAAACCAATAAACCAACCTGAAAACAGA GTCTGAGGGGAAAGTCTATGCTAGATGATTATCAACATGAAAACAGAGCT TAAACCAAAAAAACGACATGAAAATAGAGTCTGAGGGGAAAGTCTGTACT GAATAATTGCCAATCAGCCAATAAACCACATGAAAACAGTCTCAGAGGAA AGGCTGTACTAAATTATCAACATCAAAACAGAGTTTTAAATCAACAAACC AACATTAAAACAGAGTCAGGGGGAAAGTCTGTTGTAAATTACTATTAACT TGAAAACAGGGTCTAAAAATTAGGGGAAAGTCTGTGCTAAAGAATCTTTA GAATGAGAAGTTAAAAGTCAGAGGGGAAAGTCTGAACTTTAGTGTGTCAT CTGATCCCTCTGCCCTCCGTCTTCATGTTTACCTCTTGCTGAAATTTTAT TTGAAATTGTCTGAGAAACAGGGAACTTAGCTGGCATGGCCTAAGCACTC ACACACACAATGGACCATTTTGTCGTATCCTACCTCACCATATCGACCCA GCGGTACATTGCCATGACAACTGGCCGAGATTTACGCCAGTGGGAATGTT TCCCGGGACGCGGGGATGAATATCCCGTCAGGAGAGGTATCAGGTTACAG GATTTAACGAAAGCTTTTGTTCTCACATGTTACCATTCTAGTCAGCTTGC TTTTTGATGTGTCTTTTCTGTTTGTGTCAATATTCTAGCAAACAAAGTGT CTGTTTGTTTGAGTTTCCCCATATTTTAGCAAACAATAACTAGTGAAGCA ATGGATGGATTGTGATGATGGTTGGTGGGAAGACAAAAGTCAAGGTCGAT GAAGGGCTTCAAGATTGTTATCGATGATGATAATAACCAGACATAATTGT AAAAAGGTTGGTGTAATATAGGCACAGAGAGGCCCAGAATGGGGGTTTCT GGAGACATGTTAGTGTGATATAGGTGCAGAGAGGCCTAGAATGGGGGTTT CTGGAGACATCTTAGTGTGACATAGGTGCCGAGAGGCCCAGAATGGGGGT TTCTTGAGACACCATCGTGTAATATTGGTGCCGAGAGGCCCAGAATGGGG GTTTCTTGAGACACCATGGTGTAATATTGGTGCAGAGAGGCCTAGAATGG GGGTTTCTGGAGACATGTTAGTGTAATATAGGTGCAAAGAGGCCCAGAAT GGGGGTTTCTGGAGACATGTTGGTATGATATAGGTACTGAGAGGCCCATG AACGGGGTTTCTGGAGAAATATTGTTTTGATGAATGTAATGTAGCATGTA TCGTTAATCCATGCGGACTCAGGATGGGGGTCAATACTCCATGATATGCA GTAATAATCAGTAAACAGCCCGGGGGGAAACTCCTCACTTCACCTGTGGT GCAGACAAAATCTGCCGCTAAACTTGCCACAAAAAGTGCCACAAATTATC TCACAAAACTGCCACAAAAGTGTCCCAGGAGAGACTGCTCGCTTCACCTG TGGTGCATGTAGACAAAATCTGCTGTGAAAACTGCCACAAAATCCGCCAC AAACTATGTCACAAAAATTGTCACATTAAATTGTGTCACAACAGAAATTG GTCTGAGGGAGCCTGCTCACTGCACCAGCAGTGCATGGAGACAAAATCTG CTGCAGAATTGCCACAGAATCTGCCACAAACGACATACATGTCACAAAAA TCACTACTAAATCTGCCTTCCTTTCTGAGAATTGTGCTGCTTATGCCAAG AAAATACGTAACATCGTCATCAACATGACCTTCATCAGTGTAAACAGCAC AACACCATATGGTGTAAACAGCTCACGACCATATATGGTGTAAACAGCTC ATGACCATATATGGTGTAAATAGCTCACGACCATATACGGTGTAAACAGC TCACAACCATATACGGCGTTTGTCTGTTTTATCTGGTGGCTCATGTTAAT GTTATTTCATGCATTGTTATCTGTATCTATTCAGTAATCAGTAGTAATAA AGACTCAATCATATTCTTCTATCTGTTGGCTAATGTCAGTTTAAAGACAT GAGACTAGGGACAGATGAGACGCCGGGGGAAGCATAGAAAGTTCTTAAGT TGCAGACAAGCAGTAAAAGTTGGCCGGTTGTTATGGCTGTGGCCTTGGAC TGACTGTTTAGTCGATACAGCGGGATTTTGTTGAGCTTCGCGGGACACAA AAGACATTTCTGATCACCCCATGGTCGTTTGGCACCGATGGCTTTGCCAT TGCTCTGGTTTTAATGTGCGTAATATCAATACAAGCTGGGCGCATCGCTC CACTAGCAAACTGCTCAATTTGGCACCGGACCAGCCCCGGCAACTGGTGC CGTGGGACACAGGATCAGTGGGGCTCTATAGAACCGTGGATGTTCCTGTA GGGTTCTATAGAACTGCAGATGTTCCTGTGGGGTTCTATAGAACTGTAGA TGTCCCTGCGATATTCTATAGTACTGTACATGTAGATGTCCCTGTGGGGT TCTTTAGAACTTTAGATTTCCCTGTGGGGTTCTAAAGAACTGTAGATGTC CCTGTGGGGTTCTATAGAACTGAAGATGTACCTTTGGTGTTCTATAGAAC TGAAGATGCACCTATTGTGTTCTACAGAACTTAGCCTAAAATTCTGAAGA ACTTGTCCTTGCTTTCCACCTTGCTTCTCCTTAGCAGCTGCAACAATCTT AAACTTACTGCTTTCAATCTTGTAGATGTATTTCCCAAGACACATGTGCG TCTTATCTCCTCTTATCTGCTCTTACTGTAAATCACTTTAATATAGCAGC AGGAAAATATAGCGGTTTGGGGAAAATGGAGTAGGTCACTGCACTTAATT TTGACGGTTTGAACAAACATTACTGTCTCCAATATTAGTGATCAAATATT AGCGATGATGAAATTTTAGCGGTTGACTAGTGTCCGATAAATCAGCTAAA ATGAAGTTACAGCTAACAAATCAAGAATAACAGTATCTGGTTGAAGAATG GTTCTTGTGTCTCGCCTGCTGGAAGACGTTAGCAGGTTTACTTAAAGACG TTGTTGGCCTTGAGGCACTGCTGTTAAAGTGATATCCAGAATCTTAATCT TCAGCCTTAAGGAGGTGGCAGAGATCTTGTGTGTTTTCTTGTTTAATTGA AGATGTTGCGAGTTTCTTGGCTGATTGCAGAGTTCCAGAAAGCTGATTTC CCAGAAGTTTAATCAGGCTACGAGGAGGTGATCTTCCCCTGCCGGCAACT CTGCCTCCGAACCATCGTAAAACAGCCAGCGACAGGGCTTCTGAAGTAAT TTAAAACTTTAATATATCAGTACTTAAGGAGCAATTTCTGCTGTCTGAGG AGGTTTGAGATGTTCTTAGTTATTCTCCAGGAGAGATCGTAATCTTGGTT TCTGGTCGAGTGGAGAAAACAGGAGGAGGGCTGGGGGCGAAGTAAGATCT TGTTATAACAAACAACTAAACTAGACTCCAGAACTTTGCATATACAAACA GCTAAGCTCCACTCTAGAACTAACAAACAGCTAAACTAACTTAGCTTGAA AGTTCATCTGTGTTGGTAGAAATCATTCTCATACAAGTTTTAACTGTAAC TTACTCCTTGACAAAGACCGGTTTTGTACAGTCAAAAATTTAAGTAAGTC CAATTTTTGTGTTGGAAATTACAGTTAAAATTTGTTTCAAAACAGCTAAA CTATACTGCAAATGGTATGTTTACTTCATTAATCACCAATCAGAAATACC TTTCATTATGCTCAATTTCTCTGTTGTGTCTCCTACTACAAAACAAACAA CACGTAAGAATAGCCCATAATGAAATGTTGTCATACCTGAACCTACATGT AAGTCACATGATTGTGTTGCTTTGCTCTACAAGACTCAGCCCAAAATGCT TTATTTAAAAGACTTGCCTTGTCTTGAGACGTTGTGTCCTTGGGGGAAAG TGGCTGGTGCTGGATATTAGTGGGCAGATTAATTCCCCTCGTCATGAATC TCCCCCAACCCTGCGTACCTGACAGTAAAGTATGGGGCCGGAGAGTGACC AAGTCAGCGGATCGATGCCGGGTTCTTTGATGGAGTTTCTTCATTTCCTT TAAGTGCGCGGCTGTGTCCTGTCAATACCGGGCAACGGATCCATTAGTGA GACATGCCAATAGCACACATGACGTCTGCTTTCTTAATAACCTTATTGAA CTGGACATTCCGGATACAGGAGATGCCAATAGCACATGATGTCTGCTTTC TTAATAACGTTATTGAACTGGACATTCCGGATACAAGGGGATATAGAGGG GGGTACTGTAACTGCAGAAATATTTGCGGGGATTTGATTTCGTGGTAGGA AGAAAATTGAGTGTTTGCAGTGGTTTTGAGTGTGCGTTTGAAACAATAGT AGCACTACAGTCACACAATGGAATGGCTTTTTGCGGTGGTTTAAAGTTTG CGGTAAAGAGTTCACTGCAAAAACCCTGAGCATAAAACCACTGCGAACAT TTTTGCATTTTCAGTATCTCACTGGACCCGCAGCACGTTGGGGACCTCGC TGCAACCAAGTGATTTGGAAGAACGCTCAACAAATTTCATTCTTTTCACA CTTTGTGTGCTTTGTTGTCTTTTTAGTCATACTAGAGCATTTTGCAGGAT ATTCTTGTTATCAAGTCAAGGGTAACATAAATCTAATTTAGGTCGCAGCG AGGTTGCCAAGTGTCGCAGTCCAGTGAGACACACACTTATCTATCTTAAT ACAAGGGCATATAGCTAACCTGATATAAAATGCTCACATGTCAAAAGCTG CTTGTGGAGAAAATGTAGGTTACTGAGAGATGGGCCTTACAAGGGCTTCC GTCTTTTTCATGTTTTATTGCAATTAGAGATTGCAAACCTCTATCCCCCA GCAGAACATGCCGAATTGCAGTGCTCCCTCTGGCAGAATATACAGGAACT GCAGTGCTCCCTCTGGCAGAATATAAGGAAACTGCAGCAGAACCTCACTA CTACTATTTCAGCACCAGGGACAGACTCAGTTGTGAAAGAGATGTACAGT GTCATGCAAATGGCTGTTTCAGCAGTAGGAACAACCTGAAGCGTATTTAG ACCATTATAAGCAACATTGTGGCACACTTGGACACTTGTAGGCATTGTAC AAGACCTTGTATAAAACTGTACAAAACATTGATTAAAAAGGCTCTTTGTA CACAACCAAGTTTCTTATTCCACCAACATTTTGGTGACTGTCACTTTCCT CATGGCAGTTGTGAATGGTTCACATTGCACTGCAAAAATAAAGTATCAGC AAATATACACTTGGTTGCAAACAAAGAGTATTTTTATCCAGTGACTTACC AACCTGATGAACTATTCACGGATGTACGAAACATTGTTATTTGAGCCTGA CCATGCTGTCCTTTTTTCCACATGTACTGTCCTGGTAACTGCTGTGCTGA CTTCTTGCTGTTCCATCCGAATGACCTCTGTTGTGCTGTCGTGGCTGGTG TGCTGTTCCCTACTGTCCTCCTGTGCTGTGCTGTCTGATGGACAACTTCC CATCCCTGCATATCACAGGTAAGTCAAACCTGTTGTTTACATTGTGTGGA AAATGTACCTGTAAGTCTTAGTTAGGGGCCATCTTACAACAGATACTGGA TGAAGATGGCCCATCTCAAAATGCACACTGCTTGGAGCTCTTGTCAGTTT GCCTCCTGCAGTAACACTGGACCCATGGGGTCCTCTTTTCTGATACAATG GCGGGGGGGGGGGTCCTCATTTCTGTATAAATGGGGGTTCCTTAAATCTG AACCAGTGGGTAGAGGGTCTCAATTCTGAACCAATGGGGAGAGGGGTCTC AATTCTGAACCAATGGCGGCGCTCCATATGAACCAATGGGGAGAGTGGGT CTCAATTCTAAACCAATGGGGGAGGGTCTCTCAATTCTGAACCAATGGGG GAGGGTCTCTCAATTCTGAACCAATGGGGGAGGGTCTCTCAATTCTGAAC CAATGGGGGAGGGTCTCTCAATTCTGAACCAATGGGCTGTCCTAAAAGTT TTTCACCCCATGTTACAAATAGTGTGGCTGCTTATCAATTGTTAGTAGAA TGTAGATTGAGACTTTATAACTCTCCACAGGTGAGTAAAATATTTGGTTT ACATTGTGATAAAAATGTACCTGTGACCATGGTTAAGAATGTATTATACA ACTAAGACATCGTTGCGCTTAATACACCAATGCAATTGATGTTTCCCTCC TTCAAACACCCAGGTAATACAGACAAGTCCATATTTCCGATTAATAGATA TCTAACTATTGATTATAAGACATATCTTTTCTTACACATACATACAAACA ACATCACAAAGAAGCGAGCAGTAGTCAAATTCACTTCCTGGACTACTTGT GCTAGCTTGACAATGTATTGGTCTGTCAGTAAACTATTCTTTTGCTTGAC CCATACTCAATGCAGTTGGCATAGTACTGTAGTAGTAGTGAACTTGCAGT GGTCTGAACACCCTGCAGCTGCAATCAGTCTTTCTTCAAATCTCTCCAGT TCATCGCAAGCTTCCTTAGTTTTCTTTCTGACTGCAATCCTAGTCCTCTT TCATTCAGGTCTGCCCTCAGTAGACTCAGTAGGTTCTTGCAGTGTCTTCC TTTTCTGTGGGCATATATGTAAATGGTCTTCGTTTTGTCCTAATTCATTT TAGTAATGCTGAAGAAGAGTGATGGATGTCACTCAAAACGTCCGCAATTA AATCTCCAAATTTTATCTAGTTGTAGAGTTTGATTTGACTTTATATATTG TTTACCTGGATGTCTGACCTTCATAAACGTACTATTTTTGGTGTAAATGG TCTTCATTCGCTCATTCATTATATGATATCCAGACGTCAACCCTCCTCCT TAAGTAGGTGATAGATGTTTCACACCTGTAGTTATCTCTGTCTAAGGTTC ACCCCGACAGATCTATCTAGATGATGCACCAGAGTAGGTGATGTGTCTTC ATTAACCCAGAGGTCCTGAGAACCATTTTCTAACCCCTCCACACACGTGG GACTCCTGATGCTGCAGTATCAGGTCAGTGGGTGGGCTGGTTTGTAAGTG TGATCCATCAATTAGATAGCGCTCTGCCATAAGGACCATCAATGACTCTG ATAGCGTTCTGCCATAAGGACCATCAATGACTCTGATAGCGTTCTGCCAT AAGGACCATCAATGACTCTGATAGCGTTCTGCNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCAATTCTAA ACCAATGGGGGAGGGTCTCTCAATTCTGAACCAATGGGGGAGGGTCTCTC AATTCTGAACCAATGGGCTGTCCTAAAAGTTTTTCACCCCATGTTACAAA TAGTGTGGCTGCTTATCAATTGTTAGTAGAATGTAGATTGAGACTTTATA ACTCTCCACAGGTGAGTAAAATATTTGGTTTACATTGTGATAAAAATGTA CCTGTGACCATGGTTAAGAATGTATTATACAACTAAGACATCGTTGCGCT TAATACACCAATGCAATTGATGTTTCCCTCCTTCAAACACCCAGGTAATA CAGACAAGTCCATATTTCCGATTAATAGATATCTAACTATTGATTATAAG ACATATCTTTTCTTACACATACATACAAACAACATCACAAAGAAGCGAGC AGTAGTCAAATTCACTTCCTGGACTACTTGTGCTAGCTTGACAATGTATT GGTCTGTCAGTAAACTATTCTTTTGCTTGACCCATACTCAATGCAGTTGG CATAGTACTGTAGTAGTAGTGAACTTGCAGTGGTCTGAACACCCTGCAGC TGCAATCAGTCTTTCTTCAAATCTCTCCAGTTCATCGCAAGCTTCCTTAG TTTTCTTTCTGACTGCAATCCTAGTCCTCTTTCATTCAGGTCTGCCCTCA GTAGACTCAGTAGGTTCTTGCAGTGTCTTCCTTTTCTGTGGGCATATATG TAAATGGTCTTCGTTTTGTCCTAATTCATTTTAGTAATGCTGAAGAAGAG TGATGGATGTCACTCAAAACGTCCGCAATTAAATCTCCAAATTTTATCTA GTTGTAGAGTTTGATTTGACTTTATATATTGTTTACCTGGATGTCTGACC TTCATAAACGTACTATTTTTGGTGTAAATGGTCTTCATTCGCTCATTCAT TATATGATATCCAGACGTCAACCCTCCTCCTTAAGTAGGTGATAGATGTT TCACACCTGTAGTTATCTCTGTCTAAGGTTCACCCCGACAGATCTATCTA GATGATGCACCAGAGTAGGTGATGTGTCTTCATTAACCCAGAGGTCCTGA GAACCATTTTCTAACCCCTCCACACACGTGGGACTCCTGATGCTGCAGTA TCAGGTCAGTGGGTGGGCTGGTTTGTAAGTGTGATCCATCAATTAGATAG CGCTCTGCCATAAGGACCATCAATGACTCTGATAGCGTTCTGCCATAAGG ACCATCAATGACTCTGATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATG ACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTC TGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCAT CAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAG CGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGG ACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCT CATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAA TAAGGACCATCAATGACTCTCATAGCGTTCTGCCATAAGGACCATCAATG ACTCTGATAGCGTTCTGCAATAAGGAATCACACTTTTGATGTTAGCTTTT TGTCACAAGGAAGGAGAGTTGTAGTGTTTTCTGGGCAGGTTCATTTTATA AGCAGTGACTGTCACTGACGAAAGACAGCGGATAATGTCTGAAACGCCTA AAAGTTCACAAAACGTGTCCAGTTGCTTGAGTAACTTGTGTGTTGAGTAT CTGCACATGTATCTATATAGCTGATATAATCGCCCTTCAGCATAACAGAC CAGCTTTGCAAGCACGCGATGCACAGTAGCTGATTATATCACACTGAACG ACCTGTCACACCTAACCTTTGCACATCTAACTGTAAGCACTGTTTAAAGC TATCTGGTGATGTTCCTTACTACCTGTATCTCTTACCTTCATCAATGTAT CAAAGCTTCTATTATTTTCTGGGCAGATATTCATTAAAATAATATGAATC ATTACCTGTAACTGTTAACCATATCCTTAATGGGGGTTCCAAGAGCATGC TTGTGTCAAGAATACCAATCACACAGACTATGTCACATAAGATGTGGAGC AAATACCCCCAGGTTTGGTCCTGGACTTGTTAAGTTATGGAGAGAAGCTG CCTGGGTCTCCCCTGAAATGACTCAACTGATCCTCGAATAATTTCATACC CCATCTGTAAGCAGCAACGCCTGTGCTGCATTGCAAGCCCTTGCCAAACT GTTGTCTAATGTAGCATTAATGCCAGAAATACATATGCAGCACTAATGCT TGGTTAGTGCACACTGCCATGGTAATTTCATGGTAATTATGGCTGTCCAA AATCCAGCATTAATGCCCAATGTGCTCTGCTAAGGAGCGCGTAGTGCGGC ATTAATGCTACATTAGACAATAGTTTGGCAAGGGAGGTGAACCGGTAAAC AATTGCCCTGAGGAAAGTGATAAAGGGTCACTGAAATGTGGGTTGAATAA ATCTCTTGGCTGTGTACAAAGAGTATTTTTATTCAATGACTCTACTGGCG TGTGTGTTATACCCAAGGACGGTTATACATGTACATGCAGGCTATGTAGA CACATTGTGATCATTATGTATTATGTCTGTGCATTGTATTTGTATCCAGG GAGCCTGAAAAACAGGTCAAGAGACCTGAGTGTGTCTGCTGGCTAAATGA ATAAATGAAATGAAATGAAATACAGATACAGATACTTGTGTGTGGTTGGA GCACATCAAATCTGTCAGTTGTTCAGAAAACTGTTGGACAATCCCCTGAC ATGACACCACGATCTGTGTGGTCCTAGCCCATCAAATATGTCAGTTGCTG GGCGATGAGGAACTCTCCGGCTCAGCCTGGAGCCTCAAAGGTTTCCGCCT GTCTCATCAATAAGCTCCAAGGTCGCGGAAATCGATTGTTGTCTGTCAGG GACAGGAAAGGTGTGCTGAAGGATAAGAGTTAAGCCTGGGGCTCAGCGGT CGTAATCGCAGGTACAAACACAGGTCCTTAGGGTGGTTATGGGTTCTAGC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCTAGCCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTAT GGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAAC CCCACAGGCTGGGTGGTTATGGGTTCTAGCCCCACAGGCTGGGTGGTTAT GGGTTCTAACCCCACAGGCTGGGTGGTTATGGGTTCTAACCCCACAGGCT GGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCTAGC CCCACAGGCTGGGTGGTTATGGGTCCAAACCCCACAGGCTGGGTGGTTAT GGGTTCTAGCCCCACAGGCTGGGTGGTTATGGGTCCAAACCTCACAGGCC GGGTGGTTATGGGGTCTAACCCCACAGGCCGGGTGGTTATGGGGTCTAAC CCCACAGGCCGGGTGGTTATGGGTCCAAACCTCACAGACAAGTGTTTTGC CTCATATGGATGGTCAGAGGGCATTGATTGCAAAACTTTCTCAGCTTGGC TGATGTGATCTGGGTGTACTCTAAGTGTGAAACGATGCACGAATGAGGTT GGAACAAGCATGATCGAAGGCAGGATGGCTGGTATTCACACAATACCCTA ATGCACAGGATTGACATTTTCCTGCCTCTAACTTTGGATAAGAAGACAGG AACAGATGAGTTCCGCTCCACACGGATGGGCAAGACCATGAATAACACGG ATGTCTCAGCGCTGCTGATGCGCTCGGGGTGTGAAATGATGCATGAATGG GGACGGAATGTTCTACAGTTGATGTAGGTTCTGATTTACAATAGAGGCAG GAGAGCTTCTGCAATGCAAGAATGAAATAAAGGAAAATGACAAAAACCAA ATCCTGTGTTAACAAATTGATAAACGTTCCCAAAAGAAAAGGCCTGAGGA ATGAATCTTTCTGTGCCATTGATGCACTTTTAGAGCGTGAAACACTGCAT GAATGATTTTCAACCATTCTTTTCCAGGTTTAGATGGAGTTCATCCTTTA TAACAGAATTATGACACTATATGGGATGCAAGGAGAATTATGCAAAGCTA CCACGCTTACCTGTGATGGGAAATAATTAGCAAGAAAAAAATTTGTGCCA GTACTGTATATGAAAAATATTCTTTTGTTACACATTGTTTTGCTTCCTTG TAAAAAAATTTTTTTAATGTAAATGTGAACTGTTTTCTATTGTCTTGGCA ACAGGTATTGCATGCAAGGAAACAGTTGCTCATGCAACTGGATACAATTT TGGAAAATTGTCGCTTTGTTTTCACGTGTACCTGGATGTCTAACCTTCAT TGACGTACCAAGTATCCCTAAAGAAGAGTGATGGATGTCACTCAAAATGT CCAAAAGTAACCTCTGAATATTATCCAGAAGTAGGAATTGAATTGTGTTT GGATATTGTTAACCTGGATGTCTAACCTTCATCAACTTTTGGCAATTTTG AGAAAGTTGGTCTTCACTGAGTCTCTCTTTCTCAGCTGCGCACCGCAGCC TATAAGGGCCCGTTCACACTTGAGTTTCGTGTTGATACCTAATATAGAAC TCCTACGTAATTGAATATAGGAGAAGCAGGAACGGGCTCTAAGCAACTTT AGTGAAACTTCCACAGTTTATGGGGGAAAATTGGCTCCATTTAGAGCCGA CATCAGTCATGTAAGGTGCAGAAGGTTATGGTTATTAGCGCTCTGTCGAC AGCCGACGGCAGTAATTTGATTCCTGCTGGTTTTAATTGTGTTAGAGCTA GGAAATAACAGGACCGGGACGTGACAGCAGCCTCATGTCACAAACAGGAG GGTGGAATTAGGGAGGGCTGCAAAATTTACTGTGCTAGTTCTGGGAGTTT CTGCTTCATTTTTGGCCCAGTCAAAAGCTGGCTCCATTATGAGTCTTAGT GNTCATTTTTGACCCAGTCAAAAGCTGGCTCCATTATGAGTCTTAGTGGT GTTTTGTGTAAATTTGTCCAGGACAAGTTAGTTTAGAGTTGATCCCCAGT GTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATC CCCAGTGTGAGCTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAG TTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTA GTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGA GTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCA GTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGA TCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGG AGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTT TAGTGGAGTTGATCCCCAATGTGAGTTTAGAGTAAATCCCCAGTGTGAGT TTTCAGTAGATTCAAATGTTCAGGTTCTCATTCTGGTTCGTCTCCCGTGT GGCTGAGGGTCCCTCCCCACTGTGGAAAGTGAAAGTGTGTGACTGAGGGT CCCTCCCCACTGTGGAAAGTGAAAGTGTGTGGCTGAGGGTCCCTCCCCAC TGTGGAAAGTGAAAGTGTGTGGCTGAGGGTCCGTCCCCACTGTGGAAAGT GAAAGTGTGTGACTGAGGGTCCGTCCCCACTGTGGAAAGTGAAAGTGCCT GGTTTTGGGTTCCTCCCCACTGTGGAAAGTGAAAGTGTGTGGCTGAGGGT CCGTCCCCACTGTGGAAAGTGAAAGTGCCTGGTTTTGGGTTCCTCCCCAC TGTGGGTGCTATCAGCCTTATCAGCATCAACAGAAACACTTTCACTTTAT CACAAACACTTTCACTTTATCACGCAGTCGTTAAGATTTCTAACAGGAAG TTAATCTGCAGGAAACTGACTTGAGACGCAGTCATAACATCAACTAGCGG GCACAAACAAGTTAACGAGTTGGTTAGTGATGATTATTTGTTGTCAGATA TAGGCAAACAAGTTGGATAGTGTTAAATATTGGGGCAGCTACGAGGTGAT TAATTGGTTAGTTATATTTAGTTAGTGGCCAGGATAGTTGAAAAGTGTCC AGGTTAGTTATTAGATGGCCCAGCGGTAGAGTGTGAGATTGAGAGAGACT AGTGCGGTATTATCAGGGCTAATGTCCCACCAGTACTTGGATAGGCGAGT CATCCAGTGATCTAGGCTTTGGATTTTGTACAGTGATTTAAGCTGTTGTT TTCAGCCAGTGATTTAGGCAGGCATTGTCTGTGCAGAAGACCAGAGCCAT AGCACCATTACAGTCGGGTGAAAGTGAAAGTGATCGTTAGGCTTTAATTG TCCATTGTTTGTGCAGAACTCCAGGACCGTAGCACCATTACGGAATGAAT AGTTGTCGTGGTGATGAGGAAGGGGTAAGATTGCAGTTTTATGGGATTGT CTGCGGACGCCGGGCTTAAGCGACAGACTAATGGTTCGTGACGTCTGCTG GCTATCAAACAGCAATATGCACCAAGGCCACAGGAACGGGGTGTACCACA CAGGAATGGGGGTGTCAGGCTCTGCCACTGCAGAACAGGGGTCGGGCTGT GCCACACAAGAACGGGGGTGTCAGACTCTGCCACCTCAGAATGGGGGTAA GTTACAGACTAATGGTTCGTGACGTCTGCTGGCTATCAAACAGCAATATG CACCAAGGCCACAGGGAGGGGCTGTGCCACACAAGAGCAGGGGACAGGCT GTACCACACAAGAATGGGGGTGTCAGGCTGTGCCACTACAGAGCGGGGGT GTTGGGCTGTGCCATTACAAAACGACACAACGGGGGCTGGGCTGTGCCAC CTGGGAATGGGGGTCGGGCGGTGTCACCTCATAACGGGGTGTCGGGCTGT CCCACCTCAGAATGGGGGTCTGACTGTGCCACCTCAGTAACGGGGGTTGG ACTGTGCCACCCTTGAACGGGGTCGGGCTGTGCCACCTCAGAACGGGGGT TGGACTGTGCCACCATTGAACGGGGTCGGGCTGTGCCACCTCAGAACGGG GGTTGGACTGTGCCACCCCAGAATGGGTGTGTCAAACAAGCCCACCTCAG AACAGGGGTGTGGGGGGGGGGTGGTAATGGTCATATCTGTCAGACTTTGC CACCCCAGAACAGGAGTCAATTATTTGTAGAAGACAAAACGATGATCCAT TTAAACACAGTTTAGTGTCAGGGAAGCAATGCACCCGTATCAGCCGGGAT GATGTTATCTGGGTTTGATCATCTGCCGACAAAATGCCTCGGCTGTCAGT GGGCAGGGTTATTGGTCCCCATGGCAACAGCAGACCTCATTAACTCAGCC TTCAAGTATTCATTTTGTGATAGTAATGCTTTCATTTGGAGCAGTAATGT TTTATTCTGGAGAAGTAAATTTTTTTTCTGAAGAGTAATGGTCTATTATG GAGTGGTTATGCTTTATTTTGCAGTGGTTATGCTTTATTTTGAAGCAGTA ATGTTTTATTTTGGAGCAGTAATGTTTTATTTTGGAGAAGAAATTTTTTT TCTGAAGAGTAATGGTCTATTATGGAGTGGTTATGCTTTACTTTGCAGTG GTTATGCTTTATTTTGAAGCAGTAATGTTTTATTTTGGAGCAGTAACGTT TCTTTTGGAGGAGTAATGCTTTAATTTAGATATGTAACAGGCAGTGTCAT TATAGTGGGGCATTACTTTATGGAAAATGTATCTAATAAAACGTATATGC TAGTTAGAGGTATAAAACAAAAATTAAACTGTTGTTGACTTATTTGAGTT TTTGTCTAAAAACATGTGACTGTCTGTCTGTCTGTCTGATTGTGTGTGTG TGTGTGTCTGTATGATTGTGTGTGTGTGTGTCTGTCTGTCTGATTGCGGG TGCGTTTCTGACTTTGCACAAAGGGAGTGAATTCTGCCGTCTCTGACTCC TTCCTTGTTCATTAAACATGACTGCCATAAGATGCAAGATGCCAGACGAG CATGGTTTCAGGTTACCCGAAAGTTTTACAATCTGATTAGCACTACCGCC TGAGCCTGGAGTTGGCATCTGAACTTTACTTACTCGTCCGTCTGCATAAT TCATGCCTAATGCGATAAACCTTCTCAACAGCAGCAATTACAGCTGTTTT CTCTACATGTTCACGACACAGTGTAGGATTTCTGCCCGCTCTAACAAGCA GGGATTGTTGTTGGGCTTGGGGTTCAATTCCCAGCAGAACTTCTTGTTGT GTTGAAGGGTTCGATTCCCCGCAAGACTTCTTGTTGGGTTTGGGCTCGCT GATGTGAGTTGTCTCCGTACAAACTCCTGAGTCCCGCAGAAGTGCCTGGT CGTAGATGTTCTTGTGAAGAGAAGGTAGAAGGAAGGGCCTTTGGCTTGTT GGCAAGCGGATGCTAAAAGGTTGAGGCTACCTTCACCACAACAGTTGGTG AAGAGAAGACAGAAGGCCTTTGACTTGTTGGCAAGTGGACAAGTGGACAC TGAAAGGCTGAGGCTATCTTCACCAAAACAGTTGCCGGGTGCACTACAGA CTTTTCCTTACTGCAGGGGCAACTACAGAGTTGGGAAAGGCAACAAGTCG GGTTTCAGTGTCTGACATTATGGATGTTGCAGCCTAGAACATCCCCAACC CAGACGTTGCCATGGCGAGTAAGGACTCCCCAGCGATGGACCCCCTGGAG ATCCTGGCTGCGCTGCAGAAGCAAGCAGACCTCAGCCCAAGCTCCAGTAT AAGCAGCCGCATGAGTTCACCATTCACAACCGGTTCACCATACACAACCA ACTCGCCATTCACAACAGGCTCACCATTTCAAACTGGTCCACCGTTTACA ACTGGTCCACCATTCACAATGGCCTCACCTCGACCCAAACTGTGCTTTGA CACCGCCGGCCAAACCACCTTCGGACCAGCCGGCGCCACTTTCCTTCCAG CTGAAGCCATCATGTTTCCAAGGCAACACATCCTTCTGCATGGCATCCCG GCAACCAGACGTGTCACCATGGACACCGTTGCTAAGCTACGGGACGAGCA GGAAGAGGCCGATCTGAAACCGTCGAATTTCGTCCACTTCGCCAACAACT CGACGCTTCACGGGTTAAACAAGGTCTTCCCGGAGGATTCCCGCGGGCTG TGCGTGCAGCGCGCGCTGTGGTTGGTGGTTGTCATGACGATGATGTGCCT GTTCCTGTACTGGTCACTGACGCACATCCTGGTGTACTTCAGCTACCCGG CCGTGACCAAGATCGACGAAGGCGACGAGTCCCAATATTTCCCCGCCGTG ACCTTCTGTAACGTGAACAAGTACCGCCTGTCCGCCCTGTCGAACTTGGA CTTCTTCCACGTGGGTCGTTCCCTAGGTTACCTGCATCCCAACAAGTCGC TCAAGGCACCGCAAAACCCTGACCTTGACCTGAACCGGGTGGACGCCATC CGCCGCCTGGCCGACTTCTCCGGGCTCCCCGCCAACACGCAGAACTTCAG CCTGGCCGAGATGCAGGACCGCACGGGACACCAGCTCACAGACATCGTGC GGAAGTGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCG GTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCAT TGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCG GGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGG AAATGCAAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNCTATGGGGGTACATTGAACAAATATTAAAA GAATCCCATTCGCACTTTTGGCATACAACACTTCAAAATACGATTTTAGA GGGTATTTTGGGGAGAACATCGGCTATTTTCCTCATATGGGGTCACTGAC CTTTAGGTCACATCTTTATTCATCTGGCCAGGTGGACTAATTCGGTCAGC CAATGAGAGAGCGCGTTTTAACATACACACGGTTTATCAAGCTCAACCTG ATTGGTTAGAATATTCAATTTAATTAGGGGCACTACTAGAACTCTGACAG GTGCAGACAGGCACAACTTCAATACTCCGTGGCTCCCATCCTTGTGTTGT TATTGTTGTATCCTACTGTGCAATTGAGAAGGGTTCAACATGGGCTGGGT GATACATGTTGCATTTGCTCCTGCAAATGTTGCCTTTCTAGTTGCTGATG CTTCATTATATGATGACTACCACACACACCCCATGTACCGTGAATGGCCT TCAGTACTGCAATGTCCATAGACATCCCCCATGTAACAGACCCCCCCCCC TCCTGTACCAGGGGGTGTATTCGTGATGACTCACCCCCCCATGTGCCATA AGTAGCCGTCACTTCTGTAATGTCCACCCCCCCTCCTGTACCAGGGGGGT GTTTTCGTGATGACTCACCCCCCTGTACCATGAGTGGCCTTCACTCCTAT AATGCCCCCCCTCCTGTACCAGGGGGATGTTTTCGTGATGACTCACCCTA CATGTACCGTGAGTGGCCTTCATCCCTGTAATGTACACCCCCCATGTACC AGGGGGTGTTTTCGTCATGACTCATGACTCACCACACCACTCCCCCCCCT GTACCATTAGTTGCCTTCATCCCTGTAATGTCCCCCCCCCCCATGTACCA GGGGGGGTTTTCGTCATGACNCGCCATTCACAACAGGCTCACCATTTCAA ACTGGTCCACCGTTTACAACTGGTCCACCATTCACAATGGCCTCACCTCG ACCCAAACTGTGCTTTGACACCGCCGGCCAAACCACCTTCGGACCAGCCG GCGCCACTTTCCTTCCAGCTGAAGCCATCATGTTTCCAAGGCAACACATC CTTCTGCATGGCATCCCGGCAACCAGACGTGTCACCATGGACACCGTTGC TAAGCTACGGGACGAGCAGGAAGAGGCCGATCTGAAACCGTCGAATTTCG TCCACTTCGCCAACAACTCGACGCTTCACGGGTTAAACAAGGTCTTCCCG GAGGATTCCCGCGGGCTGTGCGTGCAGCGCGCGCTGTGGTTGGTGGTTGT CATGACGATGATGTGCCTGTTCCTGTACTGGTCACTGACGCACATCCTGG TGTACTTCAGCTACCCGGCCGTGACCAAGATCGACGAAGGCGACGAGTCC CAATATTTCCCCGCCGTGACCTTCTGTAACGTGAACAAGTACCGCCTGTC CGCCCTGTCGAACTTGGACTTCTTCCACGTGGGTCGTTCCCTAGGTTACC TGCATCCCAACAAGTCGCTCAAGGCACCGCAAAACCCTGACCTTGACCTG AACCGGGTGGACGCCATCCGCCGCCTGGCCGACTTCTCCGGGCTCCCCGC CAACACGCAGAACTTCAGCCTGGCCGAGATGCAGGACCGCACGGGACACC AGCTCACAGACATCGTGCGGAAGTGCAAGTTTCGCGGGAAACCCTGCTGC ATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCG CGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCA GGAAATGCAAGTTTTGCGGGAAACCNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNCCCCCCCCCCCATGTACCAGGGGGTGTTTTCGTCATGACTCA CCCCCCTGTACCATGAGTGGCCTTCACTCCTATAATGTCCACACTATAAT CAGATTTTCCTGGACTCCAGCTGACTTCATGTCTCTTATAAAGTGGAAAT CGTCCCATTTCCCCCTCATTATGCCATTAATAGCCAATTGTGCAAAGGCC ATCCCACCGCACCAAAGAGCATTTAGGGTCGTCAGGAAAACATTAATATG ATAAAAACAACTTTATTGCCAGTTCATGGACAGAAAGTGATAGCTATTAG CCGACTTTCTGCATTTTTAGCTATTACACTTCTGCTGAAAGGCAGGGAGA ACGGTCTCTGGGAGAACAGTCTCTGACTGTTTCAAAATCTTATCCAGTTG CTTGAGCAATTATTTTTGGCATATCTTATTACCTGGATGTCTAACCTTCA TCAACAGAACGGTCTCTGCATTGTTTCTTACCTCTTACATGTGAGGCAGC ATGTCTTCCTCAAGGCTCTGTAACGGGTCTTAAAGGACCAGCCACTTCTG CAGGATTCAACGTCTTGGACTTTTGAAGGTGGGGCTGAAACTTAAGCACC TGTTGTACCTAGCAACACTTCAAGACTTGTGAGGGCTGACTACATAACTG CTTCCATTGTGAGAGCCGATACCACTGACAGGGCTGCATTGTGAGCTGAG TCGGTTCTACCTGCAGTTGGACTTTACCCTCCAATGTTGCTGTAAAAGTT GCATTTTGGGCAGACTTCATCTGTTTTCAGGTTGGGTCTGTATTGTGAGA ACTGAATAGATACTGACAGGGCTGCATTGTGAGAGTTGAAAGCTACAGGA GTTTACCCTCCAATGGTGCTGTTGTATTTTGGGCAGACCAAACCTGTTTG CAGCTCGGGGCTGTATTGTGAGACCTGGTCCAATACATGGGGCTGAAGAC CAGAGGTTTAGGGTGGCTGCGATTCAACGCTAACTCGGGCGACCTTGACA CGACTGTGGTCGCCCCTCCCGCTGCGTTCCGCGACCCTCCGCTACCGACC TGGGCTCACGCTGCGTTCCAGGACCCTCGTTTGACGACCTTGACTCCCTC AGACATGAAGCATTCAACCAGCCCGAAACGCCTCCTCATGCCAGCAACAC AGCCAAAACTGAAAATTGAGACAAAACCAAAAATTGAGCCAAAGTTGTTA ATGGAGGGCAAACGGTCGGATCTGACTCACTTTGCCAACAACTCGACCCT GCATGGTCTCCCACGGGTGTTCCCGGAGCAGAGTAAAGGCTGGGACGTGC GGCGCGGCCTGTGGGCGGTTACCGTGGTTACGATGATCCTGGTGTTCCTG TACTGGGGCGTGAGCCACATCGGGACGTACTTCCGTTACCCGGTCACCAC CAAGCTCCATCTGCAGGAGGCAACCGAGTTGTTTCCCGCCGTCACCATCT GCAACCTGAACACCTACCGAGTCTCCCAGCTGACCCCGGACGACCTGTAC AGCTGGGGGGAGCTGATGGGCATCCTCCACCCCAACAGGACGCTGAGGGA CCAGGGCCTGCCGTACTTAAACAGCAGCGAGGAGAGAATCCTAGAGCTGG CCCGGTTCTCTGAGAAACGGCACGAGAACGTCTCGCTGTGGGAGGTGCAG AACCGCACCGGGCACGATCTGGGAGACATGGTGAAGAGATGCACCTTCCG CGGGGAACCCTGCACAGCAAACATGTTCACACCTGTAAGTAACACCTGCA ACGCAAACATGTTCAAACCTGTAAGTAGCCTCACACCTGCAACGCAAACA TGTTCACAACTGTAAGTAGCTCAAACACTGCCTCCTAAAAACGCTAAGAA CGTAAAACACAACCCATTTAAAATGTCAAAAAACTGCATCCTCAAAACAG CAAGAATTTTAAACATTGCTTTGCACTACATGTTTCCTACCTCTGAAGTT AGGCTTGTCAACTTAGTCTGTTATGAAGTTTTATAGTGTAGATTTCCAAT AACTGTTTCTGGCACCCCCGAGAGGGCTTTCAACATACATTGTAGATATG GATACGACGATGAAGGCTAGACATCCAGGTAGTTGGATACACAATACAAA TTTGAGTTACTCAAGCAACTGGATAAGTTTTGTAAGATAGCTATGGATGG CAATATAAATTTTACCCTCTTTCTATGAACGTGTATAGAAACGTACATGT ATGTAAAACAGCTGGTACAAAAACTCATTTCATTCAGCAGTGCAGCCAGG AAAATGGTGACAGGAGATTGTGAGGAGGTTTCTCACTTCTTAATTATTGA CACTTTCTTGAGTATCTTTCTTAAGGTTCAACACATTGATGATGGTCACA AAGGCAGTTTTCTTGTGAGCTGTCTCTTGGCTATTCTGTTAAGTTTTTCT GTGAGTTTTGTCTTTGCTAATGATTCATTTATTTATTTATTTATTAGACT TCACAGAGTGAAATCTGAGAGGTATTGGCAACATGATCGATGCATCCTGT TGCTATTAGTTGTGTCAGGATGTAAGGTTTAAGGTAAGGTGACTCTTTGG CTGATCCTGTTTTCAGGTTTAGGAAACTTACAGTCATTTCCAAGTCTTGG AAACTTACAGCTGTGTTGGTTATCCTGTAAAGTTTTTGGTTGACAACAAT ACAGATAGCTGAAACCTACAGCACAATTTAAGTTTCAGAAAACTTACAGT ACAATTTCAGGTCCAGGAAAGTTACGGCTGTGTTGGTAACTTGTAAAGTT TTGGTTAACAACAATATCAGTAGCTGTTATATATTAGGGGATATTAGCTG AGGTGTCTCTTGCTAATCCCCAGGAAACTTACAGCCCATTTTCAGCTTTA GAAAACAGCCCATTAAATTGAGTCACATGGGAGGGGGTTAATATCAGGGG ACAGAAACGCACATTTTGCCTCGTTAATAGGAATTTTTATGAAGAAGTTC GCAAATTATTGAATCAGACTCTGGCCTTTGATCCATTATTCAGAAGGAGT TCTCTCGGATGGAGGCGGAAATCTAATTCTGATCGGGTTGGATGCAGGAT GTAGTTGGATAACGCGATTAGAGTTTTATAACTCTGTTTTGTAGTCCGTA ACTTTGCTCCGTGTCGGTGATTAGCTGGGTTGGCGTGGGTAGTGTTGGGG TTCTTGTCTGGCCACATCACCGGTGCTGGGATAGTGGGGCTGGTTTGGAA CCAATGCTGTGGTACTTTGGACAGATTTGGCACCGACATTTTGGAACCAG TGTTGTGGTACCTCAGACACCAGGAGTGTTGTGGTACCTCGGGCGGATTT GGAAACAGCACTGTGGTACTTTGGACAGATTTGGTACCAACATTTTGGAA CCAGTGTTGTGGTACCTCAGACACCAGGAGTGTTGTGGTACCTCGGGCGG ATTTGGAAACAGCACTGTGGTACTTCAGACAGGTTTGGCACTGGGAGTGT TGTTGGGAATATTGTGATGCCACAGACGCTTCAGACGGTGCCATGGGATT GATGTACATGTTGGTGGGACTACGGTGTTGGCAGTGTGGGGACTTTGTAA CCTCCAGCCAGTGCCAGGTCTGATGACCAGTGTGTTTATATCAGCTCCCC AACCCTCAGACTTGCTCCTCCTCAGCAGAACTGACTATTTTTTGGCTCAT TGAATTTTTTGGACCAACTTGTTGGTAGATAGGCGGGTCAGAAAAGGTTC AGAGATCAGGTGCTCACTTCACTTGGCACTTCAAGAAGCTCAAGGAGCTG CTTCTTCAAGTGAAAGTGAAAGTTGTAAGCAGGTAGAATGAAGAGAGTCC TGCAGAGGCTCCTGGGGCGTGGCCCACGGGTCTCCACGACAACGGTTGCC GTGCAACCGGGAGATCTCCCGGAGAACATCCTGCCGTTCGGGACACCGCT GAACTCCAGTGCACTGGCGGTGTTCGCACATGACCCGGACATCCCCGACG ACCGTTTCCGTGGTGATGGTCTCCATGACGATGAGCTGAATGGCGTTCTG GCCACCATGATGGTGAAGCTGGACGCGCCGGAGGAGTTCTCGGACAACGA GTCTGTCCGCGGGAAAAACGACAAGAACAAGGAACGCGACAGTCGCCATG GCAACCAGGGAGGGAGTTGCCACGGCAGCCCAAACAGCTACGACGGGGAC GAAAGCACTGTCAGCTCCCGTCACTATAGCAACACCATGGCAACGTTAAA CAACAACAACGTCCCGCCCCCACGGAAGGAAGACCGTGACCGCAAGTCTC ACATCTCGCGGTTCGCAAACGAGACGACGGCGCACGGGTTCTGGCACGTG TTCCCGCCGGGCTACGCGGCGGGGTGCGCCGGCTGGACGGTCCAGCGCGC GGTGTGGGCGGCGCTGTTTGCCTGGGGCGTGGCCATGTTCCTGTACATGA AGATCGTCCACATCCAGATGTACTTCAGCTTCCCCCACTCCACCATCATC GACGAGGGCGCCTTCCACACCGACCGGTTCCCCGCCATCACCATCTGCAA CCTCAACAAGTACCGCCTCAGCCAGCTACGCAACTCCGACTTCTGGCACA TCGGCCGGTCCCTCAGCTACCTGGACGCCTCGCGCTCCCTCCGACCCGAA CCTCTCATCAACCGCACCCTCCCCAAACCCGTCCCTGCCTACACAGACCC ACAGAACCTCGCCGTGCTCTCCAACCTGTCCGACTTTCCCGCGAACTGGC GCGAGAACCCGCCGCCCTTCTGTCTGCTGGACGCCCAGGACCGCGCAGGG CATCAGCTGGAGGACACGGTCCTGGACTGCCACTATCGCGGAAAGAAGTG CTGCAAGGACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTAC TGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTANTGCAAGTTTC GCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGC AGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCC GGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCA TTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGC GGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAG GAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGG TAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATT GACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGG GAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGA AATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTA AGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGA CATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGA AACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAA TGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAG TACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACA TGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAA CCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATG CAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTA CCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATG TTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACC CTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCA AGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACC TTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTT CACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCT GCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAG TTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTT TGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCA CTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGC TGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTT TCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTG GCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACT CCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTG CATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTC GCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGC AGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCC GGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCA TTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGC GGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAG GAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGG TAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATT GACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGG GAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGA AATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTA AGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGA CATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGA AACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAA TGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAG TACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACA TGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAA CCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATG CAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTA CCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATG TTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACC CTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCA AGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACC TTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTT CACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCT GCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAG TTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTT TGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCA CTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGC TGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTT TCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTG GCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACT CCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTG CATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTT GCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGC AGGAAATGCAAGTTTTGCGGGAAACCGTGCTGTGTCGACATGTTCACTCC GGTGAGTATTTTTGGCAGGAAGTGCAAGTTTTGCTTATTGTCCTGAGATA GCTGGCGTTGCTCTTGTATGGTTACTGCAAAGGTGTGCAGAATGAGATGT TTAGCTGTGGTCGCTGGTCATTGTTGTTGCTAGAATGGGTCAGAATCTAT CTGGCATTTCCGTAGGCTGTGTCATAGGACAGGCATATGCTTGAACTTTC ACCCTGTGTCATAGGACAGGGATATGTGTGAACTTTAACCCTGTACCATA GGATAGGGATGTGTGAACTTTAACCCTGTGCCANTTCAACCAGCCCGAAA CGCCTCCTCATGCCAGCAACACAGCCAAAACTGAAAATTGAGACAAAACC AAAAATTGAGCCAAAGTTGTTAATGGAGGGCAAACGGTCGGATCTGACTC ACTTTGCCAACAACTCGACCCTGCATGGTCTCCCACGGGTGTTCCCGGAG CAGAGTAAAGGCTGGGACGTGCGGCGCGGCCTGTGGGCGGTTACCGTGGT TACGATGATCCTGGTGTTCCTGTACTGGGGCGTGAGCCACATCGGGACGT ACTTCCGTTACCCGGTCACCACCAAGCTCCATCTGCAGGAGGCAACCGAG TTGTTTCCCGCCGTCACCATCTGCAACCTGAACACCTACCGAGTCTCCCA GCTGACCCCGGACGACCTGTACAGCTGGGGGGAGCTGATGGGCATCCTCC ACCCCAACAGGACGCTGAGGGACCAGGGCCTGCCGTACTTAAACAGCAGC GAGGAGAGAATCCTAGAGCTGGCCCGGTTCTCTGAGAAACGGCACGAGAA CGTCTCGCTGTGGGAGGTGCAGAACCGCACCGGGCACGATCTGGGAGACA TGGTGAAGAGATGCACCTTCCGCGGGGAACCCTGCACAGCAAACATGTTC ACNCTTTGGGGGAAGGAGGGGGGATACTGCTGTGTGTGTGTGTGGGGGGG GGGAACTGTTGTGTTCTCTAACAAATAGTTTGTCTAAATTGATATACACT CCCTTACTTTCTGCCAAAAGGCACTTGTTATCATTGTCGATGCTACATTT ATGACTAACATCCCCCCCCCCCCCATGCGCTGTGAGTGGCCTGGAAGGTC CACAGCCCCCCCCCCTGTACCAGGGGGGTGTTTTCATGATGACTCACCCC CCTGTACCATGAGTGGCCTTCACTCCTATAATGCCCCCCCTCCTGTACCA GGGGGATGTTTTCGTGATGACTCACCCTACATGTACCGTGAGTGGCCTTC ATCCCTGTAATGTACACCCCCCATGTACCAGGGGGTGTTTTCGTCATGAC TCATGACTCACCACACCACTCCCCCCCCTGTACCATTAGTTGCCTTCATC CCTGTAATGTCCCCCCCCCCCATGTACCAGGGGGNACTGAAAATTGAGAC AAAACCAAAAATTGAGCCAAAGTTGTTAATGGAGGGCAAACGGTCGGATC TGACTCACTTTGCCAACAACTCGACCCTGCATGGTCTCCCACGGGTGTTC CCGGAGCAGAGTAAAGGCTGGGACGTGCGGCGCGGCCTGTGGGCGGTTAC CGTGGTTACGATGATCCTGGTGTTCCTGTACTGGGGCGTGAGCCACATCG GGACGTACTTCCGTTACCCGGTCACCACCAAGCTCCATCTGCAGGAGGCA ACCGAGTTGTTTCCCGCCGTCACCATCTGCAACCTGAACACCTACCGAGT CTCCCAGCTGACCCCGGACGACCTGTACAGCTGGGGGGAGCTGATGGGCA TCCTCCACCCCAACAGGACGCTGAGGGACCAGGGCCTGCCGTACTTAAAC AGCAGCGAGGAGAGAATCCTAGAGCTGGCCCGGTTCTCTGAGAAACGGCA CGAGAACGTCTCGCTGTGGGAGGTGCAGAACCGCACCGGGCACGATCTGG GAGACATGGTGAAGAGATGCACCTTCCGCGGGGAACCCTGCACAGCAAAC ATGTTCACACCTGTAAGTAACACCTGCAACGCAAACATGTTCAAACCTGT AAGTAGCCTCACACCTGCAACGCAAACATGTTCACAACTGTAAGTAGCTC AAACACTGCCTCCTAAAAACGCTAAGAACGTAAAACACAACCCATTTAAA ATGTCAAAAAACTGCATCCTCAAAACAGCAAGAATTTTAAACATTGCTTT GCACTACATGTTTCCTACCTCTGAAGTTAGGCTTGTCAACTTAGTCTGTT ATGAAGTTTTATAGTGTAGATTTCCAATAACTGTTTCTGGCACCCCCGAG AGGGCTTTCAACATACATTGTAGATATGGATACGACGATGAAGGCTAGAC ATCCAGGTAGTTGGATACACAATACAAATTTGAGTTACTCAAGCAACTGG ATAAGTTTTGTAAGATAGCTATGGATGGCAATATAAATTTTACCCTCTTT CTATGAACGTGTATAGAAACGTACATGTATGTAAAACAGCTGGTACAAAA ACTCATTTCATTCAGCAGTGCAGCCAGGAAAATGGTGACAGGAGATTGTG AGGAGGTTTCTCACTTCTTAATTATTGACACTTTCTTGAGTATCTTTCTT AAGGTTCAACACATTGATGATGGTCACAAAGGCAGTTTTCTTGTGAGCTG TCTCTTGGCTATTCTGTTAAGTTTTTCTGTGAGTTTTGTCTTTGCTAATG ATTCATTTATTTATTTATTTATTAGACTTCACAGAGTGAAATCTGAGAGG TATTGGCAACATGATCGATGCATCCTGTTGCTATTAGTTGTGTCAGGATG TAAGGTTTAAGGTAAGGTGACTCTTTGGCTGATCCTGTTTTCAGGTTTAG GAAACTTACAGTCATTTCCAAGTCTTGGAAACTTACAGCTGTGTTGGTTA TCCTGTAAAGTTTTTGGTTGACAACAATACAGATAGCTGAAACCTACAGC ACAATTTAAGTTTCAGAAAACTTACAGTACAATTTCAGGTCCAGGAAAGT TACGGCTGTGTTGGTAACTTGTAAAGTTTTGGTTAACAACAATATCAGTA GCTGTTATATATTAGGGGATATTAGCTGAGGTGTCTCTTGCTAATCCCCA GGAAACTTACAGCCCATTTTCAGCTTTAGAAAACAGCCCATTAAATTGAG TCACATGGGAGGGGGTTAATATCAGGGGACAGAAACGCACATTTTGCCTC GTTAATAGGAATTTTTATGAAGAAGTTCGCAAATTATTGAATCAGACTCT GGCCTTTGATCCATTATTCAGAAGGAGTTCTCTCGGATGGAGGCGGAAAT CTAATTCTGATCGGGTTGGATGCAGGATGTAGTTGGATAACGCGATTAGA GTTTTATAACTCTGTTTTGTAGTCCGTAACTTTGCTCCGTGTCGGTGATT AGCTGGGTTGGCGTGGGTAGTGTTGGGGTTCTTGTCTGGCCACATCACCG GTGCTGGGATAGTGGGGCTGGTTTGGAACCAATGCTGTGGTACTTTGGAC AGATTTGGCACCGACATTTTGGAACCAGTGTTGTGGTACCTCAGACACCA GGAGTGTTGTGGTACCTCGGGCGGATTTGGAAACAGCACTGTGGTACTTT GGACAGATTTGGTACCAACATTTTGGAACCAGTGTTGTGGTACCTCAGAC ACCAGGAGTGTTGTGGTACCTCGGGCGGATTTGGAAACAGCACTGTGGTA CTTCAGACAGGTTTGGCACTGGGAGTGTTGTTGGGAATATTGTGATGCCA CAGACGCTTCAGACGGTGCCATGGGATTGATGTACATGTTGGTGGGACTA CGGTGTTGGCAGTGTGGGGACTTTGTAACCTCCAGCCAGTGCCAGGTCTG ATGACCAGTGTGTTTATATCAGCTCCCCAACCCTCAGACTTGCTCCTCCT CAGCAGAACTGACTATTTTTTGGCTCATTGAATTTTTTGGACCAACTTGT TGGTAGATAGGCGGGTCAGAAAAGGTTCAGAGATCAGGTGCTCACTTCAC TTGGCACTTCAAGAAGCTCAAGGAGCTGCTTCTTCAAGTGAAAGTGAAAG TTGTAAGCAGGTAGAATGAAGAGAGTCCTGCAGAGGCTCCTGGGGCGTGG CCCACGGGTCTCCACGACAACGGTTGCCGTGCAACCGGGAGATCTCCCGG AGAACATCCTGCCGTTCGGGACACCGCTGAACTCCAGTGCACTGGCGGTG TTCGCACATGACCCGGACATCCCCGACGACCGTTTCCGTGGTGATGGTCT CCATGACGATGAGCTGAATGGCGTTCTGGCCACCATGATGGTGAAGCTGG ACGCGCCGGAGGAGTTCTCGGACAACGAGTCTGTCCGCGGGAAAAACGAC AAGAACAAGGAACGCGACAGTCGCCATGGCAACCAGGGAGGGAGTTGCCA CGGCAGCCCAAACAGCTACGACGGGGACGAAAGCACTGTCAGCTCCCGTC ACTATAGCAACACCATGGCAACGTTAAACAACAACAACGTCCCGCCCCCA CGGAAGGAAGACCGTGACCGCAAGTCTCACATCTCGCGGTTCGCAAACGA GACGACGGCGCACGGGTTCTGGCACGTGTTCCCGCCGGGCTACGCGGCGG GGTGCGCCGGCTGGACGGTCCAGCGCGCGGTGTGGGCGGCGCTGTTTGCC TGGGGCGTGGCCATGTTCCTGTACATGAAGATCGTCCACATCCAGATGTA CTTCAGCTTCCCCCACTCCACCATCATCGACGAGGGCGCCTTCCACACCG ACCGGTTCCCCGCCATCACCATCTGCAACCTCAACAAGTACCGCCTCAGC CAGCTACGCAACTCCGACTTCTGGCACATCGGCCGGTCCCTCAGCTACCT GGACGCCTCGCGCTCCCTCCGACCCGAACCTCTCATCAACCGCACCCTCC CCAAACCCGTCCCTGCCTACACAGACCCACAGAACCTCGCCGTGCTCTCC AACCTGTCCGACTTTCCCGCGAACTGGCGCGAGAACCCGCCGCCCTTCTG TCTGCTGGACGCCCAGGACCGCGCAGGGCATCAGCTGGAGGACACGGTCC TGGACTGCCACTATCGCGGAAAGAAGTGCTGCAAGGACTGGTTCAAACCG GTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTG GTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCG GTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTG GTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCG GTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTG GTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCG GTAAGTACTGGTTCAAACTGGTTGGTACTGGTTCAAACCGGTAAGTACAG GTCAAAAATGGTTAGCACTCTTTCAAACTGGTAAGTACTGGTCAAACCAG GTTCAAACTGGTAACTACTGGTAAGATTCAAGGCAAAATTGGATGTGACT CGGCAAATAGACAGAACCCATAAACAACCCCAAACAGTTTGACCTGTCAT TTCCCCCCCAAGTTATGAGTATCTGTTTCTATATCTTTATAGACGGTATA TCCACCCCTCTGCATAACACACCAGCTTCTGTATCTGTATATCCGGTATA ACCGCCCTTTGGCGTAACACCCCAGCTTCTGTATCTGTATATCCGGTATA ACCGCCCTTTGGCATAACACGCCAGCTTTGAGTAAATCTGATCAGAGCAC ACGAGTCGTGCTGATGACAGATTTGTCCTTGACATTTGCAGCAAATTGGA AAATCTTGACCCCAAGTTGACCCTTGACATTCCTTTGTCAATATCTCTGA CTGGGGTTAAAGGTCGCAATCACAGCCCCTAAATCAGCTTGGAATCCTAA CATGGTGCCAAAGGATCAAGTTTCATCTGACAGACAGAAGGTCAACAAGC GCTATGTGTCAAGGTTATTTACTTAATCCCAAGTCACTGCAAGGTCACCT GGGGGTCATTGGGATGTCGCCAAGGGTAACGTTGCCATGGTTACATCTAT AAGAGGATATTTAGGTAATCTAAAGATTGAGCTGAGCAATCATACAGTGT TGAGGGAAATGCTTGTAATAAGTTGTAGGTCATTCAATAAATCAAGTTAC AGATTGGGGAAAAATAGGAGTTTGCAGTGTCTGCATCCCACTTGGATAAA TAGGCTTTAGAACAATGAAGATAGTGTTAATGAATTGGAAAATGTGTTTT TAGTGGAATATTGTTGAACAGAAAATTTTCTGCAGTCTGTTTTTGTCTGG ATTTCTTGAAATGTTTCTGTGGATCTGTGAAGTTCTGCAGAATATGTTAT ATTCTGAACAAAACCCCATATTGCACCCCGGGGGTATTAAGAATAGGTGG TGCAGGTACAAACAAAACTGTTCATTCTGGTTTGATAATGTGTGAAAGCG AAGCCCTGCTGAGCTGTTGGTTGTAACATGGTCATGTGATGCCCCCTAAC AGTTAGAGCTGGAACTGCACCTGTATTGTATGTCTGCTGTGGAGAAAACA CTTTGCCTTTTCCTGACCACACATCAAGTCAAGTCAAGTCACGTCAATGC CTTTATTTTGCTTTTAGATACTTTTTTGGCTTACGCAGCCACTTTTCAAC ATTTTGGCGGGTAACGGACAAGAGTGAAAAAATGTACATGTACCCTTCAG CATAACACACCAGCTTCTGTATCTATATAGCAGGTATAACCGCCCTTCAG CGTAACACACCAGCTTCTGTATCTGTATAGCTGGTATAACTGCCTTTCAG TATAACACACCAGTTTCTGTATCTGTATAGCTGATATAACTGCCTTTCAG TATAACACACCAGCTTCTGTATCTATATAGCCGATATAACTGCCCATCAG CATAACACACCAGCTTCTGTATCTGTATAGCTGGTATAACTGCCTTTCAG TATAACACACCAGCTTCGCAGGCTTGCGGCGCGGCAGCAGACCTGTCACA CCTAACCTTTGCACATCTAACTGCCAGCATTCTTTAATGTGTCTACAGTA CTTGTTGGCAACGAGTTCCACTCTACGATTCGACTATTTGAACACATCAA TCCTAGGTTGTAACTTTGGTACATGAACATGGAGGCATGGAGTTTGACTC TCCGATACGAATATTTGAACACATCAATCCGAATATAACTTTGGTACATG TACTTGAAGGCATGTCTATATTTCTAGGTTGTAACTTTGGCACATGTACT TGAAGGCATGTCTATTTCTAGGTTGTAACTTTGGTACATGTATACTTTGA GGCATGTCTATTTCCTGTTCCCAATATCACAGTGGGATCAATGTCAAGTT TGCCGGGAGACAATCTCAGACAAGGGGCTGCCCCGACGGCGAAACCCCGT CAGAAACCCGCCAAATCTGTTTACAACGGAGACGGCCCGACTGGTGGGGG CATCGGCTGTATCCGATCCAATTTGGGGCCTGCGCTCTTCCATGTAATAA GGTAGTCAGGAATCGATATGTAAGCCCAGGGCCTGCCACAGGCAGGAGGG AGGGTGGTCAGAATGTCTGCCGATTTGCAGGGATGAGATTTACTGTCATG AGCCAGATGATGATTACTTCTATTGAGTCCGGTTAACTCAGTCAACTACA GCCCCCCTGGGTACAGGGTTGGTGCAGTCGGAAAAATGCGCAAAGGTACA CTGAGAACCCCCCAGAAGTTCACTGTTACACCCCCCTGGGTTCATTGAAG ACCCCACAAGTCTATTGTTACAGCGGGAAGGGTGGTCAGAATGTCTGGCG ATTTGCAGGGATAAAATTTACTGTCATAAGCCAGATGATAATAACTTCTA TTGGGTCTGCTTAACTCAGTCAACTACACAACTACAGCCCGATGGGTACA GGATTAGTGCAGGAGGGAAAATGCCCAAAGGTTCACGGAGGACCCCCACA ATACTACTGTAACACCCCCTGGGTCCACTGACGACCCCCCACAGGTCTAC TGTAACACCCCCCACTGAGGACCCCCCACAAGTCAATTATAACACCTCCC TGGGTTCATTTAAGAACCCCCCTGTCCACTGTAAACCCCCCCTGGGAATA GTATTTGTACAGGAGAAAAATGGCCAAATGTCCACTGAGACCCCCCCCCC CTAAATGAGTAACTCCCCCCTGCACAAGTCCAGTGTTACTACAGTACAGG AGGGAAACTGCCCCAGGTAACCCTGATGTTGTGGTACAGAGGAAGCCTGC TTTTGTAGTACATGGGCTCCCCCTGCTGGATAGCTGCAGGACTGCAGTTG TACAGACTGTAGGGAGAATCTCAAGTGACACAAAGACTCACTTGCATGAA GCACTGTTGCCTATATATGGGGATTAGTCATGTCAGGCATTTACAAGTGC AGCCATGTTGTTTAACCCTCTTCCTGCAAAGTCTACTTACGGCACTAAAT TTGTATTGGATTCAGGGTTAGGCAGCAGAGAGAAGGTTAATGTGCCATTT CTAAGTCAACTCAATGCTTTTTAACCTTCTCCCTGCTGAGTATCCCTTCG GCACCAAATTTGTGCTGGGATACAGGGTTAGTTTACAGGGAGAGGGTTAA TTTGCCATGATTGTAAAGTCAACTGAATGCTGTTTAACCTTCTTCCTGCA TAAGTAGCATTTTGCGACCAAATTTGTACTGGATTCAGGGTTAGTTTGCA GTGAGAGGGTTAAAGTGCCGACGTTGATTCCTGTCCTGTGTTCACGCTGC CTCATGATTCACCAGGAATTCTTTTCCTTTCTCCCCCTTTGTGCTGTCAC CCTGATGCGGTCTCACACCGATGTTTCTCCTACTCTGCGGTCTCACATTG CTGTTTCTCCCACCCTGCGGTCTCACACGGCTGTTTCCTGCCCTCCTGAT GCTCGGATCTGTAGGTGAGTAAACGTGGTGATTGTTGGTAACTGCTTGAA TATGTCTGTTTTCTTGTGTGACCTCTGACCTCTGACCTTGAAATGAATCG TTGCTCATCTATTCTACCATCCAACCACACACCAGGAAACACGGCTTCAC TGACCAATCAGAGATAGGGTCAAATGTCATTTCAAGGCTCGGCTGACTAA TCAGAAAGAAGAATTGTGAAATCAGATCATTATGTTTTCAAATTTCTTCT TGGAATTTCTGGAAATAAATCCTGCTGAAAGGACTTTTTTGTATTTCCGC TCATCTTGTGAGGTGCCAGAGTCTCCCTTAGACATCTTCAAATTTAATAA AAGTGGAAAAGCAAGCTTCTTATTGAACACCTTTAAACTCAACCACAGTT GGGAAGTCACAAAAGTTGCAAAATATCAAACCCTGCATTATCAAGAAAGT GTGTTTCGGCATCAAAGCAACATGAACTGTAGTAGAGAACAACACAACCT GGTTTGGTCAGGATTTTTCTAGCCTTAACTAGTGTTCCCCCTGGAGTGTG GTGGATTGTTCTGTATCTATATAAATGCGCTCTTGTACTAATGACTTCGT CCTTTAAGATTTCTCATCTTTCTTGTAACCTGTGGAAATCTGAGATGAAG AGATCAGCGGATGATTGAAAAATTGGGAGCAAATTACAAAAGTGGAAAAG CAAGCTTCTTATTCAATACATTTTAACTCAGAGAAGTTGTGAAGTCCAAA AAGTATCCAGCCCTGCTTTCTTCTGCTACTGAAAATTAAACCAGTCTTGT CACCTGCAACCCAGATGAAGATGGCGTCTTGGTAAACTGGGTATCCAAAG TTTCTGCCAGTTCTTCTCTTAACAGAACCCCAAATAATAAGGAAAAATCC ATTCTATTCCATTTTTTATGGCTGCAGAAAGGGAAAATGAAGTTTTTCAT TTTCCAAACTTGCAGCTGTTTTGGCTAGTTTTTTTAGGAATTTAAGACGC TGTAAATTTGGTATCTACGACATCTCAGAATTTCACTCAGAGTTTTCCTT GGTGTTCGACATGTTGCTGCGCGGAGAATCCTTGTTCTCTCGTGACATTT ACTTGGCTGCGCTGCGATAGAAACTGTTCCTGCTGCATTTTGCGTCGCAT AATGTGCTGCCTAGGAAAACAGGCCGCGATATTTTTACTTACACATGATA CGTTTACTAATGATTGTTCACATGTTACATCATTGTTTACTTGTTACATG GTTATTGTTGCCATGTTACATGAGAATTGTTCACATGTTGCACATGATAA TTGTTGGCATGTTACATGGTTATTGTGCACATGTTACATGATTAATTAGT TATTACATGATTGATTGTTGAGATGCTACTATCATGATGGCTATTCTTGA CATGTTTCATATTTATTATTTACATGTTACATGTTGATTATAGGTTTATA AAAGTGATTGAATTGAATGAATGAATGAATGAATGAATGAATGAATGAAT GAAAAAGTAGATGTGTTGTTGTGCATTTGTGCTCTCTGATAAGTCTGATG AGGGGTCTGTGATTGACAGGAGTCAGTCTTACCTTTGATTGACAGGTGAC AATCTGACAGTGCTGTCATGTCAATATATAAGCACTTGTTTTTTATTTTA TTAAATTTTCAGACAGCTGGGTAGCCCATTCAATTTTAGCAAATAGATTT TCAGTTGGGTCCAGACTATAAAACAGTAAAATCATCAGTATAGCATGGAA AATGAACTTATGACAATTGTAACATAAGTAACACTACAGACCATCTATAT AATGCACTGTGCCATTGCCTGGTACATTCTGAAAAAACAACCAGTTTCCC CAAATCTTCAGTTATCACAAAAGAAAGCTTGGCACTGCATCAATCACAGA GACAGAACTGTTTTTTGTGTGAACTTCAGGCCATTCCAAGTTTTTTCCTT GTGTCTCAGATCCCACCTTCCATTGCTGAGGTCCACAGTTGTACCTTCAA CCAAGAAACTGTGATTGGATTTCACAAAAGAAGCAGTTGTGATAGATTTT TAAAAAGAACTGACATTTTATTCAGTTTACTCATAACGCATTGCATGCAT CATACCCATGATGCAATAAAAGATTGTGCCACCATCTTGGATTCCCTTTG AAGGTGACCTTGTGTGGAGCAGACATTGAACCTTTTATTTTGCCATAAAT TTAATTTTTTTTTAAATTTTTGGCTACATCTATTGTAAAAAAAGCACCCC CAAAATGTTTTACTGGTACTGGTACAGACAGTTTCAGGCCATTTTCTTTT GCCTTTTTTTGACTCAAAACCATCTGAGAACTAATGGAATAACTTGGTGT GGTCTGACTAGAAAGCTTGTCAAGAGGAACAAAGGTAGGTGAGTGACTTT AAGAGTCTACTTCAGAAGACTTGGACCATTAGAAGCAGTCTCGGTAAGTA GGTCTTAATTGTATTATTAGATATTTGGGAAATTTTGCACCTTAGCTAGT ACACATTGAGAACTCATCGTACCTACATACCAGATCTATCTACAGGTATA GGCTGGTCCCATAGCTACATATCAAATCTATCTATGTGTAAGGCAGTAGA CTGATCTCATAGCCCTGACCACAGTCACAACTTATGCAAGACAAAAACAC AGGAAATCAAAAAGAAATGTGACTGACATGAAGCTAACTGCCTTTAGGCC CCCTACTATCAAATTCATGTGGCCAAGGTCTATTGAAATGGAGATGGGCG CCGCCCTAAGCACCATCTTCTGTGGGAAGGACTTTTAACTAGCATGTCTG TAGTGTGTACATAAACATACATCTTATACCACATGATACCTGCTCGCTGC CGCAGCTTCATATTTCCCCATTCTGGTCAGACCACCCTGCCGAGCCTGCC TGTGGGTGGCGGAGCTGAAAGCTCATTTTCAGTTCTTAATGACTGTTTAA GTGAGCGGGGAGGAAGCATTGACGTGCGTCAGGCAGCACGCCAGCCGTGA AGGTCACGGAACGAGATACGGGAGGCCTCGCTGATCTAGGTGTGCAGACT CTCATCTATTTATTAGTTTGAATATTGGACTGTTGGGCAACACAGGAGAT CTGACAACCAGATTTCTCCTCCCTTCTTGGTCTTGTTTTTCTTAGTGTTT CATCATCATCATCATCCGTCGACCTCTGCAGCAGAGGACGGGGCGAGCCC TTGTACAACCGAGGCCCACATCAGTCTGTCTGACATGGCTGCTCCCAAGT CCTCCAACTCAATCCCTGTGTCCCTTGAGATAGTCCTTGGGAAGGTCAGC TTCCTGGAGTGTGTTTTCCCGTGTGGTTTCCACAGTGTGAGAGATGAGAC AATCTCCTCGCTGGCCCGATGGCAGTGGCCAGCAAACCGGACTCGTCTCT GTTTTAGTGTTTATCTTAGGGCCATGTCAGTCCATTCTCTATCCTCCCAT CTTTTCCTGCCTCTCTTTTGTCCCTCCCTGGATAGTTCATGGCATGATAA ATGTGACTTGTCCCGATGACCGTAACACATGACCGTACCACTGCAGTTTT TCCTTAGGGGGTTAATAGGGCTTTGTATAGACCAATGTTTTGCTTGACTC TCCTCTGTATGTCAGTATTTGAGATGCAGTCTCTGTATGTGATCCCCAGA ATGTTCTGGAAGCATTTCATTACTGTTGTCTGGATTCTTGAGTTTTTCTG TCATAGTCCAGGAATCACAAGAGTACAGGAACACAGAGGTGAACAGGAAA AGTAACCACGCAAACACATATGTAATGTTACATGTAATAATTTTCTACTG TCCACTTTCTGAAGTGGCAATGTTGAGGGATGAGGTTGATGATTGCAGAC AGAGCTGCCACCTAACGTTTGCCTCCAGAATAGCAGCAGCTGACCTTGTT CAGTACTGCCCCCTAGCAAGTGTAGCAAGTACTGCAGCTGTGGCCCACTC ATGCCATGACAGAATTGCAGCCCTGGCTTTCAAAGTGGTCAATAACTTTG CTGTTGAGCACAATATTGACCAATATATCTAAAAGCATCTCTACCTGAGT CTGCTTCAGGCAAAAATCATCTTACAATTCTGAAAAAGTGAGGCAAAACT GTTAAGATCTGTTCTGTCCTTAGTGCTGAAGTCATGTCTGGTTTTGTCCT TAGTGCTGCACTCATAACTGTTAGGATCTGTTTTGTCCTTAGTGCTGAAC TCATGTCTGGTTTTGTCCTTAGTGCTGCACTCATAACTGTTAAGATCTGT TCTGTCCTTAGTGCTGAACTCATGACTGTTAGGATCTATTCTGTCCTTAG TGCTGAACTCATGACTGTTAAGATCTGTTCTGTCCTTAGTGCTGAACTCA TAACTGTTAGGATCTGTTTTGTCCTTAGTGCTGAACTCATGTCTGGTTCT GTCCTTAGTGCTGAACTGATGACTGTTGTGATGGTTTCTTTTCTTCAAGG GGGTTAAGTATCATTTAGGTGTGTGTGTCTAACATTGCATAAGGGTGTGA AGTGTAGTTATTGTTATCACAGAATAACTAAGGATCAGTTTGTTTGGACG TTATTGGTATCTGCACGAAGAAAAGCAACAGAGAATGAAATTGCCGGGAC TTGATAAGTAAAACTTTCTCATGCTATAGAAGTCTTTAAGTGTGAGGAAG GGTTGTCAGAGTAGTTTGTAGACGTCTGTAACTTTAAAGCAGGAAGTATA AGAAGCCGTTGACGTCTGCCTGTCTGCAACTTTAAGGGGATTCCGCCCGA GGGGCCAGAAGTGCAAGGTCAGCCTGACCTTGCCATGATCGAAAGCAAAT AAGCTATGAATAGTCAATGTGCAGGGGAGGGGGGCACCTCAGACCTCAGT GTTTGGAACAGCAAGGGACTGTCTCAAAACTTTGATGTCTGAAATGGCCA GGGGCAATCTCAAAACATTCATGTCTCGAACGGCCAGGGAAGATCTAAAA ACTTAAATGTCTGGAAGAGGCAGGGGCAATTTCAAAACCTTTTAAAGGCT TTTCACACATTTCAAAACAGAATGTGGGGAACCCGTTTCTTTGTGCTGCA CAATTATGTATCAACATTACATGTCACAAAACATCCCATGCAGGCAAAGA AACATTCAGTCTCTTACCCTGAATTGGTATAGATTGGTACAATTCTATCC AAGAACGATTACATACAAAGGCACAAGAAAAAAATGCTGACAATGCAATG ATAAGGCAAGGAAAAGTTTATCTATTGTCCTTTAGGATGATTCCAAATTT GCCATGATGGTACATTCCTAGCTTAAGCACCAGCCCTGCTTATGTTAGTG GGGTGCAGAACAAAGATATTGAAATCAGCCCCCCTGGCAACAGTGTTGGA CGTTGGCAGAGAATTTTCAGCACATTTTGGGGGGCAACTCACTTATGGAA TCAACCATGCTGTGTTTCGTTCGTTGATGGGAGAATGAGATGGTATTACC TCTGGCAAGGCGCATCATACTCACTTCCCCGCAGTCAGAGGAAGTCATGT TTGATATGAATGCGATCGAAGAAAGCGGTCCCTGACATGTCAGACTTTAT ACCCTCCCTGTGAAGATGCAATTCCATTCCGTGACATTACACGCTACTTC CTGGCTGTGATACGGAATCGATCCTGACGTATCATGTCGTTCCTGCCTTA CAAAGTTGATCCATGTCGTTCCTGACGCACAAAGTGGATTCGTGTTCGGC TGAAAACATGAAACCTGATATTACGGCCGGCGCTACTGCTGAGGTCAGCA AGGTCGCGTGGCCTTGATTGTCCTTGTTCTCTCCATGCAGATAACTCAAG GTCAAAGTCACTTAGCTCATCTTTTTGACCTTGGCTGGAGCCATAGTCAG ACTACAAAACTTGCCGATTATTTGGAGAGTGGCTGCCGATAAATAGTGTA GCAAATTTTTGGGATTCTGGAGATAAACAGTGGCAATTTTGGGGAGAGAC TTACTGATAAACAGTGTGGCAATTTGTGAAGAGGCTGCTGATAAACAGTG TAGCAATTTGAGAAGAGGTTGCTGATAAACAGTGTGGCAATTTTGGGGAG AGGCTGCTGTTAAACAGTGTGGCAATTTGGGGAGAGACTTACTGATAAAC AGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGG GAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAA ACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTG GGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGAT AAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATT TGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTG ATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAA TTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGC TGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGC AATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCT GCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTG GCAATTTGAGGAGAGGTTGCTGATAAACAGTGTGGCAATTTGGGGAGAGG CTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTG TGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGA GGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAG TGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGA GAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAAC AGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGG GAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAA ACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTG GGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGAT AAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATT TGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTG ATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAA TTTGGGGAGAGGTTGCTGATAAACAGTGTGGCAATTTGGGGAGAGACTTG CTGATAAACAGTGTGGCAATTTGGGGAGAAGCTGCTGATAAACAGTGTGG CAATTTGGGGAGAGGCTTCTGATAAACAGTGTGGCAATTTGGGGAGACGC TGCTGATAAACAGTGTGGCAATTCGGGGAGAGGCTTCTGATAAACAGTGT GGCAATTTTGGGGAGAGGCTGCTGATAAACAGTGTAGCAATTTGAGAAAA GAGGTTGCTTTTGGGAGGCGTATGATGTATAATGAATATCTCTCAGCTTT GAGCAGATCATAGACTGACTTCTGTAGATTTTGGAATGCTCTAGAATGTG TAATTGTTTCTTAATTTTTAATCATGGCAAACATCTCTGATTTTAAACTA TGTGTGCCTTGCGTTAAATGTAATTTAAGGCATCATAGTGGATCAAATGG TCTTTTCGCCCTTGAAGTGTGCTTTCCTGCCCAAAGCTGGCTCCCTGTGC ACAGCACTGAGTGGTTCCTTTGATGTGAAGTTAAGAGTTTATTCCGGCAG TAAAACCTGTGAAATGTGAGCCATGAGTGAACGGAGTGATCAGACAGGGG GAACCTCGTAAAACATGGGTTAACGTTCTGTGGATGACAGCAACACCAAA TATGGTTAGTGTCTGATGGACTTATTGTGCACCAACACCAAATATGGTTA GTGTCTGACACTGCACCAACACCAAATATGGTGTCTGACAGACTTATAGT GTGCACCAACACCAAATATGGTTAGTGTCTGATAGACTTAGTATACACCA ACACCAAATATGGCTAGTGTGCACCAACACCAAATATGGTTACTGTCTGA CAGACTTAGTGTGCCACAACACCAAATATGGCCAGTGTCTGACAGACTAA ATGTGCACCAACACCAAATATGGTTAGTGTGTGTTGTGCGGCTTTATAGT CCGGCTGCTTTAAAGAGATCAAACGTAATGTCAGGTGGTTGCCGCTAGCG ACGGTGAGACCAGGGATGATGTGCGTTGTGATTCGCCGGCAGATTCAGAG AGATCAAATGAAAGCCATCTCAAAAGAAGCCTTTATGTTGTCGGGTCAGG TAGGATGGTTGCCCCTAGCAATGGTGGGACGAGGCATGGGCCGTATCGTG ATTCAGAGAGATCAAATGAAACGCAACTCAAAAGAACAAAGATGTTGGAG GGTCAGGTTTGATGGTTGCCCCTAGCGACGGTGGGACAAGGGATGGGCTG TATCGTGATTCAGAGAGATCAAATGAAACGCAACTCAAAAGAACAAAGAT GTTGGAGGGTCAGGTTTGATGGTTGCCCCTAGCGACGGTGTGCGGCCTGA TTGGCCGGCTGATTTATAGAGATCAAGCAGCAGCACAGAGGAGGCCATGA AAGTGAAAGTGATGTTGTAGGCTTGCCCCAAGGCTGAGAGATCCGCAGCG CGAACTCTCACTTTCATCCCAACAGCAACATTTATTATTTAATAGCTGGG ATTATCTTCACTCTCCTGGAGCACTTTCACTTTTCCCAATGTCAAGTGCA CGAAGCGGCCGTTATCAGAGCGCTGACAGGCGGAGTTCCTGTTATCTAAC TCGTGTGCTTTTGACTAGCGTCTGTCAGACGGCATTTGTGGTGTAGCAGT TTCTAAACTCACCTTAAATGGGTTGTGTAGCACTTTCTAAAGGGTGTTAC AGTTTCTAGAGTCCCCTTAAAGGGCCTGTGGTGTAGCAGTTTCTAGAGTC CCCTTAAATGGGTTGTGTAGCACTTTCTGCACCCCCCTAAAGGGTGTTAC CGTTTCTAAACTAACCTCAAAGGCCAAGTGGTGTAGCAGTTTCTGAAGTC CCCTTAAAGGGCCTGTAGTGTAGCAGTTTCTAGAGTCCCCTTTAAAGGGC CTGTAGTGTAGCAGTTTCTAGAGTCCCCTTAAAGGGCATGCGGTGTGGCA GTTTCTAGACCCCCCGAAAGGGGCAAATGGTGTAGCAGTTTCTCAACCCC CCTAAAGGTCTTGTGGTGTAGCAGTTTCTCAACCCCCCTAAAGGGCTTGT GGTGTAGCAGTTTCTCAACCCCCCTAAAGGGCTTGTGGTGTAGCAGTTTC TCAACCCCCCTAAAGGGCTTGTGGTGTAGCAGTTTCTCAACCCCCCTAAA GGGCTTGTGGTGTAGCAGTTTCTCAACCCCCCTAAAGGGCTTGTGGTGTA GCAGTTTCTCAACCCCCCTAAAGGGCTTGTGGTGTAGCAGTTTCTCAACC CCCCTAAAGGGCTTGTGGTGTAGCAGTTTCTCAACCCCCCTAAAGGGCTT GTGGTGAAGCAGTTTCTCAACCCCCCTAAAGGGCTTGTGGTGTAGCAGTT TCTCAACCCCCTTAAGGGCTTGTGGTGTAGCAGTTTCTCAACCCCCTTAA GGGCTTGTGGTGTAACGGTTTCTAGACCCCCTTGAGGGCATGTAGTGTAG CAGTTTTTGTTTAATTATTTCGCACAGGTAAAAAGGAAATGATACATACA TAATCAAAATGGTGCTGGGGAAAGTAGAGATCAATCTTATCTGTATGATT CCTTCTCCATTTTTCTTACCCCCTTAAGGGCATGTAGTGTAGCAGTTTCT AAGCAGTTTCTAGACTCCCCTGAAAGAGCATGTAGTGTAGCAGTTTCTAA GCTCCCCTTGAAGGGCTTCTAATGTCGCAGTTTCTAAATCAGGAGATCAC ATTCCCATCTTCATATCCTAACCCAAGTTTTATTAATGAATGTCTGACAG CCATGCTGGCCCCCCAGGCTGCTGGGTTAGGCTTGCTGTGAGGGAATTGA TTTTGGTTTACTGAAAAGCTTAATCCAGAAAGCAATATTATGTCACACGA ACTGATATGTGACGTCCTGATGACTGGAAAGGAAAAGCTTAGCGTTCGCT CAGGCAGGAATTTCTTAAGTAGATTTACCACATTTCAACTCAGGATCTTG TGGCATTTCTCATGTATATTTGCCCCATTTCAGGATCTGAAGATCTTGTG GCATATTTTATGTAGATTTGCCCCATTTGAGGATCTTGAGGAATTTCTTA TGTAGATTTGCCATATCGGAGGAACTTGAGGCATTTCTTGAGGCGCGTCT GTAAATCCTGCCGGGATCTTCGTGGCGGGAAGACGAATAGTTTTGTTAAA TATCAATTTTCCGCTGGTTGATTTGATGGCAGAGAATCGACCTGCCGTCT GGGCTGATGAGGAGGTCCTCAAGTGGGGAATAAATCTCCCCGAAATCTGA TCCCGCTGTACAGAAACCAAGCCCCATCCAAGATTTCAGAAATCTGATCC CCGTCTCAGATTACAGAAATCTGATGCTCATCTCAAATTACAGAAATCTG ATTCTCATCTCAAATTACAGAAATCTGATTCTCATCTCAAATTACAGAAA TCTGATTCTCATCTCAAATTACAGAAATCTGATCCCGTCTCAGATTACAG AAATCTGACCCCCATCTCACAGCACAGATTTAGTCTTTCCTGCAATCAGT TTTTCCAGGAATCAGTCTTTCCTTAAAGTTTAACCTAGGTGATCGGGAAA AACCGCTATTTGTTTTTATGGGGAAGGACAACAGGCCTAAAATGTGATGA CAACTGCATGAGCTGAACAAGATTAGAAAAAGGGTTGGATTTGTTACTGT TATGTCCCAACCTCTACATAAATCTGTGTAATTTGCTGCCAACTACAGGC ACAGTGGGATGGAGGGAGGGCAAACAGTGGGGACTTCTTCAGTCAGTCTC TTGAAAGAAAAATTTACAGTGTCTGCATTCCAGCCCAGCAAACTACAGGC AAACCAAGCTGTAGGACACCAACTATTCAGGGCAGTCTTTCCTGGAATTA GTTTTTCCTGGAATCAGACAAATTATTTGTAGAAATCTAAAGTGAGATCA CCCCGGCAACCCAGCCCTACATGTAAACCAAGCTGTAGGTCATCAACTCT CCCTGGCAGTCTTTCCTGGAATCAGTTTTTCCTGGAATCAGACAAACTAT TTGTAGAAATTTAAAGTGAAATCACCCCAGCATCCCAGTCCAGGATAACT ACATGGCAACCAAACTGTAGGTCACCAACTCTCCTGGGCAGTCTTTCCTG GAATCCTGTCAGACACTTACCATATTTGGTGTTGGAATCAGACAAAATAT TTGTAGAAATCTAAAGTGAGATCACTGCAGGATCCCAGCCCAGTAGACTA ACAGGCAAACCAAGCTGTAGGTCACCAACTCTCCTGGAATCAGTATTTCC TGCAATCAGTTTTTCCTGGAATTTTATAAACTATTTGTGTAAATTTAAAG TGAGATCACTCCAGCATCCCAGCCCAGTAGACCAAGCTGTAGGTCACCAA CTCTGCTGGACAGTCTTTCCTGGAATCAGTCTTTTCTAGAATCAGTTTTT CCTGGAATTTTATAAACTATTTGTGTAAATTTAAAGTGAGATCACCCCGG CATCCCAGCCCAGTAGACCAAGCTGTAGGTCATCAACTCTCCTGGACAGT CTTTCCTGGAATCAGTCTTTTCTGGAATCAGTTTTTCCTGGAATTTTGTA AACTATTTGTGTAAATTTAAAGTGAGATCACCCCGGCATCCCAGCCCAGT AGACCAAGCTGTAGGTCACCAACTCTCCTGGACAGTCTTTCCTGGAATCA GTCTTTCCTGGAATCAGTTTTTCCTGGAATTTTGTAAACTATTTGTGTAA ATTTAAAGTGAGATCACCCCGGCATCCTAGCCCAGCAAACCCAGCTATAG GTCACCGACTCTCCTGGGCAGTCTTTCCTGGAATCAGTCTTTTCTGGAAT TAGTTTTTCCTGGAATTTTGTAAACTATTTGTGTAGATTTAAAGTGAGAT CACCCCGGCATCCCAGCCCAGTAGACCAAGCTGTAGGTCACCAACTCCCC TGGGCAGTGTGAGAAATGATCCTGGCCCGTCCAGCCCATCAGTTTCACTG CAACATGAATATAGATTGGGCTTTAATTGTCCACGCATGATTTCTCCCGC CGCTGGCTAATTTCCCCCACACGTCCCTGAAGTGCCCGAAATTATGGCCG ATATAATTGCCAGAATTAGCCGTCCGCAGAACGGAACGGATTTCTTCGTT ATGCAGACTCATCAAATGAGCATCGGACAGTTTGGCCATTCCCTGCAGTA CTGGGGAGCAAGAATGTTTTATTCTTATACTTTTTACCCATAGAGTCACA CCAAACATGGGCGTAGCAATGTAGTCATACCAAACATGGGCGTAGCAATG TAGTCACACCAAACATGGGCGTAGCAATGTAGCAATGCCAAACAGTGGCA TAGCAATATATGTAGACATATAGACATCCAAACATGGCAATATATGTAGA CATATATGGTCACACAGAGCACAATAAAGGGTAAACCAGACAGGGACATG ATAAGGGGAAACAGTGCCTCAGACAGGGACACAATAAAGAGGAACCAGCG CCTGCCTTTGATCAATCGCAGAAAGTATCGCGCGATCCATCGTTTCGCCA CTTGCTGATTCCAGCGGTGGAGTAAAGACAAAATCAATTCTCTCCATTTC CTTATATTGTTGCAGCCGGCTATAAGGCGCTACTGATGGATAGGTATAGG GCAGGGGTAGAGCAGTTCTCAGGTTTGGGCCTTATATTGTTGCACCATAT TTAAGGTGCTTGTGATGGATAGGTATAGGGCAGGGGGAGAGCAGTTCTCA GGTTTGGGCCTTACATTGTAAGTTGCAGCTGGTTATATTAACTTAGGTGC TTGTGATGGTGGGTGGGGTTTGGGAGAGTAGCTTGCAGGTTTTTATTATC TCCATGAAAGTTATCTCCATGAAAAATGGAGATATTGTTTTGGGTGTGTC TGTTTGTCTGTTTGTGTTTCCGGACCACTCCAGTCAGCACAACTCAAGAG CCTCTTGATGGATTACAATGATATTTGGTATGTGGGCAAGTGTTGTGAAG CCGAAATTCAAGGTCGATTTTGGGCCCCCTGGTATGTGACCTTGGTACTG CAGCAGAACTTCAATTTTTGTATCTTTTGACCTGGACGTGCTGTAGTCTT GATTTTTGGGTGGCAGATAGCTTGTGATGTAATAAAGAAGTGGTGTAGGT TTGGGCCACCTAGCAGCTTCCTCTGGAACTGCAGGGGTGTTTTTGTGAGG AGAATAACTGAACAAAGGAATAACAGATTTCCATGATATTATTTTGGTTG AGATGCAGTCAATGCTGCCCAACAAGCCAAAAGCTTGAGGCTGTCAGTTG AGAACGATGAACTCTCAAAATCAAAGTCAGTAAGACTGGAAACCTGAAGA ACTCTGACAACGTTTCAGTCAATGTTCTCTGTAGCCACAAACAGGTAAAT GTTAAAGGCACAATGATATATGATACACTTACTGTTTTCAAAATCATATC CAGTTACATGAGTAACTCCTATTTAGCGTATTGTTTATAATGTCTTAGTC AATGGTCTCTGTTACTAGAAACAGGTAAATGTTAAAGGCACAATCATATG ATACATCAACGCAGTTATTGGTTGAGGGAGGCGTTGACTTGAAGAAAGTC CATTTTGAGACAGGCTAGAGCTACATGTTTCATCATGCAACCATAAGGGA TCCGGAGATAATGCTATCATAGCCTATGCTAGACCACCAGAGAGCTAGTA AGATGTTTCATCATGCAAATGTAACTAAGGGATCCAGAGATATGCTATGC CAGACCACCAGGGAACTAAAGACAATTTTTAACTATGAGATGGGTTAGAG TTGGACCACCAGGGAATTGGAGACAATTTCTAACTGTGGGATGAGTTAGA GCTAGACCACCGGAGACCTAGATGTCTCATCATGAGACCTTAAGGGATCC AACGTGCTGCTATGCTAGACCACCAGGGAATTACAGACAATATCTAATTG TCCCCCATGCTTTATTAACAGAAGCTGTAATTGCTGTTGATGAACATCCT GTCGGACAGGGAATTGATGAAGTCCTACATCGTCAGCAAAGCCTCGTTAA GGGCCAATTAGCTCCCAGCTGTGACGAGCCCCTCAGCTCGGCAAGCTGCG AAACGCGCCGATGAATATTTCAGGACAGATTGTCTGGTCCATTTGCGGTG GCGATTCCGCGATTTGTCTGAAGGACGTGCAAAGTGGGGATCACCTGGGG GCGCGTTCTACCACAACATGGTTTGAAAAATAAGAAATTCATCATTAATG TGAAGTACCATTTGTCCAGTTTGCACATTTTTGAGTTTTTGCAACACATT GATTTTTGGAATACTCCATCTTGTACGGGGATTTTGAGGTGTATACAATG TACATGCACTCTCTGTTTTGGAAAATGACACAACAAAAAAATAAAAATAA AAACTTTATTGCACAACAATTGTACAAGGTACAAAGTGTGGCATTCACTG GTACATAGATAACATTCTATTATGCTAATCATATATTATGGATGTAAAGT ACTGGTAGTCCATTTTACACATTTTCGGAGTTTGGAATACTCCATTTTTG CAATGCTGTGATTGTGGAATACTCCATTTTTGCATGGGGAATAGATTTTG GGGTTCAGATATTAATGATGATGTCTTTCGGCATGAAATATTCTGTGAAG GAAGGTCATGACAGTACTGACTGTGGGCCATTAAGTATTTTGCTGCCACA GCTTTATGTCTACTTTAGTCATTTTCATATACTTATTATTAGAAGAAACT TCTGAAATCAGGGGGTATGTACAGGGGGAATTTCCACATTCAGATGGACT GTCTCCATATTTCCTAAGGCATATTTCAAACATGCAAAATAGTATCCACC CCTTCTTCTGAATCAGCAGAAACTGCCAATGTACAGCTTTCAGGCTCTGT GCTCATGTTAATACTACAATTGAGAATTTTTCTACAGCTGAGAACCGACA AACGAAATTGGTGTGGCCTAATCATTGCCTCATCAGTGATCAGTCAACCT TATGAGACGGCTCAAATAACACAGACAAAACAGCTAATATCCTGCCCANC AAATAACACCGACAAAACAGCTAATATCCTGCCCAAACTGTGGCCCCCTG CGGGACACATGAATGAACTCTTCCATCCATCATCACGTTGCCATGGCAAC CATTGCCACGGCGGGGATTAAGTCAGCCAGATGCCGTCTCAAATTACAAC TCACAGGCCAGAACTGGAAACATTTATGTTTTAAATCTTTCTTTCAGTTC AACTTGGGAATTTTGTTGGATGGAATATGCTGGTGTGTTGATGAATACAT CCTGTGAAACCGTTTTATTGTTTTATCTGAATTTATCACTAACAATGTGA AGGGGAGGACAAATCAGGTGCAGTAAGCACTACAAATTTCCCTCCCACAC ACTTAACACATAAACATCAACAATATATTTCAGTAGAAACCAACTGAATA TACAAATACGCAAAGCATATCTTAACATACAATTCACAATGACGCATAAT CCAGATATTGATATCTCTTGAATCTTGAATGGGACATTAATGATGTCAAC ACGGAGAACAATATTGATATACAATGAAGCGAGAACTCAATGGAGCCTTG CGTCAACACTGGAGCTACCCCCACAAGTGGTCCGCTGGTACATGGGAGAC TGTTTGACACGACTATTAATGGCTACTGGGTGTTTTACACGTAACAATCA AATTCAACACGATTTCACCCTGTTGGATCAGCAGGAATGTGTGTTTTTAC TTCCCAACAATGTGGAGACTTTCATTTAACCGTTTCACGCTTGTGTGGCT GCTACACCGTTAGGGTTTGGTGTAATTGTTTTTATGTTTGTTTAATGCTG CCACAATGTGATTATTTCCTATCACTGTCCCCCGGGTAATCGGTGCATGG CTCGAACCCAAACCCAGCCGTGCCGGCCTCTCTTGCCAGTCCTGATCAAT AAGTTATCATCTATGATCTACTGGTTACAGGAATCTACTGGTTACAGGAA TCTACTGGTTATAGGAGTCTACTGGTTACAGGAATCTACTGGTTACAGGA ATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGG AATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAG GAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACA GGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTAC AGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTA CAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTT ACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGT TACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGG TTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTG GTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACT GGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTAC TGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTA CTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCT ACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATC TACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAAT CTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAA TCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGA ATCTACTGGTTACAGGAATCTACTGTAATTAGTGCATGGGTTTTACCCAA ACCAGCCCCTCCTGTCATTCTTCATGAATACCAGGGGTAAATGTGATGCT TCTTGTTCCTTTGCTTTTCCGTTTGAAGGCCACACCAATTTACCAATTAG TCTTCACCCCAACAAGCAAATTTCTGGAGATGAGTCCTGGAGACAGCCGT GCTATCAATGAAACACCCCAAGTCGGCAGTCTCTCCGTCTTTAATATTGC ATGTCGTGATCAGGTTTACAGTGTTGGTAATTACCTGGTTCTCAGTGAGC TGGGCTGCATGTGACACGATTAACACCTAAATGTCCATGTATAACAGCCA CCTTTGACATGATGAACTCTCACACACCTTCATCTTTGTGTAAAACAGCC ACCTTTGTGATATAATTAACCCTCACACAGATACATGACCATGTATAACA GCCACCTTTGACATAATTAACTCTCACACACCTTCATCTTTGTGTAAAAC AGCCACATTTGTGATATAATTAACCCTCACACAGCTACATGACCATGTAT AACAGCCACCTTTGACATAATTAACTCTCTCACAGCTACATCTTTGTGTA AAACAGCCACCTTTGACATAATTAACCCTCAGACACATACTGTACACGTC TTCGATGTCAGTGCCTTTCATAATGATGCCCTGATCAGGTGTACAGTGTT AGTGATTACCTGGTGCTGATCATGAGTGAGCTTGGCTGTATGTGACATAA TTAACCTTCAAACAGACACATGTTCATGTATAACAGCCGCCTTTGTGACA TAATTAACCCTTACACAGCTACACGCCCATGTATAACAGCCACCTTTGAC ATAATTAACCCTTACACAACTACATGCTCATGTTTAACAGCCACCTTTGT AACATAATTAACACACATACATGTCTATGTACATTTGTATAACAGCCACC TCTGACATAATTAACCCTCACACAGATACATGTCTGCGATGTCAGTGCCT TTAATATTGCATGCCGTGATGATGTTAACAGTGTTAGTATTACTGTGACT GGATCTGCGTAAGCTCGGATTGACAGCTTCAGTTCCAGCTCTTTGTACTG AGTGGTTGACGTAATATCCCTGAATGTTTGTACCAATGAGTGGTCCCCAT TAAAGTCTGCAATGCCTTTAATATTGTATGCCTTGATGATGTGGTAGTAA TTACTGTAACTGCTTCTGCGTAAGCTCGGATTGACAGCTTTTTGAATTAT TTCCACCTCTCTTTGCACATAGTCGTTGACGTAATATCCTCAAATGTTTG TACAAATGAACACTCCCCAGTCCGCAGTGCCTTTAATATAATTGTATATT GTGATGATTTTACAGTGTTAGTAATTACTGTGACTGCTTCTGTGTAAGCG CGGCTTGACAGCCTCAGTTCCACCTTTCTTCGTGCCAATTAGTTGACGTA ATATCCCTGAATTTTTTGTACCAATGAACACTCCCCAGCCTTTAATATTG TATGCCTTGATGATGTTTACAGTGGTAGTAATTACTGTACTTCTGCATAA GCTCGAATTGACAGCTTTAATTCCACCTCTGTTTGTACCCAGTAGTTGAC GTCATACCCCCAATTGTTTGTACCAATGAGTGGTTCCCGGCCTTTAATAT TGCATGCCATGATGATGTTTACAGTGGTAGTAATTACTGTGACTGCTTCT GCGTAAGCTTGAATCGGCAGCTTCAGTTCCACTTCTATTTGTACCGAGTG TTTGGCGTATGGTCCCTGAATGTTTGTCCCAATGAACGGTCCCCGGCCTT TAATATTGCATGCCGTGATGATGTTTACAGCATCAGTAATTACTCTAACC GCTTCTGCGTAAGCTCGGATTGACAGCTTTGGTTCCACCTCTGTTCATGC TGAGTCAAGTTGACGTAATATCCCCGGATGTTTGTACCAATGGACGGTCC CCGGCCTTTAATATTGCATGCAGTGAGGATGTTTACAGCATTAGTAATTA CTCTAACTGCTTCTGTGTAACCTTGTCTTGACAGCTTTGGTTCCACCTCT GTTTGTACCGAGTAGTTGATGTGACATCCCCGAATGTTTGTACCAGTGAA CGGTCCCCGGCCTTTAATATTGCATACCGTGATGATGTTTACAGCATTAG TAATTACTCTAACTGCTTCTGTGTAAGCTTGGATTGACAGCTTTGGTTCC AGCTCTGTGCCGAGTAGTTGACGTAATATCCCCGGATGTTTGTACCAATG AGCACTCCCCGGCCTTTAATATTGTATGCCGTGATGATGTTTACAACATT AGTAATTACTCTAACCGCTTCTGCGTAAGCTCGGATTGACAGCTTTGGTT CCACCTCTGTGCCGAGTAGTTGACGCAATATCCCCGAATGTTTGTACCAA TGGACGGTCCCTGGCCTTTAATATTGCATGCCGTGATGATGTTTACAGCA TTAGTAATTACTCTAACCGCTTCTGCGTAAGCTCGGCTTGACAGCTTTAG TTCCACCTCTGGTTGCCCCTCGGAAACAGGAATTATGCGTCCCTCGTGAC GTGTAATTTGTTCCCCCTCCATAATTGTCATCTGGATTTGTTTTCCCGGC GTAATTATGGAGTAATAGACTCAATTCTGGGTTGATCAATTTCCATAAGC TGTGTTTAAGTCCGTTCTGTCTCAGTGCTTTTTGTTTGGAAATTTGTCAG AGATTGGGGTTTGTGCCGTGTCAGCAGAACGGCTAACCCGGCCGGGTGTC CCTGTGTGAGGGTGCGTGGGTAGCTGTGTGGGTGGATGGGTAAGCTGTGT GGGGTGCCTGGGTAACTCTGGGGGAGATTTTCTGGGAATCCCTTGCTGTG TTTTATTGTCTTATTTGGGTTTATTGCAACGTAAAAGGGAGGTCAAAACA GGTGAATACACTGTGAGCTTACTAGTTGCCCTCCGACACGCTAAAGGAAA TAAATATCAACAGTACACTACATTAGAATTTAACTCTTCTTCTTCTTGAC TTGGCTTCAGAACAGTATTAAACAGTATTAGAGATTAAACATATCTACAA ATATACAATACAGCGCTCAACACAACAATGAAGCATACTGCATTATATTT TGATATTCTCCCATGTAAGTCCTGTACCTTTGTGGGAATATTGCACAGTT TTTTAGAAGGGTAAAACCTGTCCCTAAGTGTGTTAGAATATCATGTAAAT TCTGCACAGTATATAGAAGGGTAGAACCTGGGTTTTGTTAGAATATTGCG CAGTTTTGTAGATGGCTGAAACCTGTGCCTGAGTGTTTGAGAATATTATG TCAATGCTAGAATCAGTGGCAGCCAGCGGGAGAAGCTTGTTTCAATGAGT GTTTAATCCTTGCAGCTTGGTTCCTCCTGTACCTATGTGGGAATATTGTA CAGTTTTGTAGAAGGTTGAAACCTGTTCCTAAGAGTGTTGGAATATTATG TAAATTCTGCAGTTTTGTAGATGGCTGAAACCTGTGCCTGAGTGTTTGAG AATATTATGTCAATGCTAGAATCAGTGGCAGCCAGCGGGAGAAGCTTGAT TCAATGAGTGTTTAATCCTGGCAGCCTGGTTCCTCCTGTACGTATGTGGG AATATTGTTTTGTAGAAGGTTGAAACCTGTCCCTAAGAGTGTTAGAATAT CATGTAAATTCTGCAGTTTTGTAGATGGTTAAAAGCTGTCCCTGTTAGAA AATTATGCAAAAGCTTGAATCAGTGGCAGCCAACAGGAGACTGGTGTGTG CTCAATCCTGGCAGCCTGGGTCCCTCCTGTACCTATGTGGGAGTATTGTT TTGTAGAAGGTGCCTGAGTGTGTTAGAGTGAATTCTGCAGTTTGGTAGAA GGTTGTTAGAATATTATGTAGATTCTGCCCTGTCCTGAGTGCGTTAGAAT ATTATGTAAATGCTTGAATCAGTGGCAGCCAACAGGAGATTTGTGTGTTC AATCCTGGCAGCCTGATCCATTGTGGGAATATTGTACAGTTTTGTAGAAG GCTAAAACCTGTCCCTAGCCTGGGTTTGTTAGAATAAATCCTGCAGTTTT GCAGAAGGTTGTCCCAAAGAGTGTTAGAATATTATGTAAATTCTGCCCAG TCGTGAGTGTGTTAGAATATTATGTAAATGCTTGAATCAGTGGCAGCTGA CAGGAGATTTGTGTTGTCAATCCTGGCAGCCTGATCCTTTGTGGGAATAT TGTTCAGTTTTGTAGAAGGTTGAAACCTGTCCCTGGCCTAGGTGTGTTAG AATAAATTCTGCAGTTTTGCAGAAGGTTGTCCCAAAGAGTGTTAGAATAT CATGTAAATTCTGCCTAGTCGTGAGTGCGTTAGAATATTATGTAAATGCT TGAATCAGTGGCAGCCAACAGGAGATTTGTGTGTTCAATCCTGGCAGCTT TTCCTGTACCTATGTGGGAATATTGTTCAGTTTAATGGAAGGTTGAAACC TGTCCCTAAGAGTGTTAGAATATTATGTAAATTCTGCCCAGTCGTGAGTG CGTTAGAGTATTATGTAAATGCTTGAATCAGTGGCAGCCAACAGGAGATT TGTGTGTTCAATCCTGGCAGCCGGGTCCCGCGGGAGGGTGCGTTCCCCGT CCCAGCCGATATTGAGTTCCATCAAACGGCGCTCAGTAATTATCCACAGT GCAGCGGGCTGATACATATGGATGCCGCGCCCCGCAGGTGAGGAGCCCAC TTCATATGGAAGGCACGCCGCCGCTATGCAAATGCCTCACTGATAGATGG ACTGCCTCGTTTGCTTGCAGCCGTCAGCTCTGTGCGCTGGATTCAGACAT CGCTCGGTGTGGCGGCGACGCTAGTGTGAAGCTGAGGACCAACCAGGGGA GGAAACGAACTGTGGAGGCAGAACTCTGGCAGGGTGGGGCTGGGACGGCG TCTCTCCCGGGTAAGGTTGGAGAGGAGGAGGAGGAGGATTCACTCCCCTG GTTTTACTGCCCACTCCACCACCACCGATGCCACGCCAACATTCCGGGAC TCACCAGCGTCACAGCAACGGAACACCAACATTCCGGGACTTACAACGAC GTCACGGCAACGCACCGAGGATCCGGGACGCCTTGGCTGCGCTCCTCCTG TGCTCGGGAACCTCCAGCCCGTCCGTGGAGCACCTGCAGTCCTGAGAAAA TCTACCCACCAGCAGGGAAGTCTGCAGTTTCTCTGTCTGCATTTTTATTG ATTGAGGCTCTACTGCTGGTGCCGTAAAGCCGGATTCCTGCTGCAAATAT TCCCCCCTGATCGCAGGTAGGCGGAATTGCTGTGTGGACAAAGTTGTTCC TCGCCCGGGCGCTCCGGGGAGTCTTGTAAATAGACTTGACATTGAACTGC CACTTCACTCCGTCCATTCTCCGATCGTGGCGCGGAGACGCAATATTAAT CATAAGGGCTTCTTGCAAGGCAAGCTTCTCACCCATCCGATGGATTATTG TTGTAAATAGACCCGTGTTGTGCACCGAGGTGCCTCCTTTTTATACTTCG TGCCAAGTCGGTCCTACGGTCACCGCGGTTACCGGACTGACCTCTATGCA GAAACGCGACCTTGCTGTCACCGCCCGTATCTTGGTTGCTTATTCGGAGG AGAGAGAGTCCCACTGGCCAGAACCCATGCACATGAAACTGGAACCACGC ACGNGAGAGAGAGTCCCACTGGCCTGAACCCATGCACATGAAACTGGAAC CACGCACGTGAAAATCACCTGTGCTTTGGAACCACGCACGCAAAACCTTT CTGTGGAACCACGCAAGTGAAACTTACCTGTGCTTTAAAACCACGCACAT GAAACTCGCTTGTTTTCTGGAACCACGCATGTGAAATTCACATGTGATTT GAAACCACGCACGTTGAAACTCACCTGTTTCCTGGAACCACAGACGCCAA ACTCAGCTGTTTCCTGGAACCACTGACGCCAAACTCACCTGTGCTTTGGA ATCACGCAAGTGAAACTTGGAGCCCCGCACATGAAATCTTCCTGTGGAAC CACGCACCTGAAAACGACCTGTTTGCTGGAACCCAGCACATTAAACTGAC CTGTGGAACCACGCGTGTGAAACTGCCAAGTCTGCAGGAACCACGCGTGT GAAACTACCCTGCGGAAACACGCACGTGAAACTGCCAAGTTTGCTGTGAA ACTGCAAAACCACGCGTGTGAAACTGCGGAACCATGCACGTGAAACTGAC ATGTTCGGTGGAGCTGGACTGCTGCCCCTGCTGCGACTGCGGACAATGCT GCTGCGGCTCGAGCACGGCCGGCTCCGAACCCCGAGACGCCTCGTCGGAA CTCGGGGACGGAACAGACATCAACGGCGATCAGACATACTACCGGAAACA GGCGCAGACGATGTCGGACTTCGCGGCGGACTCGACGCTACACGGGCTGC CGCACATCTTCCCGGGATCGCCGCTGAGTGTGCGACAGATCGCGTGGGCG CTTGCGTTCGTGGGCTCGCTGTCGGTGCTGCTTTACCAGTGCTCCGACCG CGTGAAGTTCTACTTCCAGTACCCGCACATCACCAAGCTGGACATGGTGC TGGCGGCACAGCTGGACTTCCCCGCCATCACCATCTGCAACATGAACATG TTCCGCTGGAGACAGTTCACCAAGAACGACTTGTGGTACATGGGGAAACC CCTCAACATTCTAGACGAGAACAACAACCTCCGCTGCTCTGAATATGCAA CCTCGGGAGACATACAAGCGCTAAAAACGAAGGCGAACTTCGATTCTTTT AAACCCTCGCCCTTCAGCATGATTGAATTTGCGAACAGAACGGGCCATCA AATCGAGTCTTTTCTCTTAGACTGTAAGTGGAAAAACTTCACTTGTGGGC CGGAATACTTCACACCCGTAAGTCACTTCTCTCTTACCTTCATCTGTGTC TTACACTGTGTGTCTTAGACGGTCAATGGGGGAGGGGGGAACTAACACTT CACACCCGTAAGTCATTCTCTTACCTTCTTGTGTCGTGGTATGTCTTAAA TTGTATGTCTTAGAATGTGGGAAGTCTTAGACTTGGATAAGGTGGTAAGA GGGAAGGGAGAGTAACATTTCACAGTTCTTACCTGTGTTGTGAGTCTTTG ACTGTGGTGCCTTAGATGTGGCGCTTTAAGCATGTGGTAACCTCGCATTG TTGGGGAGGCAGCAGCAATGGTAGTCTCAGCTTTCTCCACCTTTTTAAAC TTTCCCACCTTTCCCCATCTGTCTCACCTTTCCTCACCTGTCCCACCTGT CTCACATTTCTCACCAATTCTCACCTGTCTCACTTTTTCTCTCCTGTCTC AATTTCCCCATCCGTCTAAACTTTTGTCACCTGCCCCACCTTTCCCACCT ATATAAACTCTTCTCACCTGTATGAATTCTTCCCACCTGTGTAACTCCTC CCACTTGTCTCACCTTTTCTCACCTGTCCAAACTGTTCTGACCTTTTTGA CCTTTTCCAGCCTATCTCACCCTTCCCCACCTGTCTGACCTTTTCTCAAC TGACTAAACTGTTATCACCTGTCTCCCCTTTTCTCACCTGGCCACATTTT CCCACCTGTCTCACCTTTCCCCACAATCAATCTTTATGGGAACGCGCCTG GTGACAGAAAAGGAGTCTTCCTACTTTAACCTTCTCCCTGCTGCCCAACC CTGTAAACATGAGAGAAATGGTGGCCAAACGGCTACTTCAGTGTGCTAAA GGTTAATAGGAAATCATCCGTCTTGAGGTGTTGAGTAAACTTTCACTGTA CATTTAAAATATGGAAACAAATCAAAACAGAAAAACTCTCCTGATAAAGA CTGCTCGATGGCCATCTATCAAGACCCTTAACCAACTTCATGTATAACTG CATCTGCATCTGTCTAGCCAACATAACTGCCCTTCGGCATAGCACACCAG CATTAAACAACCTATTATTAAACCTTTGCACATCTAGCTCATGCCCGTAG CCAGGATTTTGATTGGGGGGGTTCTTTTTAATGTTTGAGGGACCAGCGAG CGCCGTAGGCGCGAGACGAGTGCCGCTGGCGCGAGCTTCCTAGGGGGGTC CGGGGGTATGCCCCCCTGAAAATTTAAAAAATGGAACCTTCTGATATGGC ATTTTCTGTGTTTTTGAGAGGATTTCAAAGAAAGAAATCAGAGACAAAGT GAGCAGTTTTTCTTGGATTCCAGCCCCGCTGGTGATACAAATAAGTCCAC CTTGAAAAAAAACTTGGACGTTAAAAAGTGGACCTTCGAAAGTGTAAGAT TTAAAAAATTGTACCATCTGAAAGGCCATTTCCTGTTTTTTTGAAAGGGT TTCAGAGGAAAAATCAGAGACAAAGTGAGCAGTTTTTATAGGATTCTAGC CTCTGTGGCCTTGCTGGTGATACAAATAAGCCCGCTTTGAAAAAAAATCT TGAACATTAAAAAGTGGACCTTCAAGCCTGTGAAAGTGGACCTTCAAGCC TGTGGGGGGTTCTTCCGAACCCCCCGAACCCCCCCTGGCTACGGGCATGT AGCTGAAAGCCTTCTTAAAGCTGTCCAGTGAAGATGCTCCTACTGTACTT GGTAACTAAAGGAGGAATTCTAGGGAAAAATGAATCTTTGAACACCTCCA TTCTGGGTTGATAACTCTGGCACGACTATTCCTAATATTCTTTTTCAAGC TGGTATTATCAGTGGGTGTGATTTATAAGTCATTTTGTACATTATGCATG GTCTAGACATTTTTCTTCTCTATCTTCAATGCATAAAACATAGTAGATTT CCTTTGGGAGCGATGAAGTAGTTTTGAGCTGACCCTCGCAGGTGTCCCTT ATCCGCGCCGCTGTCCATCCATCACATTTTCCTGGATCAGGTTTCTCATG AATTATTCCGGGAAATGTTACAGGAATCCTCCCTGGAAAATCCACCGTTC CCACCATTCCTGCTGGCATTATTCTGTCTCAACTTCCAGTAAAATGTTAC AGGAATGCAGCCTGGAAAATCCACCATTCCTGTTAGCATTATTCTGCCCC AACTTCCAGGAAAATGTTACAGGAATCCAGACTGGAAAGTCCATCATTCC TGTTAGCATTATTCTGCCCCAACTTCCAGGGAAATGTTACAGGAATCCAG ACTGGAAAATCCACCATTCCTGTTAGCATTATTTTGCCCCAACTTCCAGG GAAATGTTACAGGAATCCAGACTGGAAAGTCCACCGTTCCCACCATTCCT GTTAGCATTATTCTGCCCCAACTTCCAGGCAAATGTTGCAGGAATCCAGA CTGGAAAGTCCACCGTTCCCACCATTCCTGTTAGCATTATTCTGCCCCAA CTTCCAGGCAAATGTTGCAGGAATCCAGACTGGAAAGTCCACCGTTCCCA CCATTCCTGTTAGCATTATTCTGCCCCAACTTCCAGGCAAATGTTGCAGG AATCCAGACTGGAAAGTCCACCGTTCCCACCATTCCTGTTAGCATTATTC TGCCCCAACTTCCAGGAAAATGTTACAGGAATCCATCCCAGAAAATCCAC CGTTCCCGCCATTCTTTTTTGCATTATTCTTTCCCAAATTCCAGGAAAAT GTTACGGGAATCCACCCTGGAAAATCCACCGTTCCCCACCATTCCTGCTG GCATTGCTCTGTCCCAACTTCCAGGAACATACTTGTTTAAAAGCAGCTGA ATCACACTTGGCAGGCCTGCAATATTATTAACAGTGCTACATGATCGACA TCTAGTTTCACAGACCAAGAAATTGGGACAATGTTGCATCGCTTCATCCT CATGTGTTTGATGGCCAGATATATCACAACTGCCAGGCCAGTTATATGCC AAGCTGTCTGCTTGGGAAGGTTGGTTTAACATGATTTAGGCTGAGGCACT GTTAAAGCTGTTTGTAGGCCCAGTGGCTGGTTATGTTTACAAAATAGAAG CTAATGATGATACCAATTATACACATGCAATGTCAGCCAATGCTGAATTG CTGCAGGGTTTACAATCACATGATATACAATAATACACATGATACATATT GGCACACTTGCACTTGCAAGCTGAGAGTACTGTATAACCACCCTTTATAT ATCTATAGGCCCTTAGCATTGGCTGGTTATGGTAAAACTGTTTAAGCTGT GTCAGTATAACCACCTTTTGCAGACCCATAGCAGTGGCTGTCTTTTATTG AACAACTTGTCAGGTCTGGCTCTAGGCACTGATGAAGCTATGAGAATAAC TGCCCTTTGCAAGCCAAGTGGCTGCATGGTTATGTTAAAGCTCAGTATAA CCACCCTTTGCAAGCCAAGTGGCGGGTTATGTTAAAGCTGTGAGTACCAC CACCCTTTCCAGGCCCTTGGCATCAGCTGTTTGTATTACATGTCCTTTTA TTGAACAACTTGTCAGGTCTGGCTGTAGGCATTGTTGGAGCTGTGAGAAT AGCTGCCCTTTGCAGTGGCAGGTTATATTACAGCACGGCTAGCTGTAGGC GCTGACAGTGTTGTAATGAAGAGGCCGTCTGCAACAAACGATAAGCACGT CTCAGCAGACGGAATTTTTAAACACCTCATCATGAGCAACTTTGACGTCT GTGGAAGTTTGATAATCGTCTGTCCAGCCGCGACGCAGACAGACGTGAGG CCTGAGGCGTTGCCAGGGCGANAGGCCCGCGGCGTTGCTAGGGCGATGGG AGGCCTGCGACGTGCAGCTTGTCCTGTGTTGGTTTGCAGGGCTGCAGGAT TTGATTTTACTGCAGCTTCTCCAATGTTGGTTTGCATGGCTGCAGGGCTG CAGTTCAATTTTACGGCTGCAGTTTGATTTCACTGCAGTCAATGTCAAGC CTTGGTTTATCTCTATTTGTTTCTGTATAGCCAGTATAACCGCCCTTCAG TGTAACACATCAGCTAGTTATATTACACTGAACGACCTGTCACACCTAGC TTTTCCCCTAGCTAACTGCAAGCATTCTTTAAAGCTATCCAGCGAACTAC TGTGTACTTGGTGATAATATCTCAATACGACTTCACAGCTAGACTCTGTG GTTCGTTCATGCATTTGTTGCTTCAGCAGACTGTTGGGAATAACGGTGGG CTATAAATACTCATGTTAGAAAATTATCGCCAGCAAATAGATTACACAAA GGAGCATAGTGCTTTTCCTAATCAGTGCAACAGTCCGTCTGTTGCTTTGT GAAACCGGCAATCAGTCAGCCCGTCTGCAAAGGCTCCAACTGTGACTGCC CCAAATTCCAGGAAAATGTTACAGGAATAAACCCTGGAAAATCCACCGTT CCCACCATTCTTGCTGGCATTATTCTGTCCAAACTTCCAGGGAAATGTTA CAGGAATCCTCCCTGGAAAATCCACCGTTCCCACTATTTCTGCTGACATT GGTCTGCCCCAACTTCCAGGAACTCACTTGTTTAAAAGCAGCTGAATCAC ACTTGCTCATGCATTTGTTGCAATCAGTCAGTCCGTCTGCAAAGGCTCCA ACTGTGACTTTGAGCCTTTGCTTACAGAGTTTAGAAGTGCAATTTCATGT CTTATTTTGGAAATTAGTTTACGATTCTGATAATTTTCATGCTTCTGTTG CAGTGTAGTGCTGTTATGACTTATATGTGCAAATTGGACTGCATTGGCCT CGCGGCTTTCCTGGAGAAAAAGCAAGCAAAGAATGAGAATAGATATCATT TTCTATCATTATGTAGGCACAATTAAACATACTTCTATCTCAGATGTCAT ATAGATAGAGAGAAATATATATATACGAATAGATATAGATATGTATAGAT ATAGTTAGATGGATATATAGCTAGATAGATGTTACACGGGTATACAGAAA AGCTGCAGCAAAATTCAACAGAATAGAATATTCGATGTGCATTGGAGGTG CAGTATTGTTGGCACAGCAAGTGGGCTAGATGGAGCCATAGATCTGAAGT AAATTCCAAAGATGTCAGAAACCCTCAGCGTGCTGTGAGTTGGATGGAAG CTCGGGAGAATTCCCGATTCCGACAGCGTTTGGAGAGATGAAGATTCCGG GCGCAGCACCCTTTGGACCCTCACTCGGGAATTTGGAAGCATTTTAACAT TCCGTGTGCATTTCGCACTAATGTAGCATTCCATATTCCACGGGCGTCGG ATCAGTTTCCTCTCGGAATCCTGTGTTAGCCGGATATGCCTGTCACTGGG GACAGATCAGTAATGCTGGGGGTGGGGGTGGGTATGGCTGTCACTTGGGA CCGATCAGTAATGCTGGGGGTGGGTGTGGCTGTCACTGGGGACTGATCAG TAATGCTGGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNGTGAGTTTCCAGACTCCCCAGTAACCATGGTT ACCCTCCACTGTGAGTTTGCAGTCTCCCCAGTAACCGTGGTTACCCTTCA CAGTGAGTTTCCAGTCTCCCCAGTAACCGTGGTTACCCTTCACAGTGAGT TTCCAGTCTCCCCAGTAACCGTGGTTACCCTCAACTGTGAGTTTCCAGTC TCCCCAGTAACCGTGGTTACCCTTCACAGTGAGTTTCCAGACTCCCCAGT AACCACGGTTACCCTTTATGTAATAGCCACAGGCTAGTTGGGCAGCCCTG GCTTTGCGTCCTGAACAGCCAAACCAATAAAATGATAAAAAATTAAATGG TTACCCTCCACTGTAGTTTCCAGCAGGTTGCAGCCTGATACCTGGAGATC CCCCCAAACCCAAAGCTTCATTGTTATTTTGCTGCTGCTGCTGCTAAGTC CCCAAAGCCCTGCAGATCTCATAAATGGTTTGTCTCCATGGTGAGTATTT GAGTGCCTAAAGCCCTGTGGATCCACATTAATGGCTCGTCTCCACTGCGA ATATTAGTCAAACAATTCTGCTTCAGTCTGCAACCCTGGGGGAAACAATA CCCATAAAGGAGCGGCATCATATTCTGCTCCATCATCCATTATCGGCCGC GATGCTGGTTTATCATTAACGACTCCGATGCTGGTTTATCATTAACGGCT CCGATGCTGGTTTATCATTAACGCCCGCGATGTTGGTTTATCATTAACGC CCGCGATGTTGGTTTATCATTAAAAGCCGCGATGCTGGTTTATCATTATC AGCAGCAATGCTGGTTTATCATTAACGGCTGCGATGCTGATTTGTCATTA AAAGTCGCGATACTGGTTTATCATTATCAGCAGCGATGCTGGTTTATCAT TATCAGCCGTGATGCTGGTTTATCATTAACGGCTCCAATGCTTGTTTAAC ATTGACGGCCACGATGCTGATTTATCATTAACGGCCGCGATGCTGATTTT ATCATTATCAGCCGTTATGCTGGTTTATCATTAACGGTCGCAATGCAGGT TAATCATTAACGGCCACAATTTATCGTTAACACTAAGTAAAAGTTTCCCC CCTTACCATCAGCACATAGTGAAAGTTCCCCTCTTTACCATCAGCACAGA GTGAGAGGTGCCATCAGCACAATGTGAAAGTTGCCATCAGCATTAAGTGA AAGTTCCCCCTTACCATCAGCAGAAAGTGACATTTCTCCCTTCACCATCA GCACAAAGAAAAGCTCCCCTCTGTTACCATCAGCACAAAGTGAAAGTTCC ATCTGCACCATCAGCACAAATTGAAGGTCCCCTCATTACCATCAGCAGAA AGTGAAATTTCCCCCTCACCATCAGCAGAAAGTGAAATTTCTCCCTTTAC CATCAGCACAAAGAAAAGCTCCCCTCTGTTACCATCAGCACAAAGTGAAA GTTCCCCCTTACCATCAGCACAAATTGAAAGTCCCCTCATTACCATCAGC AGAAAGTGAAAGTAACCATCTGCCCAGGCTGGCCCCAGATTTGTGGCCTC CATTTTGCGGGAAGTGAAGTCCAACGCCACCTGAGCCGCCTCGCTCGCTC GTTTGCTCGGGAGGTTAATTAGCAGGGAGATTGCCTCATGAATCTGTCAT GGCAACAACAGGAAACTTTCACCCCTAACAGACAGCAACTTTCACTTGTA GACGTGGTAACATTGCTTTGTTGCGATTTCAATAAAATAAATCATGTCTT GTGGTTTAATCTCATTTTGTGACGCTGTAGGTAATTTGATACCATGTTGG ACAGTAGTTAAATCATGCTGTAGGTAATTAGATACCAGGTTGGACTGTAT GTAGTTGAACAGAGCCGTTACAGGGAGAGTTGAAGTTTTATGGTGTGAGG ACCTCATTGTCAGTTCATATTGGCACGAGCCCAGAGCACCAGTCATGCCA TCATTGGGCTGAATTTTGTTGCATGTTGAAAACAGTTTTAAACCATTCAC AATTAAGATCCATGAGTAAAGATGTAAAAATGTCCAAATTTGAATAAGTT GGTAGAAGTTTGTTCAAGGTGACAGAAAAAATAAGACTCTTTGTAGGATC TTTCTGTCAATGGGAATTGGGATGATGGAAAAAAATTCAATGCTCAAAGT ATGAAGTTATTAGTATACACAAATGAGCTTAACAGTGTTAGTTAATGTCA CTACTGTAAAGATTTCAGCATTTCTTTATTTCCGTTTTCGGGGCCCTAAT ATTGCTTTGGGCCCCTTTAATTTGGACTCCAGTCAGCTCCACAGTGGTGA GGGTTCACATAGCTCTGATGAACAGCTCAGAAATTGGGCCACTTTTACTG CTGCTGTTATAGCTTTGGCCAAATGACATGGTTTTAATTGAAGTCATCCC TGCAGGATTGTAAGGGGCTGTAAAAACCCATGGTCTGCTTGTCAACGGGA GGCTGTGTGTGCTTTCAACACAAATCACTATTAGGGGTGGATACCGGTTC GCTGGACCTGAATCGGACCTTTATGACATCCAAGAACCGAGTCCAAAAAA CCTGAAAGCTAAAACCCGAGTAAAAAAAAACCTGAACAAAGTAAAACATT CATTTTTCAATTTTGTTTGATAGAAAGGGTTTTAAGACCCCTCTCTGCCA AAAAAGCATTTAAAATAAGTGCAACATTCACATATCAAACACTGGTTTGT CTTGAAAGTCTTTTCACCAACAAACTTTTATAGTCGTGAGTGTCAGTATT GATTCTCTATGAAAATATTGGTCTGATAAAACAAAACATCAACTGGACAG GATCAGGTCCAGGTTCAGGTCCGGACCTGAACCTAAATCTCTGGACCTAA ACTTGGACTTGGACCTTATTAAGCCGGACCGGTATCCACCCCTAATCACT ACAAATACAGTAATTCTTGTTTCTTTCCCAGTGACTGTAACTTTATGTTC ACTGTTATCACAGTCACCTCTGTGCCGTGAACTTATCATCACCCTGAAAA AAACCTTCACACATCTGAAAATCTCTTGCCGCCACCGTGAAGTTAAAGTT CAGTGAAGTGTCCATTTTCCTTACACAGTGAAATTTTGCTACCGTGAAAA TAAAGTGAATTACAGTATAGCAGGGCAGGAGATCACTTAATGCCTATCTG TATTATCAACATTACTCTAATGTGAGAAGATTGTTATCTCCATGAAAAAT GGAGATATTGTTTTGGGTGTGTCTGTCTGTGTGTGTGTGTGTGTTTGTGT TTCCAGATGTTTGTAGTCAGCGTAACTCAAGAACGCCTGGATGGATTATG ATGATATTTGGTTTGCGGGTAGGTGTTGGGGAGATAAAGGTCAAGGTTGA TTTTGGGCTCCCTAGTATGTGACATTGGTACTGCAGCAGATCTTCCTTAA CTTTCTAAAATCTTTTGACCAGGATGTGCTATGGTCTTGTTTGACTTGTA ACCATGTGAATCTGTGTCTAGTCATGTTACATATCTAATTTTCGGTGTTA GTTTGAGATCTATTGTATACAGACTTACCTCGATGAAGGTTAGACATCCT GCTAATAAGATATGCAAGAAAACAGTTAAGCAAGGTACAGAACGGTTACC TGACTCCATGGTCCCTCCCCAGTGTGGGGAACTGTCTCTACTGTCTCTTT ATGTGCCACAGTTTCTGCTGTGTTGTGCCACACAGTTACAGCCTTGTTCT GGTCACATTTTGTGCTTTGTTCTGGCCACAGTTTTGCCTTGTTCTGGCCA CATTTTTTGCTTTGTTCTGGCCACAGTTTGCCTTGTCTTGGCCACATTTT GTGCTTTGTTCTGGCCACATTTTGTGCTTTGTTCTGGCCACAGTTTCAGC CTTGTTCTGGCCACATTTTGTGCTTTGTTCTGGCCACAGTTTCAGCCTTG TCTTGGCCACATTTTGTGCTTTGTTCTGGCCACAGTTTTGTCTTGTCTTG GCTACATTTTGTGCTTTGTTCTGGCCACAGTTTTGTGCTTTGTTCTGGCC ACATTTTCAGCCTTGTTCTGGCCACATTTTGTGCTTTGTTCTGGCCACAT TTTTGCCTTGTTCTGGCCACATCTTGTGCTTTGTTCTGGCCACAGTTTCA GCCTTGTTCTGGCCAGAGTCTGTGCTGTGTCTTGGCCACAGTTTTTGCCT CGCTCTGGCCAGAGTCTGTGCTTTGTTGTGGCCACAGGTGTGTTATGCCG GCAGTAATGGGAAAGATGTTATCTGCCAAACAGACGTGTGCAGAATAACA GGCCACTACTCTGTTATTGATGTGGATGCTGTCTGCAGTAATAGTAATGC GTCTGGGCTGCCGGATCGATACCTGTAAACCTACACCCGACAGCACAACA GTATAGCACACAAGTGGTACAATAATAGAACAGATACCTGTAAACCTACG CTGGGCAGTGCGATAGTACAGCACACAAGTGGTACAATAATAGAACAGAT ACCTGTAAACCTACACCCGACAGCATAACAGTATAGCACACAAGAGGTAC AATAATAGAACAGATACCTGTAAACCTACACCCGACAGCACAACAGTATA GCACACATTCAGTGGTACAATAACAAAACAGACACCTGTAAACCCACGCT GGGCAGTGCGACAGTACAGCACACAAGAGGTACAATAATAGAACAGATTC CTGTAAACCTACACCGGGCAGTGCGATAGTACAGCACACAATAATAGAAC AGAAATAGAACAGTGAAAGTGTCAGTGAAAGTCTAAGACAATGATAAGCA GGAAAAGTGAAAGTGCCAGACATCACCAGCAGGAACAACTGTGCAGCAGC TTGGCTATTCTTGTTTCTCCTCGGGGTTGTGGTCTTAGACACTGCCGGGT CACAGAATCAGGAACTTGACGAAAGGAAATGTCTTATCTGCCAGCCCAGA CTCTGATCTTTCTCCCCTCAAGTGGCTGAAGTGAGAAGGGAAGAAATGGC AACACTGTGGCAGTTCTACTGACAGAGGTGATAGTGGCAGGTGATACACC TGTGTGTACAAATTTGATCTTACTGCTCGCACAAAATGCTACCCTTAAGA CACCCATACTTACTTCTTAAACTATAGGCACAGCCCTTAAGACACCCGTA CAACATGACAAGGTTATTGAGAGCTTTATTCCTTAAGACATTGGTCTTAC ATGTGAGGTTATTTCTTACATCCAGACAGACCTGCTATTGAGATCCGCCT GAGGGTGTATAATCTATGATTCCAGTGGAAGTGTAGCATAACGTTAGAAG GTTTCAAGTTACTGAGCAGCAGTGGTGTCAAGTTACTGAGGAGCAGCAGT GGTATCAAGTTACTGAGGAGCAGCAGTGGTGTCAAGTTACTGAGGAGCAG CAGTGGTGTCAAGTTACTGAGGAGCAGCAGTGGTGTCAAGTTACTGAGGA GCAGCAGTGGTGTCAGATTTCAGGGACGAGCAAAGCTCCCATCAGAATAT ATTTCATACCAAACTGGATGGAAATGAACGCGGATAATCCCGACTGCAAG GACAGATTAATAGAAGGAAATAGCCTGTCATATTATCGGGGATGCAGCGG AGCGGAGCACTTCAGGGGGCTTTTTAATGAAATCTTATTGCAAGTCCTTG TCCCACGGATAATTGAACGTGACGACAGGGGATAGAGAAAGAATAACAAC ATTCAGGAAAGTGCAGGCTGTGATAATTGTGTACAGTTGGGTTATCTGTA CGCTGCAGATACAAAACGTTCCACTTTCCCCGCTCCGCACAGTTGTATTT GACATTACTGTTAACAGGAAACATTATAGTACAAAGTGTAGTAATAGAAC AGAAATATTGATAATCTTTAAACAGAAAATGCTACTGTTACTTTTGGCAG CTCCTTCTGCTTTCGACTTTGCCCAGCTTTGAGCTTCCATCCACACAACA CAACAGAACACAAAAATGAAAATTGACCAGTTAATATTGCATGTGCTCTC CATTCAACTGCACATAAACATGAGAGGCAATTCCCCTGAGCTAACAGCCA GCAAACACCATGAGCCTGAGGGATGGGAACCGTGTCCAGCGAATTCCTGA TGATTCACTCCAGCATTCCCCCCAGCATTCCGGCCTCATCTGCATTCCCG GGGGCGATGTTAGCCTTGGCTAAGAAACGCTGCTTCCGACGTCACATCAT TCAGGCAGATTCCTGATGATTCACTCCAGCATTCCGTCCAACATTCCGGC CTCATCTGCATTCCCCTGGGCGATGTTAGCCTTGGCTAAGAAACGCTGCT TCCGACGTCACATCATTCAGGCAGATTCCTGATGATTCACTCCAGCATTC CGTCCAGCATTCCGGCCTCATCTGCATTCCCCTGGGCGATGTTAGCCTTG GCTAAGAAACGCTGCTTCCGACGTCACATCATTCAGGCAGATTCCTGATG ATTCACTCCAGCATTCCCCCCAGCATTCCGGCCTCATCTGCATTCCCCGG GGCGATGTTAGCCTTGGCTAAGAAACGCTGCTTCCGACGTCACATCATTC AGGCAGATTCCTGATGATTCACTCCAACATTCTGTCCAACATTCCGACCT CATCAGCATTCCCAGGGGCGATGTTAGCCTTGGCTAAGAAACGCCGCTTC CGACGTCACATCATTCAGGCAGATTCCTGATGATTCACTCCAACATTCCC CCCAGCATTCCGACCTCATCTGCATTCCCCTGGGCGATGTTAGCCTTGGC TAAGAAACGCTGCTTCCAACGTCACATCATTCAGGCAGATTCCTGATGAT TCACTCCAGCATTCCGTCCAACATTCCGACCTCATCTGCATTCCCCTGGG CGATGTTAGCCTTGGCTAAGAAACGCTGCTTCCGACGTCACATCATTCAG GCAGATTCCTGATGATTCACTCCAGCATTCCCCCCAGCATTCCGGCCTCA TCTGCATTCCCCTGGGCGATGTTAGCCTTGGCTAAGAAACGCTGCTTCCA ACGTCACATCATTCAGGCAGATTCCTGATGATTCACTCCAGCATTCCGTC CAACATTCCGACCTCATCTGCATTCCCCTGGGCGATGTTAGCCTTGGCTA AGAAACGCTGCTTCCGACGTCACATCATTCAGGCAGATTCCTGATGAGCA GGTCGAGGCGGTCGATGTCAGGCTCGATGGAAACCACTGAAAACGCTGAT TCATCATTCCTGCTGCCGGTCTGTAAACAGCAGGGGCTGCAGAGGAGGGG AATTATGTTTGTTATGTTTATAGCTATAACCTTTAGCCTTTATGAGGGTT CGGAGTAAAAATACATACAGACAATCATGCAAACATACAGGTAACAGAGT TAGAGGAAACATAGTATACATACTGTAAGATATACAGGAAACAAATTGTT GAGTCTTCGCGTTGGTTTTAAGTTTGCAGCAGCGTTATAGTCACATATAC TGCTACAGTATGGGACAAAAATGTTCGGGTGGTTTTAAGTTCGCGGTGAA ACGGTCGCCGCGAAAACCGCGAACATAAAACCACCGCGACCATTTCTGCA TCTACTGTATACAGAAAACAAATTGTTGACTTAAATTGTGAACAAAATGG TGGATAGCCTTTTTAAAGTTGGATGGACTGGATAAAGATTTAGTGTTGGG TGGCAGGGTGTTTCAAAGAGCGATGTTACAGTAGAGAAAGGTTCACTTTT TGATGTTTATTTTAGATACTAGTAGTTTGAAACGGTAGAAATTGGATAAT CTGGTTGAGTCTGTCCTTAGATATCAGCATCAGACGTAGGAGTGGAATGT GAAGCTGCTATTCAAAGGGCATGGATGAGGGTCACTGCTAGAGCTCGGCC ACGTCACTGCCTTACATGATGCTTAACTGGTGCAGACATCCTGATTCTTT AACTCCAAGTGTTCAATAACGATAAGTTTATAACAGGTCTGACTTTTCCC AGTGGGCATCTTTGCAGCCCTGAATGTGAAGCCGTATTGACTATTCACAG CATGGATGAGGGTCAATGCTGGAGCTAGGCGACGTCACTGCGTCACACGA TGCTTAACTGGTGCAGACATCCTGATTCTTTAACTCCAAGTGTTCAATAA CGATAAGTTTATAACCGGTGTGAGTTTTCCCATTGGGCATCTTTCCAGCC CTGAATGTGAAGCCGTATTGACTATTCACAGCATGGATGAGAGTCGCTGC AAGAGCTAGGCAACGTACCTGCGTTACATGATGCTTGTACATGTAAGTGT TGCAGAAATCCTGATTCTTTAACTCCAAGTGTTCGGTAAAGATAAGTTTA TAACCGGTTTGAGCTTTCCCGGTGGGTATGTTGGCAGCCCTGAATGTGTC CTGATTCTTTAACTCCAAGTGTTCGGTAGCGATAAGTTTATAACCGGTTT GAGCTTTCCCGGTGGGCATGTTGGCAGTCCTGAATGTGAAAGCGATGGCG GGGTTTGCCATTGACCTTCAGAATGATTGGATTGCATTTTACTCCCTCAT TAAAGGATTCCGTCTGCCCGAGGCGGAATGACCGATGGGAATGATGGACA TTAAATTCCATTGATTTTCCGGAGTCCAGAAGGCGAGCCTTTCATCAGGT TTACGCTGCGCTCTGGTTGGACGAGTCTTTGATTTCCGTTCCNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAGATGGTTGATAA TGTGCAGCAGATGCAGGACCAAGGCACATGGTCGATAATGTGCAGCATAT GCAGGACCGAGGCATATGGTCGATAATGTGCAGCAGATGCAGGACCTAGG CACATGGTCGATAATGTGCAGCAGATGCAGGACCTAGCAGATGGTTGATA ATGTGCAGCAGATGCAGGACCAAGGCACATGGTCGATAATGTGCAGCATA TGCAGGACCGAGGCATATGGTCGATAATGTGCAGCAGATGCAGGACCTAG GCACATGGTCGATAATGTGCAGCAGATGCAGGACCTAGCAGATGGTTGAT AATGTGCAGCAGATGCAGATGGGCAATAATGTGCAGCAGATGCAGGACCT AGGCAGATGGTTGATACTATGCAGCAGATGCAGGACCTAGGCAGATGGTT GATAATGTGCAGCAGATGCAGATGGGCGATAATGTGCAGCAGATGCAGTA CCCAGGTAGATGGTTGATAATGAGCAGCGGATGCAGATGGTTGATAATGT GCGGCAGATGTAGATGGTTTATGATGCGCAGCAGATGCAGTACCCATGCA GATGGCAGATAGTGTGCAGCAGATGCAGGACCCATGCAGATGGTGGATAA TGCGCAGCAGATGCAATTGGCGGATAATGTGCAGCAGATGCAGTACCCAG GCAGATGGTTGATAATATGCGGCAGATACAGGACCTAGCAGATGGTTAAT AATGTGCAGCAGATGCAGTTGGTTGATAATGTGCAGCAGATGCAGATGGT TGATAATGTGCAGCAGATGCAGGACCCAGGTAGATGGTTGATAATGTGCG GCAGATGTAGATGGTTGATGATGTGCAGCAGATGCATGACCCATGCAGAT GGCGGATAGTGTGCAGCAGACACAGGACCCATGCAGATGGTTGATAATGT GCAACAGATGCAGTTGGTGGATAATGTGCAGCAGATGCAGATAGTCGGTA ATGTGTGTAAAGTTCCGCCGTTATTTGGTTTTTGTGACCTCCAGGAGTGT CCTATTGTTCCATCACAGTTCATGGCTGCATTTGGAGCAATCAAACGGTT TCCAATATTCCATGGAAAATCCCATCCAGCCAACGATCACCAGGCATTGT ATTTTCCTAGAATTATTGTTGAGTAGAATTCATTGCCACAGTACAGTAGG AGCATCTTGCCTCGCTAGCTTTAAACACGCTTACACCTAGATGTGCAAAG TTAGTTGTGACAGGTTGTTCAGTGAATAAGGGGCAGATTCCTATGACAGC TCCACTAAAGAAGACCGAGTGCCTCAGTCGCGCTGCACATTACTGAAGCC CTGGTGCCTTCCGTAATGACCATCCTCGATGCTTATGAATGACTTCAGTG CCTTTACAAGGCCATGGCCGGTGTTGTCACATTGTTGCAGTTCCCGTGAT AAATTTCCCCACATATCCCAACATCAGACAAGCCCCAAACACAATACCTG AGACTGGTGGGTGTTTGAATGGTTGTTTGCCAGGATGAACCAGGGTGCCT ATTCTGTGCGCTGAGCACAGAGCCCATTGCTTAAGTGTATGAATGTATCT ATTATAGGCTTTTACATGAGAATAGCCATTTTTAGGTACAAGTCTATAAT TTTACTGGAAATTGCAGTGTTGCCATTGAATTGAACCAAAATGTACAATG ATTCAAAACATTTTGGATGATGATGTGACGGCGCAATACATTGTTGCAGT CCCTGTGACAAATTTCCCCACATATCCCAACATCAGACAAAGCCCAAACA CAATACCTGAGACTGGTGGAAGTGTTTGAATGGCTTTTGCCAGGATGAAT AAAATGTTTAGCGATCAGGGTTCCTGTTTAGTGCCCTGAGCACAGAGCTC AGTGTAGTGAATATACAAATCTATCAATCATATAGGCTTTTACATCTAAA ACTTCTAAAGATAGGCTTCATAGAACATCCTAGCATTACTTTCTCCTGAT TTGTTTGTTTTCCTTGTTTTCCACTTTTTCTCTGATATTTGATAACTGTT ATCAAATATCAGAGGAAAACTGTTACAGAATAATTCATTCAGTTATTATT TTTGTACAATTTTGATCTATTTCTTTATAAATTGAAAACTATGTTTAACA TTGATCATGTATAACGTAATCACATTTATTATCTTCTTCTTTTATATTTA TTATATAGTGTAATCATACTTATTATGTTTGGAACTCAAAACTCATTTTG TTATTCCTCTTCTCTTTGATTTGTTTCATTAGGAATTATCATGGTATAAT TTCGTTTTTTTTTTCTTTTGTTGATTTTGCTTAGTTTTGATTATGTGCGG TTAAAAAATTGTCCAGGATATTTGGAGTTTCTTTTATCACAACCAGGAAT CTCACCTGCTGACGATTCCTGGTTGCGATAAAAGAAACTCCAAATATCCT ATGTTCTATCAACCTGATGAAATTATTTTCGGGATTCCTATTGTCTAGTT TTAAGGGAAGGCCCACGAAAACCCACATAGGCTTCTGGACAAGAACCAGA AGTCCTGGGTTCAAATCCTGACTTGCCTCTGCTGTTGTGCCCTTGGAAAA GGCACTTTTTATTACACGACCTTCCTTACTCCACCCAGGTGTAAAAATGG GTCGACTTCAGTTGGGGAGGTAAAAGGCAGTGGAAGGAGAGGGTTGGGCT CCGCCTTCCAATACTGAGCAGACCAGTTGACCATTACAGAAGACAACACA CTGTTTAGCCATTCCCCCCATGTCCGTTACAGGAGAAATAATTACCAGGG TGGGAGGTTTTGAAAAATCTATTGACTCTTGGACTTGTCGTGTTGGTGTA ATAGTCAGGGTATTTGTGCTGGATTCAAGTCCCCGGACATGCCCTTGGGA AAGGCACTTTACATGACTTTCCTCACTCCACTCAGGTGTTAAATGGGTAT GTGACTTTGCTTGGGGAGGTAAAAGGCAGTGGAAGGAGAGGGTTGGGCTC CACCTTCCAATACCGTGCCCTAGACAATGGTGGATAGCAACCCACTGCCC CTACGGCCTCAAAAAGGCTGTGGTACTGTACTACCTAATACCTACCTTTT TGCGTTTGGAGTGGCCAGCTGTGAAGTTAAGGGAGCTGAGTTCAAGTTCA AGTGAAACCCTGTTACAGGTTACTACCCCTACCAACAGATCGTGACTTTG ATTCTATGGATTATCAATTTGACTCCCTGTCATCCTCTCATTCCATTGCC CAAATGGAAGTTTATTGCGGTCTGAAATCGGATTGGAGACCTTCCATCAA GCCTCCCCTTCCTGTGAGGCTGGGAAAAATTGAATCTAGCTGCCGACATA TTGCTCTTTAGATTGGGTCAAAGTCAATGACAAGATTTTCCTGTTACATT TAGTTTCCAACATAACATACCGTTCTTTAGATTCGGAGCAAAGTCAATGA CGAGATTTTGCAGTTCCATCTAGTTTCCAACATAACGATCTTTAGATTGG GAATAAAGTCAACGCAGAGATTTTACTGTTGGATCTAGCTGCTGACATAA CGATCTTTAGATCGGGAATAAAATCAATGCAGAGATTTTACTGTTGGATC TAGCTGCTGACATAACATTCTTTCCATCGGGAACAAAGCAATTGATGAGA TGTTACTGTAGTTTTATCTAGATGCCAACGTAACGTTCTTTAGACCGAGA ACAAAGCAAATGACAAGATTTATTGTGCATTTCGTTCTTTAAATTGGGAG TAAAGCCAATTACGAGATTTTACTATTATATAATTGCATCTAGCTTCCAA TATAACACTCTTTAGATCAGGAACAAAGTCAATGAAGAGATTTTACCGTT GCATCTAGCTTCCAACATGACGCTCTTTCCATTGGGAGCAAAGCCAATGA CCAGATTTTACTGGTGATGCCTCGTGCTTCCAACGGCGTTGTCATGTCTG GTCTGCTGGGCTTTGTGTGGAATTGATGGTCGTTGGGCGTCCTAGCTCGG TCATCACTAACAATGTACCGCATCATTCCGCGTGGACCATGGACTAGATG ATGAAGTACCTTAATTGTACCATGTCTCTAAGGGCTAGGTACAGGTACAG GTAGTGAAACGTATGTATGACTTATATATTATACATGACTTAAACATACA TAGTAGATAGATATGAGCTAGCTGAGTACAGTCAACTTCTTCTGGCTTCC TTGTACAAGTGAGGACGTGGGATAATATCTCTTGTACAGAGTTGTCTACA GCAATCATCAAGTCAAGTCAAGTCAAGTCAAAGCCTTTATTTTACTTCGA ATGCTTGTTCGGCCATAATATGGCCGCTTTTCGACAAGGTCGAAGTGAAA CGGAGGGGCAGGAGTCACGGTACAATAATAAACTTAACGTAAACTTAACG TAACCGATATCAATACAATCATCAGTCACCATATCTACTCTTCCGGGATA GGAAAGTCTGCAGTATGGCTTAGCAGCGCTCCCTAGCAGATGTGCCTATA ACAACAGCTAGGTCCCATATGTACCCTGCTACATGTATATGCCTAGAACA TACAATGTTCACTTGTAAACCTCAGTTCACTGCTTTCGGTATGCCTTGAA ATTCCACACTTGGAACGCCAACTAGAATGCCAAGGAAAGGATAGAGAAAT GGCTACAAACTAAGAGTAAGACTCTCACAGTTGTAGAAGGGGAAATATGG GAGGGAAGTGTTTAATATGATCTCTAAGGGTGTTTCTGCTTGAAAAGACT AGACTCCTTGGAATGGTATATCGTGGTCCCATGGTCAAGCTGGGAGATAA GTAAGATGAGACGAGACTTCTGTCTGGAGAAGCAGCGGCTACAGGTTGTA TGGGTACAGCTGTTCGACTCACACCAGCTACAGGTACATGTTTGATCTAT TCCTTCACTCACAACACATTTCTGCAGGTGGTTGCAAATATACAACAAAG TGTGGAAGTGGATTTCGAGTGGCTGTGAACGCTGTAATTATCAGTAGAAT TTGTGATAATTTTGGTTTTTTTTTCTTCTAAACAAATTGCTTTATTCTGC AGGTGATTGTTGCAGTAAGATAGCTGCTAAGGATGGATGCAACATCCACT GCCAACATTCAGCTGCAAAGTGCTGAAAATTTTTATTCCTTTCAGGTCTT TTATATGAGGAAAAGTAGATCTCAATTTAACTATGACCTGTTCAAGTTTT CAGGTGGCTCTACCATGTTTCACTTTCAAGTGGTTTCATCACCTGTGCAA GTCTGTTGGTGGTTTTCAGGTGGCTGTGAGAATCCCCTATCCAGGTTTGA AGGTGGTTTTCAGTCGGCAGTGTGAAAATGACCTGTGGAAGTTTGCCCTG ACAGGCTGTTTCCATCCATCTGCAGATGTTCACTAAGTCTTAGTACATTA AGTGCTAAATTTTGTGGGGTCGTGTGGCGCAACGGCAGAGCGTTCGACTC AGAACCAAGAGGTCCCGAGTTCGAATCCTGTCATGTCACCGATCTTGTGC CCTTGGGAAAGGCACTTTACACGACTTTCCTCACTCCACCCAGGTGTAAA TGGGTACCTGACTTCGGTTGGGGAAAGTCGTATTGAGGTCACCTGGTGGC GCCGAATGGCAGCCGCCCAGACCCTTGCGACAGTTCCACAAAATGCAAGT GTGGATAAGATATTATATGTTGTGTATTATGTGAAACCTGCAGAACCCTG CATCAATTCAGCGCTAGAAAGGCGGCCATTGCGGGTAATTTCTGACCAAT AAAAACCAATTTGACTTGTCAGTGTTAAGCCTTCTCCTTTACTTTTCAGG TCTTCATTAGGTGCGAGCAGTGCTGTACTGGTTTACCTTTATGTTGTTTG TGTGTTAATGTTTTTGTTTACTGGTTCAGGTGTTCACTAGGTATGGGACC TGCTGTACTTCTTTGTGTATATGTATACTGTTTGTGTTTATCGTTTTTCT GTTTCAGGTCTTTACTGGGAACGGGAAGAGCTATATACACTTGTTTATTT TTTACCTTTTCAGGTCTTCACTCTGTATGGGAACTGCTGTACTTTTTCAG TACTTCACTAGGTGAAAAAAGTGCTGAACGTGTTTGTGTTAATTGTTTAT TGCTTACTGTTACAGGTGTTTACTAGGTATGGGATGAGACGTGGTGTTCT TGTTTTTGCTTATGTTTATCATTAACTGTTTCAGGTGTACTATAGGTGTG AGAAGTGCTGTACTTGTTTATGTTTACTGTTTCAGGTCTTCACTAGGTAA GAAAAGTGTAGTATTTGTTTATGTTTACTGTTTGTGTTTATTGTTTGTTG TTTACTGTTCCAGGTGTTTACTAGGTATGGGAAGTGCTATACCTTCAACT CCGGGACGCCGAACCAGCCCGTGCTGAAAACACTGAAGGGCGGCATCGGC AACGGGGTGGAGTTTTTCCTGGACGTGCAGCAAGACGACTACATGCCTGC ATGGGGGGAGTCAGGTCAGTAAACAACAAACAATAACAGTAAACAATAAT AGACAAGACGACTACATGCCTGCATGGGGGGAGTCAGGTCAGTAAACAAC AAACAATAACAGTAAACAATAATAGACAAGACGACTACATGCCTGCATGG GGGGAGTCAGGTCAGTAAACAATAGACAACAACAGTTAACAATAAAAAAT AACACTAAATAATAAGCAAGACTACATGCCTGCATGGGGGGAGTCAGGTG AGCAACAACGAAACTAACAAAACTTATATTAAAAAGTCTGCTATGGAGCC CAACCCTACACAATTTAATCTTCTTTCAAGAGCTATTTATTACTCCAAGG TCATGACCGTAGCATGTCCAGAACAGGACATATCAAAACCGAAAATTCGT CTGCAGTACCATAGAAAGTTAGGGGGTGTGTGCAAAATCTAATCATTTCA CAAATTTCATCAAGACCTACTCACATACCAAATATCAACGAAGACAATCC ACTCAGGTATTCTCGAGTTATTGTGTTCACACACAGACAGACACGTGCAA CCGAAAACTTAACCTTCTAGGCAAAGTTAACAAGGTTATCATTTGTCATG GTAACAAAGTTTTGGTCGTGCATGGTAACTAAATTTTGGTCATTATATGA AAATTTTAGCCATGGTAACAAAGTTTTGGTCATTAGAAGAAAGTTGTGGT CATGATAACAAAATTCTGAATCAGTAGAATGATTCCAAAGAAATTAGATA GTGTTGTCATTTGAAATGTTAAAACTGTAAACCTGATTGCTTTGATTTGG GAAATTCACTTTTGTTTATCTTGCCAAGAACAATAAATGTGAATAGAAGG CTTCCAAAACATGGTATGAATAAAGTTTAGAAGTTAGTTTCCAAATTTGG CCTGACTCATGTGAGCCATCATATGGTGCCACAAATTTAGTTATAAGCTG ACATCATCTCAAAACCAACTATTACTGTGTAGTCCTTTTGCCATAGATCT AGATTCTTGTAATACATGTTTCTGTAGTAGCTGTGATGTGTGCTGTCACC TGTACACCACATATTCTCCAAATGTTGTACCCACTGCCAAAGTGCCAATA TTTGCATCACATAAGCACAATGTTTGCTTCCCATTGGCATTAAGCCTGAT TCCAGGCTCAGGAGATACTGGACTTTATTGGAGTACAACTCCCTCCTTTA TGCTGTAGCCCTTATATTTAATCAAGACACAATCTTCTAGGGACACAGTG AACTACAGGTTTTCACTGACTTGTAGGCAAAACATGCCACAAATTCTGTA AAGGACATATGTCACCTCAATGTCTGACAAGTTGAAACAGCAGTTGATAA ATGAATAATAATAAATCAAATGTTTTTTTGTTGGTCAGAAATTACCTGTG CAATAGCAGCATTTCTAGTGCTGAATTGATGACATTTGTATTAATGATTA CTACTTAGTAAATGGAACTTGCAGACTCCCCTGGCATGTTCCATCAGACT CCTGGAGGGCCAGTAAGTTAGTGGTGAGATTTAGTCAGACCAGCTGCCCA GCAAGGTAGTACTGTAATTCACTTAATCTTCATGGTAGCAAAATTTGACG ATTTAAGGAAAATGGACATTTTTACTGAAATTTAACTTCACGGTGGCGGC AAGTGATTTACAGAACGGATGTGTGAAGGAATCAAAAATAATAACAACAA GTTTTTCACGGTGATGATAAGTTCACGGTACATAGGTGACCGTGAAAACA GTGAAGTTACAGTGAAAGAAACAAGACTTACAGTACATTGCTGTTTGTCG GTAGTACACTAGTCTGTTGTTATTACCTGTGCAATGGCAGTGTTTCTAGT GCTGAATTGATGACATTTGCATTAAGGATCATGTTCTTAGTAATTAGAAT TGGCAGACTCCCCTGGCATTTTTCATCAGACTACAAGATGGCCAGTAAGT CAGGGATGAGAGTTAGTCAGACCAGCAGTAGTGTTGGTAGTATATTGTTG TTTGCCGCTAGTACAATGTTTGTCTTCTCTGCACGGCTTTGTCTACACAT GGTCTTTTTCAGATGAGGTAACCTTTGAGGTGGGCCTGAAGGTGCAACTG CACACGCAAGAGGAGCCGCCCTTCATACATGAATTGGGGTTTGGCGTTGG GCCTGAGCACCAGTATTTCCTTATGACCCAAGAACAGAGGGTACAGTGTT TCCCGTACTAGCCGTGTGTGCGTGTGTGTATTAACCCAGTACTGCCTCTC CCCACAGATGAAGTAACGTTTGAGGTCGGATTCAAGATACAGCTGCACAC GCAAGAGGAGCCACCCTTCATTCATGAACTGGGCTTTGGCGTGGGGCCGG GCATGCAGTATTACGTTTCAACACAAGAGCAGAGGGTACAGTTCCCTTCT AAATCCTCACCAACAACAGCCTTGAGCTGCAGATGACCGGAATCCACTTC CTCGACCTCAACTCGAGACGTCTTAGCTTCTCCTGGGCCTTAGAAAAGTT CACCTGGCATAAATGAGGTTTTCTCCTCGAAATAGCATGTAGCCATAGCA ACAACAGGTCAAGGTTCAACTGCAGAGGGACTGTTTGCTTTGTTTGTGTG TAATCTATGATGACCGACAATGACAGTTTCTGCATGACTTAGTTCGGTTG CGGCTGACTGTAGGAGATTGGAACTTTACCCAATTCCGTATACTGCATGG GTACATGTGAAATCTGTTAGAAGCAAAGAAAACAACTTCATGTCTGAACA CTTTGCAGTTACTGTATCGAAACAAGTAGCATAGTAGAACAGCTGTATTA TTATCAATTGGTGTTAAAGTGCATGTGGAACCTGTGTGTACAGCCACAGG ACAGAGCTCTAACCTCCCATTGTCAGCTCAACCAACTTTGCTGCTTTCCC CTTCCTCTGGGCACGGCAGGGTTTGAACATGCCAGCAGGCACAAATGCTG TTCACAGCTCAAAAGGAAACCAGATTTGGCTCACATCTGAAATGTAGTTG GTTGTGAACCATGGTCAATATTGAGTGATGAAGGCCATAGTGGTCAGTAT TGACTGACAAAAGCTATCATGATAGTGGTCAATACTGACTGACAAAGGCT GTTTAAGACCAAAATGTATTTACCCTGCCCTGACCCCGCTGCTGCTCCTG CTAACTTCCTGATGCGACTCTTCACTCTCTACATGTCCTCTTGATGTTCA CCACTTGTTCTGCATCGCCCCCCCCCCCTCCTGGCAATGCTTCTCTAACA TAACATTGACATTTATTTGCAGGAGACACATCTTACACCATCCTATATAG AAAATAAGATTCAGAACAGAATTTCTGNGCTTCACAACCTCGACGTCGAC TTAGCTTCTCCTGGGCCTTAGAAAAGTTCACTTGGCATAAATGAGGTTTT CTCCTCGAAATAGCATGTAGCCATAGCAACAACAGGGCAAGGTTCAACCG CAGAGGGACAGTTTGCTTTTTTTGAGTGTAATCTACATGTATGATGACCG ACAATGACAGTTTCTGCATGACTTAGTTCGGTTGCGGCTGACTGTAGGAG ATTGGATTTTGCCTGATGCTTTTTTGCTAAAAGCTCTCAGCTTAACTCTT CCAACACAATTTCATATACTGCATGGGTAGATGTGAAATCTACAATTTTA CTAAAAAGTCAGAAGCAAATAATACAACTTCACATTTGAACCATTGCAGT ATCAAAACAAGTCGCATAGTAGAGCAGCTGTATTATTAGCAACTAGTATT GCAGTGCATGTGGAACATATTGTGTGTACAGACATTTGAGTGCAGACAGG ACAGAGCTCTAACCTTCCACTGTCAGCTCAACCAACTTTGCTGCTTTTCT CCCCTCTGGGCACGGCAGGGTCAGGTAGATGTAAGGCTTATAATCCCAAG AACATTTGCACTCTGATTTTTAACCTTTCCAAAAGGTTCAACTAAGGCTC AAGAGGGCTTGAGTCAAATTCTGGTTGGAAAGTCAAAACTGTACATCAGG TGCAAAATATTTCCTTGGTCCGAGGTGGTTACCAAGTTTTCTGCACCTGA GTTTTCAAGGCTGTTCCAAATTTAACAGTGATTTTTAGGACCAGGCTACA GCCTAGGTCACAAATTCATCACAAAATTCATATGTGAAAATCATCAGAGC AAACTGATTTGCATGCAGTAAAGGAACTTTTGTTCAGATGTCCACAGTGA CAGCCATTGTTTGAACACGCTAGCGGGCTCACACGCTCTACACAACTAAA AAAGAGACCAAATTTGACTCACACTATACTTAAAGTTGGTTTTCAACCAT GGTCAAGATTGACTGACAAAAGCCATTATGACAGTGGTCAATACTGACTG ACAAAGGCTGTATAACACTGAAATGCTTTCAGACATTTGCCCTTCCCTGA CCCCGCTGCCACTCCTGCTAACCTCCTGATGCTTCACTCTCTACATTTAC ATTTCCTCAAGATGCTCACTTGTTCACCACTTGTTCTGCATTTCCTTCCT GCCCCCTCCCCCCCCTCCTGGCAATGCTTGTCTAACATAACATTGACATT TATTTGCAGGAGACACATCTTCCACAATCCTTAGTAGCTATATAGAACAT AAAATTCAGAACAGAATTCCTGCTTTAACTCATGTTTGATAAAGTGAGTT TGCTATCACACTAGACATGATATAGCAAAATGCTAGCCTTTAAAAGGTAG CATGAAAAGTGCCCCCTACCTTTTTCTATTGGCACTGCAGGAACATCACT AGCTCCCCCAATAACCTGGGGAAAAACTTTAGGACTGCAGCTAAATTTCA CACAAGCGCTTTCACACTAACACCTTATCCTACATCCAAACTCAACAACC TACATTCACACTAACACTCTATCCTATAACCAACAACCAAAATTCAAAGC CATTGCCCTTAATCAACCGGTCTACACTAGCATTTTCCTTCATTAACTAG ACATGCTCAACTGACAAATAATGAACCTTTTCTACCTTCACTGCTCTCCT CTGATATTCTGTCCCTTTTTACTGAACAGACACATGATGTTTCACTACCA TCACGTGTCTGTTAAACTATACTGTTGCTGCTAGATGGTAAATCTATGGA GTCAGCTGGATATGTGCATCATAGTCAACCAATCATGGAAACTTGTTTGT TTGTATTCAATTTGAATAACTACTTAACTGCCTCATGTCGTAACACACCA GGTTTGTACTGAAGAGTACAAGCCGCATATCCGGACAGATATATTTGATT AACTCACACCGGGAAGGGCCCCTACTCTTATTGATAAGTGTGGTGGGTTC TTTTACGTGCTCAATTGTGACCCAAAAGATGCACATTTCCAGCAGAGATA ATGCTCCTAACTTTTCTCAGTGCCGTACAAGTCACATGTTTTTGACAATG GGACGACTGCCTTTTCTTGACATGCATGTTTCTGCTGCAATGGCTAGGGG ACTGGCGACTTGACCTACGACCCGGCTCATGACTTTTGATCGACCTTATT TTCCAGATCACCTATCTGCCCGCGCCCTGGGGTCAGTGTAAGGCCGAGAA CGACCTGACCTTTGACTTTGCCAAGTACACGACGTCCGCCTGTCGAATTG ACTGCGAGACCAAGTTTGTGGTGAGCCAGTGCGGCTGCAAGATGGTGCAC ATGCCAGGTACTGTGTCTCTCTTTCTCTCACTCACTCACTCACTCACTCA CTCACTCACTCACTCACTCACTCACACTCACTCACACTCACTCACACTCA CACTCACTCACACTCACTCACTCACTCACTCTCACTCACTCACTCACTCT CACTCACTCACTCACTCACACTCACTCACTCACTCACTCACTGTCTAACT CAAGCCTTGTCACAACACAGTAAACTTTCACAGAGACCAAGTTTGTGGTG AGCATGCATACTGTGTCTCTCTTTCACTCACTCTTTCTCTCACTCACTAA CAGTCACACACACACACTCACTCACTCACTCACTCACTCACTCACTCTCA CTCATTCACTCACTCACTCATTCACTAACTCACTGTCTAATTCAAGCCAT GTCACAACACAGTAAACTTTCGTACATTACAGAGATCAAGTTTGAGGTAA GCCAGTGCACAGCATACTTCACTCAGAATCTGTACATGCCCGGTACCTAT AAAGAAATGTCAGAAGACAATAAACTGTTGTGCACATACATTGTACATGT AGAAAAGTTGTTTTAAACAAAGAACCAATATTTTCTTCAGGAGTTCTGGT AGTTTTCAATTTCAATGATGTAGTTATGGCTGCTTGTTAAGACCTAACAT GCACATATATAACTTAATTGCACAACAATTGTACAAGGCACAAAGTATGG CAATTACATTTAAAATTCTTGCTGTTTTCCCATTTCTGCAGGATCGTTTC CCATCTGCACTCCGGATGTTTATGTGGAGTGTGCCGACCAGGCTCTCGGT AAGGACGCCTTCTTTCCTCAGACTGTTTTAAAACCCTTGTCCTGCAGGAA GCTTATATAATAATATTATAGGCTCTCTTTATAGCCTGTGTGTGGGTCCT GTATTTGTACGGGTTAGGGGTATTTTTCAGCTGAATGCATCACACCTCAG TGATACGCCCTGAATGCGGAAGCAACAATGCCATCGCAGCGCAGAAAAAG TCAAGGGAAAATGACCTGATTAAGAAATCAAATTAATGAAATAGATTGTG TAAAAAAAATAAGCAGGACAAGGGTTAACTCTGTTGGTTTCTGAGCAGCA GTGTCCATGGGAATTTCCTTGGTACAATCAAGGACATTATATATAATGTC TTTGGTACAAAGAACCTGTAAATACTGTACATAGGCTCAGAGCTTCAGAG TGTCTTCTCTGCCACGACCAGTGGAAGAATAACTCTTCAGTCAGCTAATT ATAACTGGATGAATATCATAACGATCACTAAGAATGAATAGCTTACTTGC TCAGGCAACATGGAAGTGAAACTCACAGGTCTTGCTAATTTTTCCTGTAG ATTTTCTGGTGAAGTCGGACAACAAGAAGTGTGTGTGCGACACGCCCTGC AACACAACGCGCTACAACCTGTTTATGTCTCATGTCAAGTTCCCCAGCGA GCAAGCCGTCAAGTATCTGGCTAGAAAGTATGCCAAGCGCGAAGATTACT TCAGGTGAGTGCGAATGTGGCTTCAAGCGAGTGTGAATGTGCATGGCAAG TTTGCATACTACTTCAAGTGCACATGAGTGCAAATGTGTCTTCAAGTGAG TGTGAATGTGAACTGTATGTCTGAAAACTACTTCATGTGAGTGTGAATGT GCCTTTGGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGG TGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGA ATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATG GCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTG TAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACT TCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAG TGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGT GCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAA GTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGG CTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAG GTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTG AATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCAT GGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCT GTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTAC TTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGA GTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATG TGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCA AGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAG GCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCA GGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCACGTAAGTGT GAATGTGCATGACAAGTCTGTAGGCTACTTCACGTGAGTTTGAATGTGCA CGGCATGTGTTGTTTACTTTTTGTTTGTCAAGATTGTTGGCATGCTAAGA CCAGTTGTTGTTGGCTTTGGTGAGCCATAATGTAGGGACTTTTGCTGTAG AAGCTTGTAGTTTGTAGTTGCTGAAGTGGGGGAACCGCAAAATGTAACTG ATTTTCCAGAAAGAGATTTAAGGTTATTGTTTTTGGTAAAAATTGAAAAG TGGACAGAAAAAGTCTTCACAAGAAATTGAACAGAAAAAGTTACAGAGAA ATCATGCATAGATTTTCAAACATTATAATCTGAAGCCGTGCAGGCTTTTT GCAGGCTATGAAATATTATAAATATAATATTATAAAAAAATTATAATATT ATAATATTACAAAGTCTAAGCGGAAAGCCCTTATTGTAACCTGAATTCAG ATATTGACAAAAAAGCAATGATAACAGTTTTAGATTATAGTCCTGCATGA ATTTCCCTCCTAGGAAAATTTTGTATTACAATTTATCGCTATAGTGGCTG GAAGGATATTTATGGCTTTCACAGTCTGCATGTGGTTCCCCCCTTTGCTG AAACCCAGCGCTAACCCAGCTACATGACCCAACGTGACCTTTAGTCCGAA ACAAACTGTGGCTGCGAGCTCAGAGAATGTCCATCATGCATGTCCCGCCA GTAGTGGGTAGAACCTCATGATCCAAAGACTAGAACAAAAAAACCTCCCA GGGTATTCTCTTCTTCACACACAGGAAAAACACCCTGGTTTTGAACGTCT TCTTCGAAGCACTGAACTACGAAACTATCGAGCAGCAAAAGGCCTACGAG GTCGCTTCTCTCCTCGGTAGGTGTGGGTGTGTAGACTAGCGCGTGTTGTG TCGTGGCGTAATGTTGTGGGTCGTTCTGTGTCTCTCTCTCCTCGCACAGG AAGAACACTCTGGTGATGAATATCTTCTTCGAGGCGCTAAACTATGAAAC TATTGAACAGCAAAAGGCCTATGAGGTAGCCTCCCTGCTGGGTGAGTCTC GCGAGTTGTCCATCATCCCCCTCCCACCCCTGCAGTCGCATGGCAATGGA ATCTTCCACAAGCCCGACCAATGGAATTGGGTAGACGAGGAACAGACCAT GTTGACTCTTAGGGGGATGTCTTGTCAAAAAGTTTTGTTTTTCATATATA AATTACTGATAAAAACGTTTATTATACCATGTTTTTGAAAAAAGTTTATA ATACCACATTTGAGAAAATGTTTATTATACCATGTTTGTAAACCTTTATT ACACCATGTTTGTAAAAACTGAATTACTTTGTTTGAGATGCATACTGGGA CTCGACACCCCCCTCTAGTCATCAGTGGTTCTTCCTGAGTCAAGTTCTGC CTCTGACTTTGGCATGTTACTGATGCATGGCCAATCACAAGACCCTTCCT CTCCCTGCCCAACACAAGACCCCCCTACCCAACACAAGACCCCCCCAGCT GAACACCAAGAGCCCACGGCTGAATAGAAGATCACCCCTATCCGCCCAAC ACAAGACCCCCCCCCTGCTGTCCTTCATACTGATATCTTCCTTTTTCAGC TGCAGTTGCAGAGCTGTCTCCTCCGGGCACAAGATGGTTACAGGGTGTAC ATGTACATGTACTACTCCCAAATGTACTACTGTAAATGCAGAGATGTTGC AATGGTTTTGTTTTTGTGGTAAAGTCGCAAAATTGAAACCGCCGCAAAAA GCCGTTCCACTGTGTGAGTGTAGCGCTACTAATGTTGCAAATGTGAACTC AAAACTACCGCAAACAATCCATTTTCTCAGTACTGTAAAATTAAATCCTT GCGAACATTTCTGCATTTACAGTGATTCATGAGCATACAGGCCAAACAAA CTGCAGAGATGACATGGACAAACCCATGGGTTTGTACTGACATATTAGGG AGTGGTACCAAAATTTGGGATTTGTGCTAATATATCTGGGACTTGTACCA TGAAAAAATGAATGTCACCTGTAAAAATTTTTTATATTTGCCGATAGTAA TAGTTGTCAAAAGGACCCCTGACCTCCTCCCTTGAACTCTGGAAGAACGG CTTAGGCCGAAGAGTGCATCTGTATACAGTACTCTCAAGGTTATATAAAG GTTGAAAAAAAAAAAAAAAAAAACTTGTTTGTGTGGCCCTGTATGACTGG GCATACTAAACCCTGGACATGTCACGTTGCTGGAATCCATTTGTTAAACA CTCTTATGCTTACCTCACCCCACTCTGATAAACAGTTACTCACCTGCACT TATTGATCATGCTAATAAGAACCAACCTGATTGACTTACCTGACCTTTAT CTGACCCCTGACCTTTGTCCCTTGCCCTCCTCAGGTGACATTGGTGGACA AATGGGCCTGTTCATAGGCGCCAGTATCCTGACTATTCTGGAGCTCTTCG ACTACCTCTATGAGGTGGGACTTGCCTGACCTTTATCTGACCCCTGACCT TTGCCCCTTGCCCTCCTCAGGTGACATTGGTGGACAAATGGGCCTGTTCA TAGGCGCCAGCATCCTGACTATCCTGGAGCTCTTCGACTACCTCTATGAG GTGGGTACAATCACTTGAATTTCTGTTTGGTTTTGTTTGTTTCATTTATT GTTTATTTGCATATTACGTACTTTTTATTTATTTGCTCTACTGTGTACAA TGTACAGCAGCCAAGGCTGCCCGACTAGCTATTGCTATTACAAGGGGCCA GCCTTGCTGCAAAAGTACATGATGAAATACAATAGTTGCATAAGTTAAAA ATAAATCATACACACATACAATCATACAACTCTTACCGTGAATCAATATA ATCATTCTATGAATACAACTATAAAATCTAAAAGGGACAAAATACAGATA CGGATTGTACATTGGAATAAAAGTCACTTCGTACTAGACCGGGGAGATTT AAACAGAGAAGGGTTCCCCCAGTGAGTTCCATGCCATAGTTTAAAAAGTA GGGAGTGAGGGGGCAGTCCGTCTGTTACGTACGTGGGCCTCTCCCCACAA ACTTGACAATATCAATAATGATTAAAACTGTACATAATCAAATCTTGACA AAATTAACAAAAGAAATTAATTTTATTAAGTTAATTCTACCATAAAACGG GCCAAAAGCACTAGCCCTGTGCTACGTTCGCTCTAAGGTTCGACCGTGCA ATCTGCCGTTGGCCAACGAACACATGTTCCATTCGGGTTACCTGAGGTCA CGTTGCAGGAACATGCCTGCAATTTTATGTAGCTTCAATCATTACAAAAC GCCCATTATTGTATGGGGAGGGAGTGATGTATACCGTATTTGCTCAGGAG CAAATGACGGCCTTTCTAGTTTGTTTATTTCTTCGTTGTTTGCTCCCTGT AGGTTCTGAAAGACAAGTGCACCGAGTAATTTGCTTGTTTATTTACCGAT CTGCTTGTTGTTGTTTGCTTATTTGTTCGTTGTTTGCTCCCTGTAGGTTC TGAAAGACAAGTGCACCGAGTAATTTGCTTGTTTATTTACCGATCTGCTT GTTGCTGTTTGTTTATTTGTTCCTTGTTTGTTCCCTGTAGGTTCTGAAAG ACAAGTGCACCGAGCGCCGCCACCAG

Coding sequence (CDS) from alignment at Sc0000000:169904..321929+

>BlTCONS00000023 ID=BlTCONS00000023|Name=BlTCONS00000023|organism=Branchiostoma lanceolatum|type=CDS|length=927bp|location=Sequence derived from alignment at Sc0000000:169904..321929+ (Branchiostoma lanceolatum)
ACAGGGCACCAAATCGAGGATATGCTCCTGGATTGCAAGTACAAGGGGGA
GCCCTGCAGCGCAAAGAACTTCTCAACTGTGTTTACTAGGTATGGGAAGT
GCTATACCTTCAACTCCGGGACGCCGAACCAGCCCGTGCTGAAAACACTG
AAGGGCGGCATCGGCAACGGGGTGGAGTTTTTCCTGGACGTGCAGCAAGA
CGACTACATGCCTGCATGGGGGGAGTCAGATGAAGTAACGTTTGAGGTCG
GATTCAAGATACAGCTGCACACGCAAGAGGAGCCACCCTTCATTCATGAA
CTGGGCTTTGGCGTGGGGCCGGGCATGCAGTATTACGTTTCAACACAAGA
GCAGAGGATCACCTATCTGCCCGCGCCCTGGGGTCAGTGTAAGGCCGAGA
ACGACCTGACCTTTGACTTTGCCAAGTACACGACGTCCGCCTGTCGAATT
GACTGCGAGACCAAGTTTGTGGTGAGCCAGTGCGGCTGCAAGATGGTGCA
CATGCCAGGATCGTTTCCCATCTGCACTCCGGATGTTTATGTGGAGTGTG
CCGACCAGGCTCTCGATTTTCTGGTGAAGTCGGACAACAAGAAGTGTGTG
TGCGACACGCCCTGCAACACAACGCGCTACAACCTGTTTATGTCTCATGT
CAAGTTCCCCAGCGAGCAAGCCGTCAAGTATCTGGCTAGAAAGTATGCCA
AGCGCGAAGATTACTTCAGGAAAAACACCCTGGTTTTGAACGTCTTCTTC
GAAGCACTGAACTACGAAACTATCGAGCAGCAAAAGGCCTACGAGGTCGC
TTCTCTCCTCGGTGACATTGGTGGACAAATGGGCCTGTTCATAGGCGCCA
GTATCCTGACTATTCTGGAGCTCTTCGACTACCTCTATGAGGTTCTGAAA
GACAAGTGCACCGAGCGCCGCCACCAG
Gene-mRNA-Prot
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
BlTCONS00000023-exon-Sc0000000-1564993656:169904..169983BlTCONS00000023-exon-Sc0000000-1564993656:169904..169983Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:309867..310017BlTCONS00000023-exon-Sc0000000-1564993656:309867..310017Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:312261..312388BlTCONS00000023-exon-Sc0000000-1564993656:312261..312388Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:315510..315660BlTCONS00000023-exon-Sc0000000-1564993656:315510..315660Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:316395..316451BlTCONS00000023-exon-Sc0000000-1564993656:316395..316451Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:317004..317157BlTCONS00000023-exon-Sc0000000-1564993656:317004..317157Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:319078..319169BlTCONS00000023-exon-Sc0000000-1564993656:319078..319169Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:320688..320767BlTCONS00000023-exon-Sc0000000-1564993656:320688..320767Branchiostoma lanceolatumexon
BlTCONS00000023-exon-Sc0000000-1564993656:321894..321929BlTCONS00000023-exon-Sc0000000-1564993656:321894..321929Branchiostoma lanceolatumexon
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
BlTCONS00000023BlTCONS00000023-proteinBranchiostoma lanceolatumpolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000000genomeSc0000000:169904..321929 +
Spatial Expression
in the tripal_feature_cv_term.tpl.php
Properties
Property NameValue
GeneIDBlCUFF000016