BlTCONS00000018 (mRNA) - B. lanceolatum

Overview
NameBlTCONS00000018
Unique NameBlTCONS00000018
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)

Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000000:135885..326093+

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>BlTCONS00000018 ID=BlTCONS00000018|Name=BlTCONS00000018|organism=Branchiostoma lanceolatum|type=mRNA|length=190209bp|location=Sequence derived from alignment at Sc0000000:135885..326093+ (Branchiostoma lanceolatum)
CCTGGAAAGTGCAATAAATATTCCTGGATAGAAAAACACATTCATCAAGT CTGCATCGCCAGTAAGTAAGAGATTATTGCTTTAGTACTGATGAGGGCTG GGCACTACCAGGTTCATATGTTGGTTCTCGGACATAGAAAATAATTCTAG ATTGTAATGGTGATAGTCCAGCTGTGTTGTGCTGCTGCAGTGGTCTGAAC ACCCTTGGTTGTGATATTAACTTGAAAACAGAGCCTGAAAGCTTGATTGA TTGATTGTCAATGATTGACTGATTGAAAGCTGTACCTTCAATTGATACAC ACAGTTTCAGGGAATGTACATGTAGTAAGATGCAAGTATTCTCCCCAGCC TTTCATCTAGAAAACTTGCTAGATTTTTATTTCAAAATGTCTGAGAACCA ATGGAATAGACTGTTGTGGCCGTAGTCTTCTGTGTGGGTCTGACAGATGA TGGTTCATCACCAGTGTGGGTCTGCACGGTTCCTCCGCATGTCTGGCAGT TGAAAGTCAAAGTGACGTAGACAGACCACCTGTGCCCTCATCGTTTCCTT AAGAAATAAGCCTTTCCTTAGATGTTTAGAAAAGGTTATATACAGGTTAT ATACAGTCTAACAACTTTTGACATGTCTGCTGTGTGGTGCCGATGGTTTC TCACCAGTGTGGGTCCGTTTATTCGGTATGTCTGTCAGCAGACGGTAGGT GGGTTACCTGGGTTACACACATACCACACACACACACACACAGACAGACA AACACACACACACACACACACACACAGACAAACACACAGACAAACACACA CAGACACACACACACAGACACACACACACAGACAAACACACACACACACA CCACACCACACACACACACACACACACANNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNCACACACACACACACACAAACACA CACACACACACACCACACACACACAGACAAACACACACACACAGGCAAAC ACACACCACACCACACACCCTCACTGCACCATTCCCATCCCCATTACGTA GGACATGTAATAACTGTGAGGTCTGACCTCTGACCTGCAGCCATCATTTT CCCGCCAGCCACAATAACGCGCGGCGCGAGGGGGCATCAAGGACGATCGG ATCTGCTCGACTGACGGACGTAATAACGATTCCGCTTCTCGCTCCGGCAC GGCAGAAAAATCCCGCCACATAAATATCCTAACGTTTGCTGGGAGTGGAT AAATCAGGGGGGAAGACAGCTGTGCCTAACACAGCTGTGAAGAATTGCGG AACATTAGAGTTGGGAGATGAGATAAAGTTTTAACTGGCTGAGATGAGAA TTTTCTAACTTCTGTTGTTTTGTTTGAAGGACTGGAAGGAAATGTTAATT TCTTCTGTTGTTTTATCTCAACATGCGGACAGAAAAATCCCGCCACATAA ATATCCTAACGTTTGCTGGGAGTGGATAAATCAGTGGGGAAGACCTAACA CAGCTGTGAAGAATGGCGGACATTAGAGTTAGGAGATGAAATGAGATAAA CTTTAACAGGCTGAGGTGAGGATATTCTTCTGTTATTTCAGTCTAAGACA CGGACAGCAAAAATCCCATCACATAAAGATGATGTTTTTGGGAAGTACAT CAATCAGAGGATCTAGGTAACACGTCTGGATAAATCAGGCAGGAAGACAG GTGTGCCTAACACAGCTGTGACGAATGGCAGTGCAGTAAAGTTCGGAGAT TGGGATTGAGACGAGATAAACTTTTAACAGGCCGAGATGAGAATATATTG ATGAAGGTTAGACATCCAGGTAGTAAGATACACAAAAATAGTTACTCAAG CAACAGTGCTGGATATGATTTTGAAACAGTCAGACGTTTCAGACAGCATT CACTGTCTTTCGTCAGTGACTAATGAGACGAGAATATTCTTCTATTATTT AAGCTCAACGCACAGACAGCAAAAATCCTGCCACATAGATATCATAACGT TTTTGGGAAGTGGAATAACAAGAAGGTTTAGGTAACATCATTCTGTAAAA AAATTGCAGCACATACAAATTTTTCATATAAACTTTGAACTGGTTGAGAT GACATTATTCTTCTGTTTCAGCAAACAAAAATTCCGTCACATAAAATATC CTTGTTCCAGGAGTTGATGTATTCCTGAATGAATCAGAGGCAGCCGTGAG GAACTCTTATTGCTGCAAATATTCACTTTCACTTCACTTTCACTCTCGCA GGCCGCAATAACATCACTCATCTCCCTTAAGCACCGGGAAAAATCCTGTC ACGTAAATCTCGGGTTGGGAAGGGTTGGAATTTAGTGAAGGAAGTCAGAC ATAGCAGGGGCATCTGAAGATAAGAAAAAAATATAATATCATAATTGCAG TGCCAAATGTTAGAGTTTTTTAAAACTCTATTGTTAAAACATTGTTCTAT TGTTAGAACATTGAAAGCATTGTTAAAACATGCTTAGATAACAACCTCTT GCTTTGTTCCACCAACACTATAATTGCAGTGCAAAATAGTATTAGTTTTA ACATTCTTAGATAAGAACCTCTTAATTAAGAAGACCGTAATCACATAATT GCAAAATACTGTGGCTTAAATGACCCGTTAGTTTGTTCCAGCAAAACTAT AATAATCATTATGGCAGTACAAAATTTTAACATGGTTAAATAACAGCCCT TTGCCTTATTCTAGCAAAACTTTTAACATGCTTAAATAATCATCCTTCTC TTGTTTTAGAATGACTCTCCCATAGTAAAAATACCCATAATTAGGAGGTT TATGGATTACTAAGGGCAGCTCGGTATAGCTGCGTTGTACATAACAAAGC GCGCTTGTCTTGTTTGAGCTTCATATGCCTGAAGTAAAAACACAAACTGT GAAACTCTCATTAGTGACATTAGTGTCATTAATATTTTTAATTTATTAGT TACTAAGCCGGGAAAAGCTACACTGTACCTGTCTGTGAATCTGTGAGAAA CTTACTGATTCTGTCCAAGTTCAAGTCTACTGGCTGGGTGATAAAAGTTG TTTTATGTGCACTGGACAGCTCAGAAGGTCAAGTTCGTTGTAGCAGTAAA ATTTGTGACGATGATGCCGTTGGGCCTCTATGTGTGTGGGCCTGTAGATG TCTAGATCCTAATTTGGTTAGTATAGACTACATGTAAGTTTTGCTATGTC CAAACCATGAGACAATTAAGTATTTGTCAGACATCGTTATACTTTCATTC ACAAAACCCTCACCTTGTCTCGTCCACATCGGCTTTCCTCGTATTGTTGA TCACATTTTGCTGCACCACTTACACCGGTCCCATTACTCCCCAACTTCCT GGACTGCTGGGTGGGTTTTAGCACATGATTAAACAGTTAATAGAGTGTTT ATTTAGACTTCAGGTATCATATGCAGGAAACCCAACGCTTTCGAGATAAT TCCAGCAACGATACAATATTTCCATCTATTCCAGTGCTAAATTTTCACCT TTGTGGTAGGAATAACCTCCACCACATCGCCACATCCAGCCTATTACTCC CCGACTCTTTACCAGCCCAAACTTCCCCGCCAACTGGCAGGCTGTTCGTC TCACTTACCCGCAAATGTCAGAGGTCAGATTCAAGTTCACTCCCCGTAAC AGGCCGATCTGTCTTCGGCCGGCAGCCGGCGTTCCCCCAAACTGGAACAG ACATCCGCTGACCTCTTGGTGTCTGTTGGGACTCCAGAGGAGTATCAGAC TCTCTGTCAGGTCAAACTTACAAACATCTTCAATCTGTGACACTTGGAAT ACATTTATTTCAAAGCTTTAGTCAGTGCAAATATGTACATACAAAATGTA CATACATCATGCAAAACATATTTGCAAACCTAAGATGACAGGCAAAAAGG TGGGATAGAATTACAGCCGACAGCAACCCCCCAAACTGGAACAGACAGAC GCTGACCTCCTTTCTGTCTGTTGGGACTCCATAGAAGCAGCTGACATCTG GGATGCGGATTCCACTTTCTGTCAGGTCGCACTGTCAAATGCAGGTTTTC AATCTGTGCCACTAACAATACAGCAAGAGTGGGTGTCTAGGATTGTTTCC ACTGCACTTCGGTAGGCCAGGTCACACATTCAAAACATGTACGACACAGG TTTTCAATCTGTGCCACTTGCAATACATGGAGAATGCATGTATGTTACAC ATGCATGTTTCCTAGACTGTGTTCATTGTACTGCGATCTGCCAGGTCGCA CTTTCAGAGTCATGTTTTCAATCTGTACCACTTACAGTACATGGAGAATA TAAACATGTGACGCATATAATGCTGTACTGTGGCCTGATAGCGCTGTAGT CGACTGATACAACGAAGTTGTTCGATGATCTAAGGTAGTCTGTCCTGTAG TCTAGCCTGTCCTCTCAGTGAAAGTGAAAGGTGAAAAGTGAAAAGTGAAA AGTGAAAAGTGAAAAGTGAAAGTGAAAAGTGAAAAGTGAAAGTGAAACCA GATCAGACAGAGGGTGTCTGAGTGTCCCCTCCTTTATATGTAGTCTCCCC TGTATATCAAGCCTGTAAGCTCAGTGGAAGTGAAAGTGGAAAGTGAAACC AGTACCAGAAGACGTTTGTGCCTGTGTCCCCTCCTGTAGTCTCCCAGCCT GTCTGCTCAGTGAAAGTGAGAGTGAAAAGGAAAGTGAAACCAGACCAGAC AGAGGTTGACCCAGACTGCGCCCGTCTGCCACCGCTAGCCCCGCGCCCGA TCACTCATCCTCACCAGCCAAATGTCAAGGTGATGTTGCCATGGCAACGA GGGACAGAATACCACTGGATGTGTTCTGTATTTGCATGTGTACAGCCGGT ATAGCCGCCCTTCGGCGTAACACACCAGCTTCCGTGTTAACCACTTTGCC CAGCAGAAGCATCCAAAGGAGAGAGCTCCAGTGTCGCAGGGACACTCGTT GGCTGCCTATTTGGTCTTTTTGGGAGTTTTTCTTTAAAAATCATCACATG AACATTTTTGCATAAAATGTTTATGAAGGTTGGACATCCAGGTTAACAAT GACAAATACAATTCAGCCCCTACAACTGGATAAGATATAGAGATTACTTC TGGACGTTTTGAGTGACATCCATCACTCTTCTACAGCGTCACTAGAATGA ACAGAACATTGAAATAGATTAAGTTGTATAAAAGAAAGAAAGTGAAAGTT TTCCAGTCTACCGTCAGGTGTTCCAGTGTTGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGGTTAGGCACCAGTGCGAGTTTCAGGGTTAGGCACCAGTGCGAG TTTCAGGTGACACACCCAGAGTTCGGTTTCCGCCAGGGAAGACAATCGGA CCGCTTTAAGAAAAAACTCTGCAAATCTTCTTTTCAATTAAGGCCTGTGA CAGAAGCAAGAGTGAAAGTGACAGTTAAAGTGACAGTCCCTTGGAGGATG ATGGTGCCGAGTCGGCGGGAAATCCGTCACCATCACACTCCTGTCAGTGG AGACGGGGGAAAGTCGAGGGTCGTGGAGTAATGGGGAGAAAAAGTGAAAG TGATACATGTCCCGTCTTGCAAGACGCACCAGAATGGGAAGTCAAGGCCA TTTCTGAGCAAAAATGCAGCAAGTCAAGAAGGATGAAAATTGAGGGCTTG GATAATTGGATACAGACAGTACTTTTATTTCCCCCATTAGCTACATACAT TAAACATGGGCTCAGGGAGGAAAAGTAGAAATAGACTTTATTCTAGAGCG ACTATGATAACTGCTGTTTTATAAGCTAGTCTCTATTTCCCACCATGATA GTAGAATTTTTGTCCTCCTCATTTTGTCACTCTGTGATGTTAAGACACTT TCCCTGTTCAAGCTGACTGGCAGTCTGAGAGATTGTGAGAATCTGCCTCA ACTTGAGTTTATTCATCGTGATATTCTCTTCGCGTGATGATCGCGTGATA TTCTGTCTTCATGTGATGTTATGAACGTTCTTGTCCTTCTGATTTCTGGT GATGACGATGAGGGATGTTGTGAGTGTATGATGGTGAGATTCTTCATGTA ATGTTGTTGTTCATCAGCCGATGTCACAGCAATCACTTCCCACAGTTTAG GTGCAGTTTTTTTCCTCCTGATTTTTCCCAGTGTGAGTGAAAGTGTGATG TGAAAGTGAAAGTGGTGATGAGGATGGGGATGTTGTGAAAGTGAAAGTGG TGATGAGGATGGGGATGTTGCAAAGGTGAAAGTGGTGATGAGGATGGGGA TGTTGTATGATGAATGGTTCATCATCCCGAGTCACAGTAATCACTTCCCC CCAGTAATTACTGATCGAGCACCAATTACGCCACGACGGCACCTCGCTAC GAATCGCTCCACTTTCACTTTTATTGGTGTCAGCCTCATCTCTGAAACAT GATACCTGATGAGCAACACTTGGAACCGTGTCGTTTACCTTAACGAGCGC CGTCTGCACTAACGAGCGGATAGGTCTGATGTCGCCAGCCCTGTTTATAT ACAATAGTTCTAATGGGAGCTCGTTAAACCTTGACTGCTGGTAATTAATT TGTGATCTCTGCGTTAATTTTCAGCTTTATTAAAACAGGAAATGCCGTTG TGTATTCGTGACTGTGTAATTGTGTTTCAGAAATTAAGCGAGTTCCTACG CAGTGTATTTTCCACTGACTGACGGTGTTTATATCATAATCTGCAGAAAG TCTGGGGATGATTAGACTCAATTTGTTTGTTTAGCTCGTTTGTTTTCTTG TTTAAGGAATAAAGTTGGAGCTCAGATCTGTAAATGTGTTGAATTATGTT ACATGTATTAAGACTTACAAAATGAAGCCAGTTCCTATGCAGTGTATTTT TGCTGCTTGACGATATTTGCATAATAATTTCCAGGAATTACAGAAAGTCT GGGGATAAGTTAGAGCCACTTTGTTTGTATAAGTAGTTTTAGGCATAAAG TTGGCGCCCAAATTTGTTTTCTTGTAAAGATTGGTGGTGCTTATTTATAT CTTAATCTGCGGAAATACTTGTGATGATTAGAGTCAATTTGTTCATTTAG CTCGTTTGTTTTCTAATTTTAGAAATAAAGTTGGAGCGGGGCAGATTTGT TTTCTTGTTAAGAATCCTAGTGCTGAGTTTTCCCGACTCTCCTCGACTCC CTGCAGCTTCAACTTCCCCATTAAGACGGTTTTTAAGGAACTGTAATTCT AATAACGAGTCTTGAGGCGTAAAGTTGCCCCCGAGGCAGCATCAGAATTT CAGGAGATGCAGAAATTATAGGCTGGGAGAAAAATTACTTCAGTAGGAAT AAACAGTTCAAGGTCAGCCCGGCTGTTTGGGGGAGCGGCAGGGGTTTGTA TTATTCACATCTACTAGGAAATACATAGATCTTCATGGTTGGTCCCTGAG AAGTACACTTTCAGGAAATTTATCCTCTTAGGAAAAACATTTATCTTCAT GGTTGGTCCCTGAGAAGTGCACTTCCAGGAAATCTATTCTATAAGGAAAA ACATTGATATTTATTGTTGGTCCCTGAGAAGTACACTTCCAGGAAACTAA TTCTATTAGGAAAAACATTGATCTTCATGGTTGGGCTAAAAGTAGTATTG CATATCCCGGCCCTTTCCTCTTACAAACAAAAATAAGATAAACAAAACTT GCATAACAAATGACCACAATAACGTGAAAAGAAAACAAAGCAAAATAAAA CAACATTAAAGCATAGATCTGGTGAAAAAACAAACTTAAGGTATTTGTCG CTTTTTTTTCCAGCTTTGTCATAATACAATAAACAGGAGAGAAGTAACAG AATGAATCCCTTTCCCGGCTTCTGTCCAAAATGAAACAATACATACAAAT TATTGTTATACAATTACAAAAGGAATACCACTAACAAAGCAGAAAGTGAA AGTAGCATCGAAAGTGAAAGGAAACTTTGAATTCCCTTTCGGTCGCTTGT CTCCTGAGCTTACGTCAGAGATGTAAGATTGCTCCTGTCCTCTTTCTTAG GTTTTACCTTAAGATGTCTGAGACCCAGGAAAATAGATTAGTGAGGCATC ATTTGAGATGAAAGGACCAGTGAAAGTGAAAGGAAACTCTCCCTTTCTGT CGCTTGTCTCCCGAGGTTCCTCCGACCGTGAGCTTTAAGAAGGCTGCTGT CAGAAATAAGTGCAGTTTAATGTATGTAATAAACTCCTGCCAGGGACGCG CCGCGACTAGCGGCTCTGATTTCCCTCGTGTAGCCTCCTCACAGGGGGTC CGCAGACGTGCGCAGACTCAAGACGACTCCAGTCAGATTTAAGACATTTG CTAAGACATTTGCCTTGTGTTGCTGCCATTCAAGGGGTCCTGGAGACTCA AGACAGAGCTAAGACGACTTGAGTTGAAACTAAGACATTTCCCTGCTGTT GCTGCCATTCAGGGGGTCCGGAGACGTGCTCAGACCCAAGACAGAGCTGA GACGACTCAAGGCAGAACTAAATTTACCAAGACTCAAGTCAGAATTAGGA CATTTCATTTCTAATACATTGCCCCAGTTTGTTGTTAAAACAAATCATTC TCTAAGATATTTGCCAAGACATTTCCCCAGAAGGTTGTTAAAACAAACTA TTATAAGACATTCGCAAAGACATTTCCCACAATGTTGTTTGAACTAAGAC CTTTGCGGAGACATTTGCCAAGACTATCAGAAGTTAGATTTGCCTGTGCT AGCAGCCCGGTGAGAAATGGCAGAGGACATGTTTGGACTGTCAAAACTTA AAGACATTTGCAGAGACATTTGCTCAGAATGTTGAGACATTTGCTGCCCT GTGGGGAAGTGTGTAAGACGTGCCCAGACTGAGGTTAGAATTAAGACGCT TGGTCCGCAGGGTAAGAGTCGTGACGGTGGTCTTAAGTCGGATGATTGCC GAGTGCGGTCTCCTCTCCCTGGACCACCGGAGGCTGGACAAACTTGATGA ACTCAGCAGCTCCTTATCTCTGCGCAATCATGGCTGGTCGCTATGGAGAT AGGTTACCATGGAGATAGGTTGCCATGGTGCTGTCTGTTCTCCCTGGCCT GATGGATTTCTTGTTTAGCATGAATTTAGATCAGACAGAACCAAGTGTGA CGAATTCTCCCCTCCCCACCTCCCTTCACAAATCAGCGAGGGATTACTGG CCGTGATGCCTGCAGTTCTGGCATTAACTACGCAGATAGGCCCAAACAAG GCAGTTCTGGGTTCTCAAGTTACAGTTAGGCCCAAACAAGGCAGTTCTGG GTTCTCAGGTTACAGTTAGGCCCAAACAAGGCAGTTCTGGGTTCTCAAGT TACAGTTAGGCCAAAACAAGGCAGTTCTGGGTTCTCAGGTTACAGTTAGG CCCAAACAAGGCAGTTCTGGGTTCTCAGGTTACAGTTAGGCCAAAACAAG GCAGTTCTGGGTTCTCAAGTTACAGTTAGGCCCAAACAAGGCAGTTCTGG GTTCTCAGGTTACAGTTAGGCCAAAACAAGGCAGTTCTGGGTTCTCAGGT TACATTTAGGCCAAACACTTTGTTAACGTGGTTGATCGGGTTGTTCTGAC AAGTCCTCGTTTGTCAGGATCACTTCGGGAGCCCCAAATTAGGGGCAAAC TCGTTAGCACCGACCTGCGGCCTCATCGTCTTAATCATGCTTAAGACGAG TGGAACAAAGTAAGGAGTCCAGATCGTCATCTTAATCATGGCGGACTTAA GACAAGCTGAAGGAAGGAGTATCTAAGAATTTGGCTGTTGTTTTCATCAG TGCTGCGACTTTCGGCAGTTTTTGCGAGCTTCACAAGCCAAAAAAACATT CCACTCAAAATCAATGTTTTCACTAACTGTAGTCACAACTACAACTTGCT GACTCCGTTTCCATGGTGAACCCATTACCATGGCAACCCAGTTCCCATGG TCACCCCGCTACCATAGTGTCTCATGTTGGAAATGTATGCCACTGTTCAA TGATACTTGGAGAAATCTGCAACCTATAATGTGTTATTACTTATTTCTTC TATTTCTTTTATTATCTCTTCAATTTCTGAGATAATTGAGTGGCCCCTTC AACATTGATGTGTCCAAGGGGACATCATTATAATGAATGAATGAATGAAT GATCAATAAAGGTCTTCATTCATCATTAGAAAAAAAAAACCCAAGCTAGT TGGAAATTTGAATAACCTTCGCACATAATGATTGCCAAAGCGAGGTCCTA ATCCGAGTCGATCTCGGATCCATTCCTGTTAATAAAATCCCCGAGTCATC GGGGGTCGTTGGTCCGCAGGGGCTTATTCGATCCTTAAACCCACTTTTGC GTCCAACGTTCCATCATGATTACGCGCGAAACGTGGAGCGACTCTCAACT GCCGCTGTTGGACTGCACGGAGAGTCACCACAACTGTCACACTGCAAGCT GAGAGACTCAGAAACACAGCTTGACTGTGAGCATAGTCACCACAACTGTC ACCACTGCGAGCTGAGAGACTCAGAAACACGGATTGACTGTGAGCATAGT CACCACAACTGTCACACTGCAAGCTAAGAGACTCAGAAACACGGATCGAC TGTTAGCAGAGTCACCACAACTGTCACACTGCGAGCTGGATAACTCAGAA ACCCGGCTCTGTGAGCAGAGCCGCCACAACTGTCACCACTGCGATCTGAG AAACTCAGATAATGGTGCTTCAGGGTACAATCCAGCTCCCCAGGGCTCTT CCAGCCATAAAAACAAAGCAGCAAATTCATTACCATTTGTCTTAAGTGAG CTGGATTACCGGCGTAAGTGGCAGGTGAATAAAGCCTTATTTATGGTGTG TCTGCGGGAGTGATGAAGGTGCTTACAGACAGAGAATAACTGACGTTATG TCGGAGTTATGGGGACACCCAAAATCAATAGTTCTGATGCGATTGTATCT CTGATAACAGATTCCGACAAAGCCTTTAGAAAAAGCAAAGCTGAGCGCTG AAGATTGTGATGCTTCCGTCTGATTGGCTCAGTATATTTTAGAGGTTCAC AGGTGCACCGATGTTTGTGATTGGTCAATATATCGCAAGGGACAATGATG CTGTGATTTGTCACGAGTGTTCCATGATGATGATTGGCCAGAACTATTTT CCATGATGCTGATTGGTCAGAATAATTTTCCATAATGGTGATTGGTCAGA ATTGTGTTCCATGGTAATGATTGGTTAGAATAGTGTTCCATGAAATTGAT TGGACAGAATTGTGTTTTATGATGGTGATTGGTGAGAATTGTGTTCCATG ATGCTGATTGGTCAGAATCGTGTTCCGTGATGGTCATTGGACAGAATTGT GTTCCATGATGCTGATTGGTCAGAAGTGTGTTCCTTGATGCTGATTGGTC AGAATTGTGTTCCATGATGCTTATTGGTCAGAATTATGTTCCGTGATGCT GATTGGTCAGAATTATGTTCCGTGATGCTGATTGGTCAGAATTATATTCC GTGATGCTGATTGGTCAGAATCATGTTCCATGATGCTGATTGGTAAGAAT TGAGTTCCAAGAAGGTGATTGGTCAGAAATAAGTTTTATGATATTCATTG GTCAGAATTGAGTTAGACGGTAGGTTTCAGAGGTCACGCCCTGTTGAGAC TTTGATTGACAGCTCGAGCAGACGGTAGGTTGGTTCAGACGTCACGCAGT ATTAAGACTTTGATTGACAGCTGGAACAGACGGTTTTGAGGCTGCTAACT GGAGCCATTATTGACCACATCATGGTTCAGAGGTCACGCCCTGTTAGTTG AGAGTTTGATTGACAGCTGGAGTAGACGGTTTTGAGGCTGCTAACTGGAG CCATTATTGACCACATCATGGTTCAGAGGTCACGCCCTGTTAGTTGAGAG TTTGATTGACAGCTCGAGCAGACGGTTCCGAGGCTGCTAACTGGAGCCAT TATTGACCACATCAGGCCTGACAGCGGACAGGAAGTTTTCCGTCTGGCCT CGATCTGCAGATTGGACGACTTAATCACACTTAAACCCTGCAATTTGCAG AGAAAATCAAACATTTTGTCAGCCATTTTCTCTGTGTTTCTGATCAATAC TTGAACCAGCTGCAGACAAATTCTCCTCGTTTGCACACGAGGAACTCTGC AGACCAGAGGTTGTGTGTGAGGGTTGTTTTAGTCTTTGTTTATTCACGAG AAGCTCAAATTGGCCCCTTTTCTTAGAGGTCATGAAGGAAAGATACAGGT TATATGTATTGAGTGAATTCTACCTCCTAACGAATCCATAAAGATATCTT TATACATCACAAATAAAACCTGCCTGTAGAAGGAAAGGCTGCGTGTGGTT TTGGTCCATTTGTTGTAACCTGTGATGTACGTGCTGTATGTATGTATAAA GATATCTTTATACGTACATGCATCACAAATAAAACCTGCCTATAGAATGA AAGGCTGCATGTGGTTTTGGTCCATTTGTTGTAACCTGTGATGTACGTGC TGTCTGGTAATCTACGTCATCACAAACTAAGACTCAGACGCAACCAGCCG GGGAGAAACAAGCCCAACATCCTGTCTTCTTCTCGTGTCAATCTGATAAT CTTTAAGAAGCTGATTTAGTTCCTTAAGGTGCAGCCATATGTGGCTTGCA TCTGAAGATCTTGAGGATGTTTAAGAAGCAGTCATCTGTAACGTAAGACA GACTCCTTCACAGCTGGCTGCTCCTTAAAGAGCCGCGCCAGTATCTCAGA GATCGGCAGATGCATCTTGCTGGAACAAGACGATATCTGTCTGCGTTTGC TGATCTTAAGATGCTTTAAGGTTACTTGAGGTGGAATCACCTGTGGGGAA TAAGATGTAGATCTCCTTCTCTCCCTCGCTGATCTAACAACCGTCTCTAC AAGACGACTTAAGATCTTTGTCTTGTCTTAACCTTGAACCTGCATCTGAG GTCATGGCCAGGACTATGAATAAATAAGGAGTTTTATTTCATCTCTGTAA CCGTGGGTGAGTGTAAAAGCAGTTCTGATGCTATCTCGCTGTGTTTTATT GCATTGTTCTGATGCCATCTTGTGCTTGCCTTGAAGTGACATATATTGTC ACAGTGGTAGACCGGTGTTACTGTGTGCTCCTGCAGTATTCTTCTCACAC AGAGGCACAAAAAGCATGGGATGTCACACTCAAAGTGTATCGCAGTCAAG TACAGATGCAGACATTTTGCTTTTAGAAACATACCCAGATGAAGGGAAGC CTGTAGCATTTAGACCTCGGCTGCAGTTAGTCTATTTATTCTGTAGCTGC AGCAAGTCCTAGGCAAGTTTCCCAGTGCTTGCTGTTGAAGTCCAGACATG AGGGGCCGGGGTTGTCCCCCCTGACTGCCTACGCCAGGCTGCAGTAAGCA GGTTTGCTGTTCCCGATAGTCTGTAGCTGTAAGTCTATGGAATGTTTAGC AGTGGTTACTGATCGAGTTTAAACATGAGGGAGTTGTCTCCCCTGCCTGA CTCTGTGTAAGGCAGCAGTTAAAGTCTATGGCAAGTTTGCTGTTCCTGAT AGTCTGTAAGTCTATGGAATGTTTTGCAGTAGTTACTGATCGAGTTTAAA CATGGCGGAGTTGTCTCCCCTGACTGATTCTACAGCAGCAGTTAGAGTCT GTTTGCTGTTCAGGTTTAAACATGGCGGAGTTGTCTCCCCTGACTGATTC TACAGCAGCAGTTAGAGTCTGTTTGCTGTTCAGGTTTAAACATGGCAGAG TTGTCTCCCCTGACTGCGTGTGTTTCACCTCCAGCCCTCCCCACTTAACT CCCTGCCCCCGGCCTGACCTCCAAGCTTGCGGTTGTGCCAGGGTGCCTCC GTAATCAGACTCTGTGGTTCCCTGGCCTCTCATACACACGCACCTCTCAT AGGTACACAAACACACGCACCTCTCATAGGTACATGGACTTATAATGACT CCATGTGGCTTTCCTGGCCTCTGATACACACACACACACACACATACATG TACATGTGACCCCCAAGCTTGTGGTTGTGTCAGGGTGCCTCCGTAATCAG CCTCTGTGGTTCCCTGGCCTCTCATAGTCACAAACACACGCACCTCTCAT AGGTACACAAACACACGCACACACACCTCTCATAGGTACATGGACTTATA ATGACTCCATGTGGCTTTCCTGGCCTCTGATGCGTACACACACACATGTA CATGTGACCCCGAAGCTTGCTGTTGTGCCAGGTTTTCCTGGCCTCTCATA GCTATAGGTAGCATTATGGTTAATAGTTGTTGCCATACATTTTACCGTGT ACAATTGCCATGCAATAAAGTTCTTCTTCTTCATCATAACATTGTTAGTA GTAATTATCCCTCTGTGTTTTTGGTAGCCTCACACACAGACATGTACATG TGACATTGAAGCTTGCTAGTAGTAATTACTCTACTACTCTGAGTGGTTTC CCTGACTATAGCTATATGACTGTATACAAGTACATTGTTTCTCAAAGTAA TGACTTCATGTGCATGGGATTCCTGGCCTCTTATACCTTTATTTATTTAT CTTAAAACATATGGGTAGTCTCTTCAGCCAAAAAAGGCTGATTTCCAAGA GAGCCCATAGGGGTACACATAATGAATAAATGTAATAACATAATATGATG ATTAAACATAGGAATACATAGACTAGTACAGAAACAAATCAATTTGTCAA ACAATAACACTGAAATCATTAAACAAAAATGAACATGTGCCGATCAATGT GTAGTTCCCTGATGCCCCCCAAGCATACATACATGTACTGTAATGACTCA GAGTGTGGGTTCCCAGCCATATATATATATATATATATATNCTCCGTAAT CAGACTCTGTGGTTCCCTGGCCTCTCATACACACGCACCTCTCATAGGTA CACAAACACACGCACCTCTCATAGGTACATGGACTTATAATGACTCCATG TGGCTTTCCTGGCCTCTGATACACACACACACACACACATACATGTACAT GTGACCCCCAAGCTTGTGGTTGTGTCAGGGTGCCTCCGTAATCAGCCTCT GTGGTTCCCTGGCCTCTCATAGTCACAAACACACGCACCTCTCATAGGTA CACAAACACACGCACACACACCTCTCATAGGTACATGGACTTATAATGAC TCCATGTGGCTTTCCTGGCCTCTGATGCGTACACACACACATGTACATGT GACCCCGAAGCTTGCTGTTGTGCCAGGTTTTCCTGGCCTCTCATAGCTAT AGGTAGCATTATGGTTAATAGTTGTTGCCATACATTTTACCGTGTACAAT TGCCATGCAATAAAGTTCTTCTTCTTCATCATAACATTGTTAGTAGTAAT TATCCCTCTGTGTTTTTGGTAGCCTCACACACAGACATGTACATGTGACA TTGAAGCTTGCTAGTAGTAATTACTCTACTACTCTGAGTGGTTTCCCTGA CTATAGCTATATGACTGTATACAAGTACATTGTTTCTCAAAGTAATGACT TCATGTGCATGGGATTCCTGGCCTCTTATACCTTTATTTATTTATCTTAA AACATATGGGTAGTCTCTTCAGCCAAAAAAGGCTGATTTCCAAGAGAGCC CATAGGGGTACACATAATGAATAAATGTAATAACATAATATGATGATTAA ACATAGGAATACATAGACTAGTACAGAAACAAATCAATTTGTCAAACAAT AACACTGAAATCATTAAACAAAAATGAACATGTGCCGATCAATGTGTAGT TCCCTGATGCCCCCCAAGCATACATACATGTACTGTAATGACTCAGAGTG TGGGTTCCCAGCCATATATATATATATATATATATGGCTGTACCATGTAG CTGCTGACTCAGAGCTGATATAAGTAGTAATGACTCTGTGGGTTTCCTGG CCGTAACCATGGAGAACTGATGACTGTTGGAGTCTCCTGACTCCTGATTT GTGCAGCTAATGACTCCACGTTAGAGTCTCCTGGAAAGGAGGTCCTCCCA GACTTGTTTAGACTTTGACACTTTGCTCCTCCATTTTATCCACCTCATAC TTCACGTTTCTCTTCATCTCAACGCTTAGCAGGTCCTGATGCAGTTGCTT GGTAACTGTTTTTTGGTGAATCTTATTACCTGGATGGCTAACCTTCATCA ACGTTAAGGTACATAACACAGCAGTTTTAAGGACTCGCAGTCAAGGTACC TGCTGACTCAGAGCTTTAATACTGCTAGGTAAGTGATAATGACTCTGTGA GGGTTTCCTGGCCATTACCAGGTAGAAGTGATGACTGTTAAAATCTCCTG ACTCCTGATTTGTGCAGCTAATGACTCCACCTTAGAGTCTCCTCATATGA AGGAGGTCCTCCCAGACTTGTTTAGCCTTCGACACTTTGCTCCTCTTGTT CCTAGCTGTAGTCGCAGAGGTAACCCTGTTAATCATGTCATGTTTCTACA ACCAAAACTAACAGTGGGCCACACACACACCAATAAGAAGATTTTGATAC AGTCTGCACATTTTTACTGTTACAGACTCTGAGATAACAACTGCTTTTAA ATCATCTATAATTCTGTCCATCAGAATTCAGCACTGAACACATCAGAATA AAAAGTACAATAAAAACCCAATGTGAAGTCCTGGGAATATGGAATGGTTT TACCCCTACTTGGAATGTAAACTGCGCACACTGTTGCTATGTTACTAGAC AATAGGCCACACACACAGCAATAAAGAACTTGCAGAGATGTTTACTGCTG CAAACTTAAAGATAACAACTGCTCGATCATAATCCCTGCCCATCAGACAA CCAGCAAACTCTGTGCATTCAAACAACATGACGTGTGTTGGGCTGATGCT ATAGACAGTAGTCCAAGCGCACTCTATTAATAAAGAAAAGAATTACGATA CAGTTTCCATAGTGATTTTTACTGTTGCAAACTAAGATAATAACAGTAAT AATTTATCACAATTCCTGTCCATCAGACAACCACAGCAAACTCTGTTTGT GCTCTGTGCATTTAAACAACATGAAGTGTTGGACTACAGTAACTGCTAGA CAGTAGGCCACACAAACACCAATAAAAAAAGAATTATGATCATAATTCCT GCCCATCAGAATGATGACTATGTAGCAAACTCTATCACGTCTGCTCTGTG CATTTAATAAACAGCATGAAGTTTTTTTGCCTGCTGCTATAGACAGTAGG CCACACAGTCACCAATAAAAAAGAATTATGATACGGTTTGTATGGAGATT TTTACTGTTCAAAGATAACAACCCAACTTCATCTGCCCATCAGACGGCAA CGCTGAACATCAGCATGAAAAATACATAAAACATAAAGTGAGGTCCTGGG AATATGGAATGTTGTTGCCCCTGCTCTAAACGTGAACTGTACACACTGTT GCCATGTTACTAGAAATTGTGATGTGATGCAGTCTGCGTAGAGATCTTCA CTGTTGCAAATATAACAACTTTATCATAATTTATGACCAAAGCGAACTCT GTTGACTTTATAATATAGACTGTTCTGTGCATGTAAACATGTAAACAGCA TGAAGTTTTTTTGCCTGCTGTTATAGACAGTAGGCCACACAGTCACCAAT AAAAAAGAATTATAATGATACAGTTTGCAAAGAGATTTTTACTGTTCAAA GATAACAACCCAAGTTTATCTGCCCATCAGACGGCAACGCTGAACATCAG CATGAAAGATACATAAAAACTCGAGAGGGAAGTCCTGGGAATATGGAATG TCTTTACCGCCGCAGCTCAGAATATTTTTACTGGGACAGATTTACGTTCA TGGGTCGTGTTGACCAGCTGAAGGGTCAGTCTGAGACTTCAGGATTTCTT AAGATTCTGCCATTTATACCTGAAGTCTGCTTAAGACTGTGATCTTAACT CCTGAAGGAAAGAAGTCTGCACTGTAAGGGATTGAAGGAAGATGTGATTT GGACGTAACATGTTTGATTTGGAGAGAATTGCGGGACCTCATTCTTGTTT TTAGTGCCATATCTGGCTGTGACTATGAAGTTCAATGTTATGACGATGAC AGAGCCATTACGATATCGATAACCTTTATTGACACAAGAAAAAATACAGC AACTTTCGTAGCATCACCTAAACTACAAAATAGGACTACAAAATAAATCT TAAAATCCTAATAAATCTTAAGCAATAAAGGCAAATCCGTCATATCATGT TACAAAGCGGAGGGGCTTAAATCATGGGGTTCTTTATTCTTCTAATAACA ACGCAATCTTTTATGTACATATATGATTTATGATATAACCAGAATCAGGC CCATTTTAGGTGACGTAAAGTTTAGTGTATGAAGTCCTCATTGTAAAGGA CTGAAGGAAAATCATCTTCACATCTTGTGGTGCTGTTGCCAGTTCTGCAG CCAGTTCAGGGTGTCTTGGCTAGCTTCAAGCAGGTCTCGACTCGTGATGT GATGAAGCAAATTGTGAACTGGGAACATCTCAGATTTGGAAAGAATTCCT GAACTTCTTGTTTTTTGGGCCATGGACTTCTTTATAAATCCAAAATGTTA TGATGAGGGTATTACAATATAATGATATTTAATATAACCAGAAGCACACT CGTTCAGATGACGTAAAGTTTATTACAAGAAGCCCACACTGTAAAGGACT GAAGGAAAATCATCTTCACATCTTGTGGTGCTGTTGCCAGACCTGCAGCC AGTTCAGGTGTCTTGGCTAGCTTCAAACAGGTCTCGACTGGTGATGTGAT GAAGCAAGATGTGAGGTGGCAATGTCTTAGATTTGGAAAGAATTCCTGAA CTTCTTGTTTTTAGAGCCATGGACTAAATATTTTTTTATAAATCCATAAT GTTATGATGAGGGTATTACAATATAATGATATTTAATATAACCAGAAGCA CACTCGTTCAGATGACGTAAGGTTTATTGCAAGAAGCCCACATTGTAAAG GACTGAAGGAAGATATCTTCATATCTTGTGGTGCTGTTGCCAGTTCTGCA GCCAGTTCAGAGCTTCTCAGTTAGCTTCAAACAGGTCTCGACTCGTGATG TGATGAAGCAAGATGTGAGGTGGCAATGTCTTAGATTTGGAAAGAATTCC TGAACTTCTTGTTTTAAGAGCCATAGACTTGTTTGATATGAATCCATGAT TTTATGATGAGGGTATTACAATGTAATATAACCAGGAGCACACTCAGTCA GACATCGTTGACGTGAAAGTTCCCCGTAATCCAGTCACAAGGTAAAGAAT AGGATTTCACACACACGTCATGTTGAGTTTGAGGAAGGGTTTTCTGCACA TCAGTAAGAGGGCCTGCATGCCCCTTTTACGTAGAGCGTAATCGGTCGTT TTAATTTTACGTATAGAGCGTTGACGACCACTCCATAATTTAGCGTAGAG CGAAGGGGGGCTTTCTGAATGTAGCGTAGAGCGTAGGGAGGCTTTCTAAA TTTAGCGTATTACGTAGCCGGCCCTCCGAATTTAACGTAGAGCGTTGTCG GGACCCCCCCCCCCCCCATTCGGGCCCTCTTTAAAGTTAACGGTACTTTA AGAGCTCGTTCCCAAATTACGCATGTTCTTGTGCTCTGATTGATCCAGTT ACACCAGAGCTGCCCTGGGGACGAGAGCAGGAAAGTNGAACTATTTCTAG GTGCACGTATGTACGTATGCACGTATGCACGTATGCACTCACAGTAAACC ACAACTCTGATTTTGGGTGCAAAAGTACAAACTTTAAGTTACGTGATACC TATAGCGTTTCCAGCCTTTATGCATAGTGATGGCTGTTCAGTGTTTAACA TTCCAAGCGAGTGCGTCTCGTGCCTGTAACATAACCGGCAGAAAATTTCC GCCATCCTTTTTTCTCCATGCTTCAGCGACTTGAAATTCGAGCTGAGAGA TCAAACAACTCGGGGATACGTGTTGCCATGGCAACAGTGCGCACAGTTCG CGTCTGGAGTGAGGATGAAATTGTTGCTCAGATTCGCTCAAGCTTGGCGG GCGGTTCTCGCGCTGCCCCATTTTCACCAGTCGAGTTGTTTCGGGTTCCT TGTGATGTTGCTATTTCTGGATTTGTGTTGTGGCAATTTCCTGCAGATTG TAGCCATGTAAACTCTACCGTGCGGCCGCTACAAGTTATTACCTTGGTTC TCAGACATTCCATTGTGACAGATGGTGTAATAAGTTAAACATATTTTCTG ACTGATGAAACTGGGTTCTTGTAGGTTGTGACGCATGTTGCGAACCAACT TTAATGCCTCTATTTGTTATTTTTGACGCATTGTTGCTTTATAGCTTTAT TTAGGTTCATGACAATGTGAAAGAGAGAGCAAAACAGATGTCTAAGCACC TTTACAAGTTACCTTCCCATTGTTGATTGTGATGCATTCTACAAACCAAC GTTAACTCTTCTATTTGTTCATTCTGACACATGTAACAAATCCAACGCTC GTTGACTGTGACGCATGTTACAAATCAACATAAACGCTTCTTTGTGACGC ATGTTACAAACCGGCCTTGTTGATTGTGAAACATGATACAAACCATTGTT AACGCTGCTATTTGTTTATTCTGACGCATGTTGGTTGCTGATTGTGACAC ATGGTAGCCCCGATGCATGTCTCACTACTGAAGCCTGTTAAGTAGATGAT GACACACGGCTCAAACCTTCCCGTTTCTCACCACCATCTCTGCCTTTCTG CAGCCTCTCTCTAACTTACCTCAATTTGTTCGTTGTGACACAAGTAACAA ACAACGCTTGTTGATTGTGACACATGTTACAAACCAACGTTAATGCTTTA ATTTGTTCTTTGTGATGTATGTGTGGCATGTTGCTTGTGACACATGAACC TTGCTACTGTGTGTTCCTTGTGACGCATGTGGCTTGTTGATTGTAGCGAT GTTTTGCCCCAACGTTTGTGACGCATGTGGCTAATGTTGATAGTGACACA TGCTACAAAGCAGCGCTTGATGATTGTGGCACATGAAAACTTGCTACTGC GTGTTCCTCGTGACGTATGTTGCTTGTTGATTGTGACACAGGAGTCTGAA GTTGCTACTGTGTGTCCCTTGTGATGCATGTTGATTGTGGCGATGTTATG CCCCAAAGTCTTTATAGCTGCCAACAGCGTCCTCCTGTTGATGATGACAC ATGCCCCAAACCAGTACTGATAATGAAAATGGTTCAGCTCTGCAAATTTT GGTACAACTGCCTGCTTTTAAGAACTTCAAGGCTTTTGATAGAATTTCTG CAATGTTATGCCCCGGTGTATTTATTTATTTATTTGTTCAGCTGCGTACA ATGTACAGCAGCCAAGGCTGCCCGACTAGCAAGGGGCCAGCCTTGCTGCA AAGGTACATGATAAAATACAGTACATTAGTTAAAAAGACAAGTTACATTA GTTAAGAATAAATCATACACACGTACAATCATACAACTCTTACCGGTGTA GTTGCCGCCTGTTGATGATGACACACGCCCCAAACCAGCCCGTCTCTCTC CCCATCCCTGTTCCCTGCTCCCCGCTGCCTTCATCACGAATTCTGCACAG ATTTCAGGCAGAAATGAGCGTTTTTTCCTCCCCAAGCTCAACTTCCCCAC TGCTGCTGTCTTAATCACTATTCAACTCAGCCAGAGGCTTTAAACACTTT GTACTGATAATGAAAACAGTTCAGCTCTGCAAATTTTGGGACAAACGCCT GCTATTTATTATAAGTAGACCTTTGATAGATTTCAGGCAGAAATGAACCT CCCCAAGCCCAGCGTCCTTCTTCTTCTGCTTTAATCATGTAGCCAGCACA GCCACAGGCTTTACGGAAGGCTTTAAACACTTGTAATAATGAAAATGGTT TATCTCTGCAAATTTAGGGACAAATGCCTACTACTGTTTTTAAGAACTTC GAAGCTGTTGATAGAATTTTGGCAGAAATTAACCTCCAAAGCTTCCTTCT GCTACTGCCTTGATCATGAATTCAGCTCAGTCACTAGCATCAAAGCAGGC TTTAAAACAATTCTGATTATAAAAATGGTTTAGCTCTGCAAATTTAGGGA CAAATAGCTGTGAACAGTTATATATTAAGTAGGCTTTTGATAGATTTCAG GCAGAAATGAACAGTTTTTCCCCACATCCCTGGTTCCCCGCTACCTCAGC CACGATCCTGTATTCAGCCTGGCCTGTAGGATAAATGCAGGCTTGAAATA CTATACTGATTATAAAAATGGTTTAGCTCTGCAAATTTAGGGACAAATAG CTGTTTTTAAGTGGCTTTTGATAGAATGTTGTCAGAAATGCACAGTTTTT CTCCCTGAGCCCAGTTTCCCCGTTCATTCAGCCACGATCCTGTATTCAGC GCAGCCGGCGGCATTAAAGCAGGCTTTAAACACTGCTGATTAGTAATTGC CTTCATTCGTTTATCCACGTCGGGAATTTACATACGCCGACTCGAAAACC GATAAATCAGCCGCAGCGTTCACGTCCATGTAAAACGGAATCATGGACGC TGGAAATGGTTTAGCTCCAGGTATTTATGGACACAATGACTCTTCTTTCA TTTCAGGTTCGACTATGAACCTATGGAAGAAATGAACAGGATTTAGAAAG GCTGTTTAAGGAACGGAATTTGCAGGTTTCTGACTGAGTTTTGGAGGAGA CCAGAGTTTGGTTTTGACGGCTGGGAATGGTTTAGCTCCAGGTATTCATG GGCACAATGCCTCTCCTTTCATTTGAGGTTCGATTATGAACCTATGGAAG AAATTAACAGGATTTAGAAGTTTTTTTTTAAGGAACATAATAAGGAATGG AAGCTGCAGGCTTTTGGCTAGGTTCTGGAGGAGACCAGAGTTCGGTTTTG ATCGGTGGCAACAAAAGCTTTATCGACTTCTCTCTTCTTTGAATACACTG ACTCAAAAAGCAATAAATCAGTTGCCCCGTTTTATATTCATGAAAACCGG CATTACATATACTGGGAAAATGGTTAAGCTCTACAATTTAAGGGACAAAA TGACTTTTTTTTATGTAGGCTTTTGATAAAGTTCTGGCAAAAATGAACAG GGTTTTGGGAAGGTTGTTTAAGGGACATATCAAGTGTATAAGGGACTTTG CAATTGTACTTGGGAAAGTCAAGTTCAGCCAGACAAGTGCACATGGACCT GATAATGTCAAGTTCAAAGGGATATTATCTACTTTGTAATTTAAAGTATG CAGAAATTCTGTCTATGCTTTTTGTTCTGTTTTATTTGTTTGAATAATTG AAGCCTAGTGCACACTTATTCAGGCCATTGTCCCTTGAGCACACTTATAC TCTCGTCTTTGGGTCATTTCCAGTTCAGAGAGACAGTCTTAGTTGTTACT ATGGGTCATGTCCAGTTCAGAGAGACAGTGTTAACTGTCTGTATGGGTCA TCTCCAGTTCAGAGAGACTATCTTAGCCGTTGCTATGGGTCATGTCCAGT TCATAGAGACAGTGTTAGTTGTAATGCTATGCATGGGTCATGTCCAGTTC AGAGAGACAGTCTTAGTTGTTGCTATGGGTCATGTCCAGTTCAGAGAGAC AGTCTTAGTTGTTGCTATGGGTCATGTCATAGAGACAGTCTTAGCCGTTG CTATGGGTCATGTCCAGTTCAGAGAGACAGTTTTAGCCATTGCTATGGGT CATGTCCAGTTCGGAGAGACAGTCTTAGCTGTTGCTATGGGTCATGTCCA GTTCAGAGAGACAGTTTTAGTGTTGCTATGGGTCATGTCCAGTTCAGATG GACAGTTTTAGCCGTTGCTATGGGTCATGTCCAGTTCAGAGAGACAGTTT TAGCTGTTGGTATGGGTCATGTCCAGTTCAGAGAGACAGTATTAACTGTT GCTATGGGTCATGTCCAGTTCAGAGAGACAGTATTAACTGTTGCTATGGG TCATGTCCAGTTCAGAGAGACAGTATCCCCAGTAATGTCGACTGGAGGGA TCTAATCTGTCGATCTGCCCTTCTGTGTTATTGTACTGCATTGATCCGGC TGAAACACAGCCAAGAACAGGGCACAGGCCATTTCTCAGCCTGTCTTTGG TGGAACAGATACGTGTAGGGTTCTCAGGACCGTGGGTGGGTGGAACTGAT ACGTGTAGGGTTCTCAGGACCGTGGGTGGGTGGGTGGAACAGATACGTGT AGGATTCTCAGGACCGTGGGTGGGTGTGAATGATACAGAATAATGATGTA CATGTAGGTTTGGCTGTTGCACACTGAGGTGGACCCCCAAGTCTTCCCAT TCTGTTCTTGTTAACTGTGATGGGTTCTGTAACATGTGTGAAGACATTAC GCTCTTATTATATCTATATAGTGCTGCACATTTAAGGGGTGGTGGTGCTG CATTGCAGAGCAGTGCTAGGCTGGATTTGAAACCCTTAGCCCTGTGGTTC TGGTAGCTTGAAGTAGTGGATTCTGGTGTTGCATTACAGAGATTCGAACC CCTAGCCTAGCAGCCTTTGCATTTAAGCGGGTTGTGGCACTGCATTGTAG AGCAGCCTACCCTCCACCCCACAGGACCAACTTGCCAGTTGTTCCCGGCG TTACGACATGACAAATTTGAGGGATTCGAACCCCAAACCGTGATCCTAGC AGCCCTTACATGTACCACAGTAGCGAGTTGTGGTGCTGCATTGTAGAGCA GCCTACCCTAGCCCTGTGGGACCAACTTGCCAGTTGTTCCCGGCGTTACG ACATGACAAATTCGCTGCTGAGGCCCCGTCCCAGTACACCAGCCCGCCTC TTATAATTTCATTGCAGCGATCGATTATTCCAGGTCCAAATTCAATTTAT CTTAATTAAAAATTTAGGGCTGGAATATGCTGTGCTCCCCTTGCAGTTTT CAATGCAATCAATTTAGGCTGGCGCGGAGTCAAGCCGGGATGACAACATA GACTACACAGAGTGCCTCCCTCACACCAGATCATTAAAAACAAGGCCAAT ATTAGTTGTTGCCTCTTGGGTATAGAAAAATTCTAAATTGTAATATTAGC TGTTGAAAACAGAGCCTGAAAGCTGTACCATTGATACACAGCATCATGGA ATGATAAGGCCACACCAATTTTATTTGTTGATTCTCGGATAGAAAAAAAT TCTAAATTGTACTATGAACATGAAAATAGAATATGAGAGCTGTGCCAGTG ACACACAGTTTCAGGAGTGAATGTACATCTAGTAAGATTCAATTTTTTCT CCCAGCCTTCTGCTTTCACTTGAATTTTTATTCCAAAATGTCAGAGAATA AAGGAAATAAATTGGTGAGGTCGGCTTTCTTCAAACCGGATCATCTAAAA CCACAGCAATTTGATTTGCTGGTTCTCAGATTTAAAAAAGAAGAAAATTC TTATCTAGAAAACATGTAGTGCAAACAAAGCCTGAGGACCAGTTCCATGC CTTGGTGCACTCAGTTTTATGGAGTAAATACAGTCAGGCTCAAGCTTTGC TCCCTAACCTCTGCTTTTCTGATGTCTGCTTGATATATTTTCACCTTAAA ATGTCCGTGAACCGAATAAATAAATTGGTGTGGCCTAAAATATTTCTAGT GAAGGGAGTAGTTCACAGCATTTAATTCTAGCGGTGGGAACAAGGTGATC AAATAATTGTGATGATTAAATTTTAGCGGTGGGATCAAGAGTCAAGCTTG CCTCAGCAAAGTGATCAAATAATTGCAATGATGAAATTTTAGCGTTTAAA CATTAGAATGTCTGTGAAGCAAGGAAACTGATTGGTGTGGCCTGTATCAT TAGGAACCACAGCAGTTTGATTTCCCGATTGTCACATTTTACAAAGAAAA AACGCCTATCTTCCCTCTGCTTTAATTTGTGATGTCTGCTTGGTACATTT TCACATTAAAATGTCTGTGGCCTACGGGATGCACCCTCCCTCACAACATG TATCAATCTAGAAAAACATGGTGAAAACAAAGCCTGAGGACCGGCTTCAA GCCTGGGTAGACTCAGTTTTCTGGAGTAAATACGATCATAATTTTCCTCC CTGCCCCCTGCTTTTGTGATGTCCGCTTGCTAAATTTTCACATGAAAATG TCTGTTAACCAAGGAGCTAATTTGGTGTGGCCACAGAGTGCTGGTTCCCT CCAACCTTATCAAACCAAACCAGATCATTAGGAACCACAGCAGTGTGATT TCCCGGTTGTCATTTTTTGAAAAGAAAAAACGCCTATCTTCCCTGTGCTT TTGTGATGTTTGCCTGCTATATCTTCACATTAAAATGCCCGTGAACCCAG GAAATAATTTGGTGTGGCCCGGATCATTGAGAACCACAGCAGGCAGATCA GTTGTACAGACTATTGGTTCCTCCCGGGGTATCGTCCGGGGACGGATAGT CAGACAATCAGGCCGTTCATCAACCCGAAACAAAAGAACCACAAATTCTC TGCTTGTGTTCGTAGGAGTTGGACATTGTCAATCAGAGCCTGACATGAAG CTTTATTTTCATGACTTAGAATACTGTTTTTTACGGTCAACTAAAAACTA TAGAAACTAATAGAAAATAACATTCTACTTTCTAAACAATAAAGGCTATA TTTAGATATGTAAATCTGTGATATCTGGTTACACTCAGTCGGAGGTTATT TTTGTTTTTTCAGCATCTAATCTCATAACAAAGCAATATTTTTGTATCTA CCCATTTTTGCATTGTGAGAGCTGTCAAATCTACTGTAATATAACCATAT CTGTTTATGAAATAGAGTTCCTTGAAATCTGTAGTACCTAAAGAAAGAAA TGTGTGTAACCGACAGTGGCTGGAATAAGGCGGCATCTTTTTATTCTTTA TTAGCTGTGATATGATTGAAATTCAGATTACAAAACACCGGGACGCCGAA TCGCAGAATATCGTCTGGGGGAGGAGAGTGAAAGTGAAAGTGATGCCGGC AGCTTTCTCCTGTTCCGTGAAAGCACGAACCGGGGAGCGCTTTATTTGAT GTGGTGGAAAATCAGTCCTGAATTGCACCGAGTTCTGCCAACGTCGCTCC AGTTGCTGGGATGAACTGGAGAGGGTTCAGCACCAGTGTGGGTGCTCGGC AGGGTTAGCCTCCTGTGTGAATGCATAGTTGAACTGATGAGGGTTCAGTG TGGATAAACAGGAAGGTTTACTTCTTGCATGGATGCTGCACAGGGTTCAT CACCAGTGTGGATAAACAGCAGAACCAGTGAGGGTTTGTCTCCAGTGTGG ATGCACAGCTGAACTGCTGAAGGTTCATCACTAGACAAAATTTTCATCCA GGGTTAGTCTCCTGTGTGGATGCGGGGAAGAGTCAGTTTCCAGTGTGGAT AACCAGGAAGGTTTGTCTCCTGTGTGGATAAACAGGAAGACTTGTCTCCA GTGTGGATGCACACCTGAACTGCTGAGGGTTCATCACCAGTGTGGATACC TGACAGGGTTGCTCCTCGGTGTGGGTTTACAGCTGATGACCCAGAGACAT CTGTTCTGGTGGCCTGAGTGTGGATGTGCGGCTGACCCAGTCAGGGTTTC TCCCCAGTGTGGCTGATGTCACAGGGACATCTGTTTTTGTCTCACCGTGG CCTGAGATGGACCGATACCCTCCCGACTCCCCCCGCAGGCACCTCGGCTT TAATTGAAAGTGTTGGGAGGACGGCGGTACCCAGATGTGTGCCAGTTATC GGCAGGGGAGGAGAGACGGATGCGGGTTGGAGGGACTGACACAAGGAAGC TCAGGAGCGGAAGGTTTGTCTCCAGTGTGTGTTATCAGCTGAACCTGCGA GGGCTGCTCCCCAGTGTGGCTTTAAGGCTGATGATATTGGCTGGGGAGAA GGAAACGGATGCGGGTTTGAACGACTGGCACAAGGAAGCTCGGGAGCAGA ATATCCCAGGGTTGCTCCCCAGTGTGGCTGCACGGCTGAACCAGTAAGGT TTGTCCCCCGGTGGCTTTACGGCAGGTGTCACAGAGAGACGGATGCGGGT TAGAGCGACTGGCACGAGGAGGCTCGGGAGCAGCGGAATATTCGGCAGAT GGGGAGAGAGGAGCGCGGTACCCGACGATTGGCCCATTAGGCACATCACC GGCAAAATACTAATTTCATGATCCATGCAAATAATGGGGGCTCATCGGAG GTAATTGTCTGGCCGTGCATCACCGCTGGGCCGGGGAGTCCATCANATCA CTGCTTGGCCGGGGAGTCCATCAGAGCGCGCAGCTATTGCATTTGGTGTG CATAATTTATTGGGAGGGGAGAGAGGGATCCGCGCTGCACGCTTTATAAT GCACTCCCGGTGACACGCCAAGCCACGGACGGAGAAGGGGCCACGTTTCG GCACCGCGGGTCCACTCGGAGCGTCGTGTGTGCGGCTGACGAACGACGGG AAACTCTGGCTGTACGTGTCCCTGCATGGACTGTCTGTTAGCAGCTGTCT GTGGGATCGTGGGCTGGACTTTGGCAGCTGAGAAACACTCTCTGTGCTGG GGAAACATTGGCTGTGTGTGTCAGTGCATCGGCTCTACATGGGATAGCTG AGAAACATTGTGGAAACCTTGCCTGGCTGGACATGTCCCTGCATGGGCTG TATGTAAGACGCTGAGAAATACCGGCTGTGCAGTGCTGACGTTGGCTGTA AGTGGGCAGTTGAGAAACACTGTGCTGTACGTGTGCCTGTACATGACTGC TGGATTGGCAGTGAGGAAGGCTGTCTTGTGAGGGAACGTTGGCTGGAAGT GGGACTGTGCAGAGTGGAAGTGCGGGTAACCCTGTGAGCACTTGTGCATA GTTTACGCCGGGACGCTGCATTGTGATTCACCTGGCAAGGAAATTAGCAT TCTCCCCAGACAATTGGAGAGAATCGGAATCGTCATAGCGCGGGCATGTG CAGGGATTGCCACATGGGGTAGCCGCGCTGCAGTCGCCACACGGGGGAGA CGGATCGCCACACTGTGTGTGCCACAGTTGGAAATATTGCCACTTGTCAA ACCGGGGGAGTATCGACGTCAGCTGGGGGATCGAAGGCTCGCCGAGACAA TCAAGGATTATTCTGATTACCGACGGAACAGGGAGGCGGCGCGGGGTTGC CACGGCGCACGTTACCACGGTTACTGCGGGTCCGGAACACCGGTGTTTGC GAGGTAAACAACGGGAGAATATTCCTGCAGGAATTCCGTCTGGAAGTGTT GTTGTTGGCTGTGCGTGCGCTGCTCTGGAATTAATGGGTTGCCCCACGGA ATACTGAGCTGGGTTTTGATTAAACAAATGGGCCGGGAGCTGCCGGGAAT GGAGTAGCTGCCTGATCATTCCCCACCCACGGAGCAGGGCGACATTAAAC TTTCATACTTGTCATGCAGGAGCAACCCAGGTGACACGCAGAATTGTTTC CCTGTGGGGTTTAGACAGGGCGACATTGCAACTGTTATAGACAGGGCGAC AACTGGTATAGTCAGGGCAACAACTATTATAGTCAGGGCGACAACTCCTG TAGCCAGGGTGACGATTGCTGTGCACTAGGTTGCACAAGCAGGCCATGAA TTAGTCATCCTAATTGCCAGAAAATTATGTAAACAACATAATGAGCTCAA CGATAGCAAAGCCCTTTTTGCTGCCCCCATTGTAACGTCCCTCCCCGTAA CGTCTGTACAGTTTTCTACTCTGCATTTTTCTCAAGGAAAGCCAGTTTTC TTAAGGAAGGCCACCAGTTTTCTGAAAGGAAAAGCCAGTTTTTGTTCAAG GAAAGCTAGGATTTGTAAGAAAAAGTGCAAGGAAAAGTGATTTTTGAGTC AGGAAAAGTGATTTTTGTGGCAGGAAGAGAGATTTTTGTGGCAGGAAAGC CATTTTTTCAGTGATCAGGTTGGTAAGAAGCCAGGAAGCCAGGATGGAGG GAGAGTCGCGCGACCAGGAAGTGCCTAAGCCTGCTGATATTAATGTGTTT GCTGCAAGTGCTTCTATGCATGGGCTAGCCCATATCTTCACAGAAGGGAG GTTCACCATTCGGAGAATACTCTGGGCGGGTGTGTTCTGCGGGTGCGTGG CCGTGCTATTGGTTCAGAGCGTGGACCGCGTGCAGTACTACCTCTCGAAC CCCCACGCCACCAAGCTCGACGAACTCACGGCCGTGAACGGACTCAACTT TCCCGCGGTGACCATATGCAACATGAACAGTTTTCGGTTCGGCCAGGTAA ACCAGCAAGACCTGTTCTACGCGGGCCCAGACATCTTGGACCTGATTGAC CACACGTTACCCAGGCCGAAGCTCAAGATCTCCGAGGAGTTCCTTAACCA CATGAACGAGAACCCCAAGGACCACCCCGAGATGCGGCAGAAAATGGAGC GGATTCGCGAGCTGACGAACTTCGACGGATTCGCGCCGGGAAAGTTCAGT ATGTTCGACTTTTACGACAGGACAGGGCACCAAATCGAGGATATGCTCCT GGATTGCAAGTACAAGGGGGAGCCCTGCAGCGCAAAGAACTTCTCAACTG TAAGCACTTTCACTTTCGCTTTCTTAATAAGTACCTGTAGTGTCTTTAAG TTAGAGTTTGAACTTGTAGTGTTTTAAGTACAAGGGGGAACCCTGCAGCG CAAAGAACTTCTCAACTGTAAGCACTTTCACTTTCGCTTTCTTAATAAGT ACCTGTAGTGTCTTTAAGTTAGAGTTTGAACTTAAGTAGTGTTTTAAGTA CAAGGGGGAACCCTGCAGCGCAAAGAACTTCTCAACTGGAAGCAATTTCA CTTTCTATATGCTCTTAAACTTTCACTTCCTTATTTAAAGTAGCGTCTTA GTGTCTGAACTTAAGTAGTGTTTTATTAAGTGCAAGGGGGACACAGCAGT CAAAAGTACTTTTCAGCTGTCATTTTCCCATCCTCAAGACGTCTTAGATA CACTTTCACTTTCACTTCCTTAAGTCGTGTCTTAGTGTCTGAACTGAAGT AGAGTCTTAACTACAAGGGGAAACCCTACAGTGCTAAGAACTTCTCCACC TTCTCAACCAAGTCTTATCCCTCAATTGACTGCAGTTCCTTAAGTAGTGT CTTAAGTCCTAGTAACAGGTACAAGATGCCCCTCTGCGGTGCCAAAACCT TCTTAACGGTAACTCTTATCCTTCATCTCAACGCAGTTCCTTTAGAAGTG TCTTTAGCTGTAAGTCACTTTCTGTATCTTAAGTACAATTGCTAACTTAG AGAACTTTCCAACTGTAAGTCTTGTCTTTCATCTGCAATCAGCTCTTTAA GAAGCGTCTCAAGTCTTAAGATTTATCACGTCTTCCCCGGACACGACCTT CTTCATCAATGTCTTCAGTCTGAATGTCACGTCCTCTCCAGACACAAGTA CCTTAAGTAATGTCTTAAGTCTAAAGGTCATGTCTTACCGACAAAGCGAA AACAGAGTGGTGCATCTTCAAGTAAAGGAGCCAACCATACTGAGTTATGG GTGCTTTACAGACGAGCACTGATCCACACTGGAGATAAACCCAGTCACTA ACCAAATGGGACTTTAACAGTCCTGTAGTCATCCACACTGGTGAGAGACC TGTCTGTAGTTATCCACACTTGTGAGAGACCTACCTGTACATTGTAGCTA TCTACACTGGTGAGAGACCCGTCTGTACATGTAGCTATCTACACTGGTGA GAGACCCTTCTGTAGTTATCCACACTGGTGAGAGACCCAACACATCAGCA TACTTGAAGGTTCAATTTTTGAGCAACTGCAAGGCTATAATTCTATAAGA TTCTAAGATATCATAAGAAAAGAACAGGTATATTATAACTAAGGACATTG TAAGGATAAAACTAGAGATAACAATTGTGCATATGTTATACTTTATGTTG AGTTCTTAAGTACCAACTACTGAAAGAAAAACAAGGCTTAAATCCAATCT ACTTATCTATGTTATCATAAATCCACCATAAGCTGCGAGGTCCATCCATA CTGCAGCCTGATGACCGCGGCATGCATAATTCTGTGGGATCTGGGACTGC AGGACTGATCATGAGATGGGAGAGTTAGACTAGATAATTCCAGCTGAGAT CCACAGTGGAGATGAACCCTCCCCAACTTTTGCGATGTAACTAGTAAGGA GATTGTGAGGCTGAAACTAGTAGAGATAACATCTCTACATAATGTTTCAC TTTTTAAGTGTTGTTCGTCAATAGTTCCGACAGAAAGAAAAACAATAATT CTGTGCAATCTGTGACTACAGGACTGAGATGAGAGAGTTAGACTAGATAA CTCAGACTCAGATCCACACTGGAGATCAACCCTCCTGTCAGAACCCTGCC AACTTCTGTGATGTCACACCAGGTCATGTCCATGCAAACAGAGGTCTCAC TTCTGTGGGATCTGTGACTACAGGACTGAGATGAGAGAGTTAGACTAGAT AACTCCGACTCAGATTCGCACTGGAGATCAACCCTCCTGTCAGAACCCTG CCAACTTCTGTGATGACACACCAGGTCATGTCCATGCAAACAGAGGTCTC ACTTCTGTGGGATCTGTGACTACAGGACTGAGATGAGAGAGTTAGACTAG ATAACTCCGACTCAGATTCGCACTGGAGATGAACCCTCCTGTCAGAACCC TGCCAACTTCTGTGATGTCACACCAGGTCATGTACATGCAGACAGAGGTC TCTCCAAGTATAGAAAAGTGAAAGCAATATTGATTCAGTTTAGCTGATTG AAGAGTTATACTTCCACTGGTCGTGACAGAGAAGACAGACGCTATGTACA ATATTTACAGGTTCATTGTACCGGGGACATTCCCCTAACTCTTTTGACAA GCACATTGAACAGTGGACCACGGCTTAACTACTGGACTGCAACCCTTTCC AGTAGTTTTTCATAACTTTCCTCACTCCACCCAAGTGTAAAACTGGGTAC CTGACTTTGGTTGGGGAGGTAAAAGTGGTGGAAGGAGAGGGTTGGGCTGT GCCTTCCAATACCGTGCCCTAGACACAGTGGTAACAACTCACTGCCTCTA CAGCCTCAAAAGGGCTGTGGATCTACCTTTACGGTTGGGTACTGGTATCT AGAACCTGACTTTGGTTGGGACCATCTTTACCCTTTTTACGTTAGGTCTC ATCCACTGTCCATGCAAGCAGCACTTTCTCCCGGCAGTTATGACTGGAGC AGCCCGAGTGAAGTGAAAGTGATGGGTGAGCAGGCAGGAGATCTTATCTC CCCTCTTATCAGGGGGAGCAGAGATAGTTTCACTTTCACTTTTACAGCAG GCTGAAGTGTCGACAAAGCAGTGCCTTTAATCTGGCTGCAGATCTGCAGT AGTTGATAGGGTTTAGACCCACAGTGGGGAGGAACCACCACCACTGTCAG GCTTAGGGCTTAGACTCACAGTGGGGAGGAACCACCACCACTGTCAGGCT TAGGGCTTAGACCCACAGTGGGGAGGAACCACCACCACTGTCAGGCTTAG GGCTAAGCCGGTATCTTACTGGGCCTGTTTGCAAAAGACGTTCGCACACG AGCGCGAACAAACGCCAATTTGTTGCCAATGGGCATTATTTGTTTCATAA ATTGGCGATTCAAAAATCTAAACTGGCAAAATGGTAAANGCTTAGGGTTT AGACCCACAGTGGGGAGGAACCACCACCACTGTCAGGCTTAGGGCTAAGC CGGTATCTTACTGGGCCTGTTTGCAAAAGACGTTCGCACACGAGCGCGAA CAAACGCCAATTTGTTGCCAATGGGCATTATTTGTTTCATAAATTGGCGA TTCAAAAATCTAAACTGGCAAAATGGTAAAAATGGTCGTGAAATAGGCAC CAAATTGACCGATGGGCTTCGAAAGGCACAATTTATTCTGTATAAATGAA TATGACTCAGTTTCAAGTTTTCTTTATTTGAGCCTTTGTTTGTTCATGAG AAGCTCAAATCTGCTGGCAGGCCTCTTTTCATTGAGGTCATGAGGGAAGA GGTAAGGGTCAGATAAAGTATGAAAAAGATGTGGCCCAGTGAGATGCTGG CTTTAAACTCACAGTGGTGAGTAACCTTAACAGCTGGTAGAGAGAAAGGG AAGGTGAAAGGCGGAGAGAAAGTAAAAGGGAAAGGCGGAGAGAAAAGGAA AGTGAACAGCAGAGAGAAAGTGAAAGTGAAACGCTCAGAGACAGAGAAAG TAAAAGAATGAGAAAAAGTGAAAATAGAAGGCTGAGAGAATGTGAAAGTA AAAGTAAAAGGCTGAGAGAAATTCAAAGGCAGAAAGAAAGTGAAAGTGAA TGGCAGAGAGAAAGTGAAAGTGAACGGCGGAGAGAAAGCACCAGGTGCAA AGTTTAATCTTCCTCCAGGCCAATTCCGATTTTATCACTCTCCATTATCA GGGATGGGGTCAGGTGGGGTGACTGGGCAGGGAGTGTGACGCCAGGTGTG CAGTGAGAGTGAAATGAAAGGGAAAGTACTACCTGATGTGGATTTCCCTT CCCACTCTGAAATACAGGTTAGACATCCAGGTAGAGCATTACGTAACACA AAATAAACAAGCAACTGGATAAAATTCTCTACAGAGTCAGACTTTCAGAT GGCGGCCAGTTAGTCTTCCCACTGATGTCTTTCCCATCCCTTCTCCCCCA GCATTAGTTATTCTCTCCCCCCCCCATGTATTTCTCAACAGCCATCCAAG AGCATTGGCTCACCTCCCCCACACCCTCATGTATTTTCCAACACGCCCCC ACCAGCATTAGTAGATCCCCCCTCCCCTCATGCATGTTCCAACACGTCCC CCCTCATTAATGAACCCCCCTTAAACATGTTCCAACTCATCCCCCCATCA CTAGTGAATCCCCCCTCCTCTTTTGAATGACTTTCCCTCCGACTTGTTCC CTCATCATTAGCAAATCCCCCCAGCATTAATGAATCCCCCCAGCACTAAT GTATCCCCCCTCCCCTCATGCATGTTCCAACACACTTCCCCCATCATTAA TGAATCCCCCCTCATGCATGTTCCAATGCTCTCTTCCTACCCACTCAGGT CCCCTTTGATGTTCGAATCACTTCTAAACGACTTTCCCTGCAACTTGTAC CCCCAGCAGTAATGAATCCCCCCTCATGCATGTTCCCACACGTCCCCCCA GCATAAGTGAACCCTCCCCCCCTCATGGCAAAAAAGCTTGTAGAAAACCT ATTTCCCTACTTCACACATTTCAGTACTGTACAAAAATTCATATTCCTAA TGCGACTAGACAAACCTCCCATTGAAAAACACGTCTGTTCTTTTATATCT ACTATAACCGAAAAGCGAGGAGAAGTAGAATTTATCTAATGATAGTCATA TTCNGGGTTTTCGGAGCCCATTTTCCCCACCGCGCTCCCGCCGATGCCTT TAGCAACCGAGTTGTTTGTAATTAGGGGTCTGCGTGACGCCCGGCGGGAT TTCTGCAAGCGGAAATTGCCGCTGAGTTTTCCTGTGAAGGTGGTTTGGGA ATGAGTGTGGAAGTTCATCTGTGTTGGTTCAAAAGCCTTCGAGTGCTTTC AGATTGGGCAGGCCGGAGGTTTGACCACTCCTCTGACCAGTGGAGTTTGG TGTGTCCAACCTCTGTGTGTTTGAAAGCTCTAGAACTGTTTCCTGGCTGT TTAAGTCTGGGGCCCCCGGGGGAGCTAGTCTGTGGTTAACAGGCTATTAA ACAAATTCATATGTGTTCGTAGCACAGAAGTATTTTTGAATTGGATCAGG GCAGTGAAGTTGTGGTGTTTCCAATCTCTCTCTGTGTTTGGAAACATCTC AAGTGTTCCCCACTGTTTAAGTCTGGGGATCTGGTCTGTAGTTAACAGAC TGTTGAATCTGACTGACATACTGGATTTTTCATGGACATTCATATGTGTT GAAGAAGTGTAATTGTCTTTGAAGCCTTGAAGTGTTTTTGAGTTTGATCA GACCAGTGGAGTTGTGGTTTGAAGTGTTCCCCACTGTTTAAGTCAGGGGA TCTGGTCTGTGGTTAACAAGCTATTAAACTTGGATGTCCAACCTCTGTGT GTTTGATAACATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGGAGCTGGT CTGTAGTTAACAAGCTATTAAACATGGATGTCCAATCTCTGTGTGTTTGA TAACATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGGAGCTGGTCTGTAG TTAACAAGCTATTAAACATGGATGTCCAACCTCTGTGTGTTTGATAACAT CTGAAGTGTTCCCTACTGTTTAAGTCAGGGGAGCTGGTCTGTGGTTACAA GCTATCAAACATGCAAGTTTGTATGTGTTAGTAGTGATGAAGTGTTTTTT TATTTCCAATCTCTCCGTGTGTTTGAAACCATCTGAAGTGTTCCCTGCTG TTTAAGTCAGGGGGGCTGGTCTGTGGTTAACAAGCTATTAAACTTGGATG TCCAACCTCTGTGTGTTTGATAACATCTGAAGTGTTCCCTACTGTTTAAG TCAGGGAAGCTGGTCTGTGGTTAACATTTAGCTATTAAACATGGATGTCC AATCTCCGTGTGTTTGATAACATCTGAAGTGTTCCCCACTGTTTAAGTCA GGGGGGCTGGTCTGTGGTTAACAAGCTATTAAACATGGATGTCCAACCTC TGTGTGTTTGATAACATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGGAG CTGGTCTGTGGTTAACAAGCTATTAAACATGGATGTCCAACCTCTGTGTG TTTGATAACATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGGAGCTGGTC TGTGGTTAACAAGCTATTAAACATGGATGTCCAACCTCTGTGTGTTTGAT AACATCTGAAGTGTTCCCCACTGTTTAAGTCAGGGGAGCTGGTCTGTAGT TAACAAGCTATTAAACTTGGATGTCCAACCTCTGTGTGTTTGAAACCATT TGAAGTGTTCCCTACTGTTTAAGTCAGGGGAGCTGGTCTGTGGTTAACAA GCTATTAAACTTGGATGTCCAACCTCTGTGTGTTTGATAACATCTGAAGT GTTCCCTACTGTTTAAGTCAGGGGAGCTGGTCTGTGGTTAACATTAGCTA TCAAACATGGATGTCCAACCTCTGTGTGTTTGATAACATCTGAAGTGTTC CCCACTGTTTAAGTCAGGGGATCTGGTCTGTGGTTAACAAGCTATTAAAC ATGGATGTCCAACCTCCGTGTGTTTGAAACCATCTGAAGTGTTCCCTACT GTTTAAGTCAGGGGATCTGGTCTGTGGTTAACATTAGCTATTAAACATGG ATGTCCAACCTCTGTGTGTTTGATAACATCTGAAGTGTTCCCTACTGTTT AAGTCAGGGGAGCTGGTCTGTGGTTAACATTAGCTATCAAACATGGATGT CCAACCTCTGTGTGTTTGATAACATCTGAAGTGTTCCCCACTGTTTAAGT CAGGGGATCTGGTCTGTGGTTAACAAGCTATTAAACATGGATGTCCAACC TCCGTGTGTTTGAAACCATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGG ATCTGGTCTGTGGTTAACATTAGCTATTAAACATGGATGTCCAACCTCTG TGTGTTTGAAACCATCTGAAGTGTTCCCTACTGTTTAAGTCAGGGGATCT GGTCTGTGGTTAACATTAGCTATTAAACATGGATGTCCAACCTCTGTGTG TTTGGAAACATTTGAAGTGTTCCCTACTGTTTAAGTCTTGGGAGCTGGTC TGTGGTTAACAAGCTATTAAACACAACTGCAGGGAGGGAGGGAAGTTTTC CATTACCGCCGCCGCTTACGTGCTGACCCCTTTTAACCGGAATCCGCCAC CCCTCCGACAAACAGCACGATGAAAGGAAGGGATGAATCAAGTCGCTTTG ATGATGACAGCACCGTGGTTAGTTAGAGGAGAGGTGCGGAAGACAACGTG AGAGGAAACCTGAGGCTTAAGTTCAGAAATGAGACAGTAAGATGTGAAGA AAGAAAGCATCTTCTTAGTGTGATGGGAGGGAAGAAAACATCTCCAAATT AGTGTGATGGGGGGATGAGACAACAGCGGGATGAAAAGGAGAAATGAATC AAGTCGCTTTGATGATGACAGCACCGTGGTTAGTTAGAGGAGAGGCGCGG AAGACAACGTGAGAGGAAACCTGAGACAAACGAGACAGTTTAAGATATGG TGGAGGAAAGCATCTCCTTAATAGTGTGATGTGAGAAAGAGATTTTCAGT CTGTGGTTAGTTAGAGGCTGGGTGTGATGGGTGGGGGGAGACAACGTGAC AGGAAACCTCAAAAGTAGAAAACTTTTTTGCCGTGTTAAGTGAAATATAT TCGTCAGTACAGAATGAGTTCGTTAACATCAGAAGTCGTCAGAGAAAGAG GGCGGTGCTACAACTTTGCCGGTGATCCTCCGACAATGACAGACCGTTTG CCAAACTTGTTGCCAACTTTCCTTGCACCTGATTGCAGCGGGTTTGAACC AACTCCAGACGCCCGGGTTTAGGGCTCAGCTCAGAACTCACGTCTCTGAT TAAAGCTGTGCCTTCTGCCCGAGGTTCAAACAACAACGATCTGTCTTTCA TTGCCTCTCGGGGGCGAGGGCGGTCATTTCAGCTAGTGCCTCTCTCTAGT CTTGGGGATATTTGCAGCAAATGCACTCATTTGAACTAGTGGGTCTCTCA AGTCTTGGGAAAAGCTAGTCATTTAAACTAGTGGCTCTCTCAAGTCTTGG GAAATCCAGACATTTGAACTCGTGGCTCTCTCAAGTCATGGAAAACGCAC TGTCATTTGAACCAGTGGGTCTCTCAAGTCCTGGGAAACGCAGATATTTG AATTCGTGGCTGTCTGAAGTCCTGGGATATCTGTCCTTAAGTGGACTTCT GTAGGACTCGGGGTCCGTAATGGCACTTCAGCCGGATCTCAGATGAGCTT TTCACGGCAAAGTGGGAGTTTGGGCCGCTTTTGTTCCATTTTGTTCCAGT GAAAATGTGCTTAGCTGGAATAACTGGGCTGGGCAATGTGGGATCTACAT GGGGGGCTGGCCTGGGGTGTGCACAGCATGGACAAGTAGGGGGGTCTTGG GAGGGGGTACCTGGGAGGGGTGTCTAGGGAAGGGGTGCCTGGGAGGGGGT GTCTTTCATGGGAGGGGGGTGCCTGGCAGGGGCTGTCTTGGGAGGGGGTG CCTTGGAGGGGGTCATGGGAGGGGGCACCTGGGAGGGGGGTGCCTTGGCA GGGGCTGTCTTGGCAGCGGGTGTCTTGCATGGTAGGGGGGTGCCTGGGAG GGGGGTGCCTAGGAGGGGTTGTCTGGCAGGGGGTATCGGACACCTACCTA GAAGGGGCATTGCTGTGTGTGTGGCATGTGCAATAAATCTAAGCCGTTGT TCTGATCCTTTAACCATAACTCCTCTGAAGCTGTTGTTTTGTGATCCTTC TACATTTATCCTCCATAAGCTGACAGTTATTCTGACACAAATCCTACCTC TGCACAAATCCTACCGCAAATTCCACCCATCCAATCATTCCTGCCAGTGG GCTTTCCTGAATCTGCTCTCCTGAGACCTCACACAAACTCCAAAAGTTGA GCTGCTGCCAGGCCAACAAGATTAGGCCCCCATTTGCTGATTATTTCTGC CAATGATGCCGCTTTTTGATGGAGATTTGTAAGTTTTCGTTGGCTTCTCC GTTGATCTGTCAGCGTCCGTATGTTCAATCATCTCTGATCCAATTCTGAA ACTCATCATGATTTACAGGCGTCTGTATAACTGTGGACACAGTCAGTGTG TGTGGGGGGGGGGGGGGAATGATCTGGTCTTTTCAAACAGTTTACATGAA ATTGATGAAAATGTATTTTCAAAAGCTTAAAAAGACAAAGCTCATAAGGA AAATCAACCACCTGTGCTCCCAAACAATAAGTGAGATAGAAAAAGGTTTA AAGCTGGAGACAGCCCTGTATTGGTCATACATGCATATATGCATATATCA CAACACAATGCACATTTTCATGCAAGCTCATCTGCATGTGTTGGTAGTAA TCATAGTACAATGCTAAACTTTCTTCTTGAATATCTGAGTGTTGAGTGTT GGAAGAAAGTTGAGCATTGTACTACAATGCACATTTATTTATTGCACAGA ACACACATCTCTACACCATCTTCACACAGACCAGAGATGGGATCGGTTGC TACACCACTAAGTAGTGTCACTTCAGATTAACAAAGACATTCCATCTCAC AAATCATTTTCATTTGTTACGTCAAATAGCTTTACATCATTCTGCTTCAA GACTCCGTTCTGTAAAATGAAACGTACCTGCCAATAATAATCAAATAATT TACTGTGCTTGTAGTAGCTGTAAGGGTATGGAGCGTTTATATATTCAGTA GCAGTTTAGATGTGTACTAGTAATTTTTTTTTTGTTCTCTCAGATTTTTT GACAGACCAGGTAAAATTTGTGTCTGTCCCAACACGCAAATTTCGGGCTG GTACCTCAGTTGATACGGAATACTCCGTGTTGTATTCCATATGTACACAT GACGAATGCATATTATTAACTAAAGGTGCATGTATTCTGCGCAATGGTTG ATATACAAAGTGTATGGTATATACATGTATGTCCAACTTGTGGTATATAC ATGTCCAATGCATATGGTCCATGTACATGTAACTTGTGGTCTGTGTAATG GTACATATGCATGTATTGCATGTACGTCCCCTGCCTCCCAGTCCGACTAT GTTAAAGTAAAGGGCATCGCCGGCTTAAGGCTGAGCTCCGAGCATCGATC TGCGGTATATTTGTAGTCCCTGCGTTTCCCCTGATTGGGCTCATTAGCAT ATCAAACGGCTTCCCCTCAGATATGGGAGAGAGTCTAATGGTGGCCATTC CCACCGCCAGGCCTGTCTATAACTTCCTGTCCCGGCAGTGGCCTGTGTAT TCCAGTGGTTAGCGGCCCTGCCTCTGGAACTAGAGGTTACGAGTTCGATC CCGCTGTGTTGCTCACCCGACATGCACACTACTGGAAAGGGTCGCAGTCC TTAGGACAGGACGTTAAGCCATGTTATACTGTTCATTGTACATGTCGAAA AGAGCTAGCGGAATTTCCCCGGTACAATGGTTCGGTGTAATATAACCAGC TGCTGCCGCGCTGCGTGCCTGCAAAGCTGGTGTGCTATGCCGAATGGCGG TTATACATAGGTCTGTCTTCTCTGTCACGACCAGTGGAAGATTAGCTCTT CTGTGAGGTAAACTGGATCAATAGCACTTTCTATCATTCCTTTCTTGTGT AATGATGGGCGCTCCCAGGAGGCCAGGCTATCCATAACTCCCCCTGGGAG CTTAGATGCGGAAGGTTCGATTTAGAGAACAAAAGACACATTTTTGCCGG TCGGCACTCTTTTGGAAACTGGGCTTAGGCCACAGGAAGTTTATTTCTTG CTTTATATCAGACATAATCTTTTATTTATTACTACTTTTATTTGCAAATT CATGCCCATAGGCTAATTGCAAGGTTACAAACAGTAGAAAATGTAGCAAG GGTACAAACAGTATAGAAACATTCTAAATAATTGTAGTATCAACTTGAAA ACAGAGCCTGAAAGCTGTACCTTGTGACACACAGTTTCATGGAGTGATTG TGCATGTAGTAAGATGCATGTTTTCCTCCCAGCTTTCTGCTTTCATCTTG ACAACTTGTGAAATTTTTATTTCCAAATGTCCAAGAACCGAGGAAGTGAA TTGGTGTGGCCTAACTTCCTGTGAAAGCCCAGATGTGGTTTTCGGATTTA AAGAACAAAGGACGCATTTTTACCAAATGACAGAATTCTGGAAACTGGGC TGGGGCCACATTAATTTTATTTATTGGTTCTTGGATATAAAAGACAAATT CTAAGTTTGAATATTAACTTGATACAGAGCCTGAAAGCTGCACCTTAAAT TGGTATACCGGTACATACAGTTTCAGGGAGTGAATGTGCATAAAGTATGA ATTATGATGCAAGTTTTCCTCCCAGCCGTCTGCTTTCATCTTGACCACTT GTTAAATTTTTCTTTCCAAATATCCAAGAACTAATGAAGTGAGATTTGTA GCTTATGGCATGCTGCTACATGTATTTGAAAGCATGATGCTTATTTGTCA TTCCATGTAGTGACATGTACCTATGATACAATCAGACCAAAAAAATGAAG TAAATTGGTGTGGCCTAACTTCTTGTGTGAGCTCAGATGTGGATGTTCAG ATTTAGAGAACAAAGGACGCGTTTTTGCCCAATGGCAGTCTTCTGGAAAC TGGGCAATTATTGAGAATTGAGATGGAAGTTTTTTCTTCTTCTTTTTGCT GCATTCAATGATTTCTTTATGCAATTATCTTATCAGTGTACTCATCCAAG CAGAAACACAGCATAAAGCTGCCAGATCGGGTACGTCATTTTTTTTAGTA ACTGGCAGTGAGCAATCCTCAACTCATTTCCTTAAAAACCACTAAAACCA TAAAGCCATATTAATGTAATACTCAGTAGGTCTTGCCCCTACCAATTTGT GTAAGATAATCAATGTTGAAAGTAGATTATATGAGTAGATTTTGATGACC CTACACTGACGACCTGTCACACCTAACCTTCGCACATCTGACTGCAACCA TTGTTGAGTGCTATTTAATGAGAATGACCCTACTGACAATAAGTTCTTAA ATAAACTATCATAGATAAGAACTCATTGTCAGTAGGGATTTGTCATCTAT TGGTTTGGCTGTTCAGCACCCACCAACAGGGCTGCCCAACTACCTTTAAG TTAGTTCTAGGACCCCCCTCCTCTAGGGACTTCTCCGATTGGCCGAGATA TCCACCCTCAGCTTCATCATGAGCAATCTCCATCATCAAACCCAGCCTCA TCAAGCTCAGCCTCCGTGACCCACTTTCCTCCAGCTGATGGAGGCTGCAA TTAAACCTTTCAGTCCCCCATTTATTTCGACATGCCGCCGATGCTGTAGC ATTTAGAGCCGCTGATGTTGTAGTGTTTAGAGCTGACACAGACATGATGT AGCTTTGTGTGACAGGTAGTTCAGTGTAATATAACCAGCTGCTGCCGTGC TGCTTGCCTGCAAAGCTGGTGTGTTACGCCTAAGGGCTGTTATTCCAGTT ATATAGATACAGAAGCTGATAGGGTTCATGTATAGACGTACAGTGATGAT GATGTAGCATTGTAGCAAAGTAGCATTATTTTCCACTGACAAACAACTGG TAATGTAGTATAATTTTCAGTGACAAACAGCTGATAACGTAGCTTTATTT CCACTGACAAACAACTGGTAATAGAAAAGAACTTCAATGCGCGACAATAA TAATGTAGCATTATTTTCCACAAACATACAGCTGATGATGTAGCATCATT TTCAGACAAACAGCTGATAACGTGGCTTTATTTTCAGTGACAGGCAGCTG ACAGCGTAGCTTAGAGGAAAACAGTTGCAGGCAGTTTCTTGAACAGGACC TGATCGTTGCATTTAAAGCTAGAAGTCTGGTTCATTACCAGACAATGGGA CTCAGGGGGGGTCTGTTTTAAGTAGCGCTGTGAACTTTTTGGTGTAAATT CCCTGTCAATAAAGCCTACATATAAACTGTTCCTGGAATCTGCTCCTGGA ATCTGTTCCTGGAATCTGCTCCAGCCAGTCGGATATCGGATTCTGCTTCA TACAGGCGATACTGTCCATATCACAGTCCCACACACTATTTGAGTAGCGC TGCGAGGCCTGTTGGTGTGAATTCCCTGTCAATAAAGCCTACATATAAAC TGTTCCTGGAATCTGCTCCTGGAATCTGTCCCAGCTAGTCAGGTTGAACA GGAGCTGATAGTTGTATATAGAGCTAGAAGCCTGGTTCAGTACTAGACAA TGGGACTCGAGAGGGTTTATTTTAAGTAGCGGTATGAACCTGTAGGTGTA AATTCCCAGTCAATAAAGCCTAGTACATATAAACTGTTCCTGGAATCTGT TCCTGGAATCTGTCCCAGCCATTCAGATATCGGATTCTGCTTCATACAGG AGATACTGTCCATATCACAGTCTCACACACTATTTGAGTAGCCTGTTTGT GCAAATTCCCCACCCAATAAAGCCTACATATAATCTGTTCCTAGAATCTG TCCCAGCTAGTTGGATTGAACAGGACCTGATAGTTGTGTTAAGAGCTGGA AGCCTGGTTCAGTACTAGAAAATGGGACTCAGGAGGGTTTATTTTAAGTA GCGCTGCGAGCCTTTTGGTGTCAACTCCCCCCCGTAGTACATATAAACTG TTCCTGGAATCTGTTCCTGCACTCTGTCCCAGTCAGTTGGATATTGGATT TTGCTTTATAAAGCAATACTGTCCATATCACAGTCTCACATGCTGTTTAA GTAGCACTGTAAGCCTGCTTGTGTAAATTCCCCGTCAATAAAGCCTAACA TATAAACCGTTCCTGGAATCTATCCTGGAATCTGTTCCTGGAATCTGTCC CAGCCAGTCGGATATCGGATTCTGCTTCATACAAACGATACTCTCCATAT CACAGTCTCACACGCTGCCCCGCGTCAGTGCAATAAAACATGGCACCAAT TCCCAGTCACTGATAACAGAAGCCTGGGAGATTTTGATCTGATTTATTTA TTTGGCTGTAAAAAAGCACCATAACAAAACCTCAAGGAAGGCTATTACTA AGGGTTAGCCCTGTTAACTGAACATTATACGAAATCCAATCCAATCTTTC ACAAAGCACATTGAGACGTTTTTCTCCCTCAGTCTCTATGAGAGCTGTAC AAGGAAGGCAGTGGAAGATGAACTGCATTTTATCTGTTAATGTCCATTAT ACTATTCTGAAAGAAGTAGATTTTTCATAGAAATCTTTCAACTTTGCCCA AGCTTTTTATACCTTACCAATCAACCTGTTTATTTTCAAAACATTGGACA ATTCGCCTTCCACTACATGTATAGAAAAGAAGTCAAACCCTTCAAATAGC TTATTAGTAGAAATAGATTTAGAATAGTTGTCATTTTGCTCTTAATTCAT TGATATATTCCTTCTCTTTAAGCATGCACACGTTGTATACCAGTGTTTTG CTTGCTTTGTTTGCCATTAGCCTCGGGCATGGTTTTGCAATAAAGTCCAT CATGTGTTCCTGCCTGCCCTGTGCCAGGCTTGCCTGGGTCTGAATCCCGC TTCTGGAAGTGATTGAATAATTTCCCCATTCATCAATCTGTGTGCTGTGA TAGCCGAAGTAACCAACTTTGCCCCTTAGAAATGAACGAGAAAAAGCGTT ATTGGCACAACAAATAGTGCAGTGACTTCTGTACGGCCAACTAAAAACTA AAAAAAAGATATAGGAAATTAATCTTACAATTCTACTTTTAACTTAACAA TAGTGGCTAACATAGTACATAATATCCTAACACAATCAGGTGGGGCTTAA CGCAAGTTTCAGTATCTTTCCTGATAACAAAGCAATATTTTTTGTACATA CCTATTTTTGCATTGTAGACGCCAAATGTAAAGATATAGTCAACTCTATT GGTGGTCTTGAGGTCTTTGAAATCTGTTGTACCTAAAGAAAGAAATGTGA TGTCAAACACAGGACACACTGCTTTGTGATACCGCCAAGTTATATTCTTG CTTCACAAACATTCTAAAATGAAAATTTAGCAAACAGTTTGCACCAAGGT ACATACTTTCCCCTCAGACTCTGTTTTCAGGTCGATCTTCGAGTTTAGAT GTTCTAGTATTGATTTCTTCTGCCAGCTCATTCTAGTGACGCTGAAGAAG AGTGATGGATGTCACTCAAAACATCTGAAAGCAATCTTCTTATCTTATTT AGTTATAGAGATTAAATTGTCTTCAAGATATTGCTTACCAAGATGTCTAA CATTCATCAATGTGCTATCAAGTCTAGAATTCCATTTCTTTTAGAATACG CGAATCAACAGATTAGGTCGGTGTGGCCTTCCCACCCGCACATAGCGCTG TGCTATCAGGAAATGTAGGTTTGTGATAACCCAAAGCACCGGGCAATTTC CCCCTTATCTGAGTCCACTGAGACAATTTTAGGAGGTTTTCAAATTTGAT AAAGCAGGGGGACACATTCGTAACTGCCTCCCGGTTGTGGAGCTATTGAT ATAAACAGAGCCGGCAGATCTAGCAGGTTTGTGTAGGATATGTTTTGGGA ACATTGAGCCATAGCCGATTCCCATCCACTGTACAGCTAACTGTCACTAA CAGCTAAGACATGTTTTACATGTGATTGCATGGCCTACAATTCTCTCTGT GGTTATACATGACAGAAGTTCTGAGAGAGAAATGGTTTATTGTTTCATAT TAAAAAAATCCATTACAGCACAAGTGCTGAATTGCAGCCTTTGTACAAAT GTCCATCTTTTACATGTACTCAGGACTTAAAAGGCATTACTCATTAAATA TCAATGATTCTGATATTTCCTGTGCCCAGTGCACTAGTGGTGTGATTATA GAAACCATTCATACATGATTATATCTCCCCCTAGGGGCCTCCTGTGTCAC GGTTTTTAATCATTGTTTCATCAGTTTTTCTGTACGGAGATTAGTGAGAA ACGGGCAATTATGTGGTTTTATAAGAGCTTCCCGTCGGCAATCCTGCCAA TGTGATTATAACAGTTTGGGCTTTACTCGATTGTCTTGAGATATGCTCCC CTGGCTGCAGATTTTTTCAGTCTGAAGACAATTCAGTCTCTACAACTGGA ACAAATTTGGAGATAACTTCCAGACATTTTGAGTGACATCCATCACTCTT CTTCAGGGTCACTAGAATGAATTTACAGAACAAATACTAGTTTGTCGTAC TGGGAAAAAACTGTTCGAAAATGTCCAAGCTGCTGTAGTTTGTTGTACAA ATTTCTGGGCTGCAGTGAGTAGCTTAGATGAGAAGTGGACCATGGCTGGC TCCAGGACCCGTCCCAGGACGGAAAAGTGCTCATTGGGTCGGAAAAAAGG CAACCCTTTGTTCCAAACATTATGACATGAAATTGAGAAAACTTTATTTT TGTAAGCCTAAAATGAATATGATGAAAATAAACAGTGTGTGCTCCCAAAC ATTCAGTGGGACAGGAACATGAATTGAAGCCGGAAACATCCCGGAAGGAA ACTATATTAACTTGAAGATATATTTAAATTATGGTTTTTATTGGTCAGAA ATTACCAGTGCAATGCTTTCTAGTGCTGAATTGGTGCAGGGTTTACAATC ACATAATATACATTATCTTTGTATTCCCTGATAGTCCTCCCATGTTTTCT CCTGAGCTGGACTGCAGTCCCAGCCAGAGGTCTATCAGGCTAGCAGGGTT ATGAAGTGGACTGTCTATCCCATCTAGAAGTCCTCCCATCCAGAGCTATT ATGACAGATTGAGGTTTAGTTGATCGATAGCGGTCCTCAGAAACGGCCAT TTCCACCTGCAAACAATTGGGGCAATTATAATGACCGCTCGCCGGCCGGC ATTTACAGCGCATAGATTCTGCCCCCGCGGCGATCGGTCCGGTATCTGTC TAAGGTTTCCGGCAGGCTGCAATACGGTTATTTTTGTGCCATCTTCTGTG TTCATTTAAAATATTCCTTGGCACTTCCTCACAGTTTTTATTTTCAGTGC CTATTCAGCTATTTCTGCAGTTAAACATTTGGAGCCAATAGTTTCTGCCC CTGCAGGGATTGGTCCGGTATCTGTCTAAGCTTTCCAGCAGTCTCCTATA GTGTTATTTTTGTGCCATCTTCAGTGTTCATTTGAAGTCTGTTCTGAAAT ATTCCTGGATATTTCTTCACAGTTCTAGCAATGCTATTTACAGTGTCTAT TTAGTTATTTCTGCAGTTAAACATTTAGAGCCCATAGATTCTACCCCAGG GCTGTATGTCTGGTATCTGTCTAAGCTTTCAGGCAGTTTGCAATATGGAT ATTTTTGTGCCATCTTAAGTGTTCATTTAGAATATCCCTTCGTACTTCCT CACAGTTCTAGCTTTGCTGTTTTCATTGCCTATTTAGTTTTTGTTCTAAA GTTAGACATTAGAGCCTATAGATTCTACCTCCACTGCTATCAGTTTGGTA TCTGTCTAAGGGTTCTGGCAGTCTTTGATAAGGTTATATTTGTGCCGTCT TTTCCGTCATTATGTTTTTGGTGAGGTTCGAGCATTTGTGTGGACGTTAA CACGAAATTTGAGAATGCCTGCTAGTGGGTGTTTTTTTTATTACCTATGC TATAAGGTTATGTTTTTGGTCCTGTTCATGTGTCTGTGTGGGTGTGATTA TGAGAACTCGAGAACGCCTTGGTCGATTCTCTTTTATATTTGGCATGGGG TAGGTCTTCTTTGCTGTTGTTTTTATAATTCTTTAGTGTTAGTCTGCTGT GAGCTCTGTGATATTCCTTTGATATTTCTAGCTTTGCTCTCTTCAGTGCC TATTTAGTTGCTTTTCCCACCTTTTAGTTTTTAGTTCCAGTTGTACTTTG CTTGCCTGACGTTTTGTTTTAAGCTCAGAGTGTTTTTTTTTTCATTTGTG CAGTGATTTTTTATTCTTACAACTGTGCATGAGTACTTTATAGTGGTTAA TTACAGCTATAACTGTGCATCACTGCAGTCACTATGACTATACAGTTATG CATTTGTGCGGCGATTTTTCACTGTTATAAATGTGCTTTCCAGCCGTGTC TATCTATGATCATAACTGAGTGTGTCTGCGGCTCTTATTTACAATTGTAG CTGTGCATTTCTGCTGTGGTTATTTACAGCTATGGATGTGCCTACCCTGC CATAGCCTGATATATGACGCCATTTATGCACCACTTCTTTTCATTCTGCT TCACTTAGCCACAATCTGGCCTGTAAAAAACATTCTCTCCGAGATTTCTG GATACAGGGAGCAGCCATATCACAGCCACACGTTATTCACATTACAGATA GTGTGTACAAATGTATGTATTGTTCCTTCATACTTGTAGATTCCTGAAAA ATGCCTCTTTATAGACATTTGGTTTCCCAACACCACAATCTGGGCTGTAA AAAAACATTCTCTCAAAGATTTCCGGATACAGTGAGCAGCCATACCACAG TTATTTACATTACAGATAGTGTGTTCAAATGTATGTATTATTCTTGCAGA TTCCTGAAAAATCCCTATTTTATAGACATTTTATATACATATCATAGCCC ACAAGTTATTAACTTTACAGACAGCATGTAAAAATGTGTCATTCATCCAT AGGTGCAGTTTCCTGATAAATTCATCTTTTTATAGGCATTTGCAAACAGC ACACACTTGATTATAGGCTGTACAAATGGCTTCTGGAACATGCTTTTATC TGCAGATTTGGGGTGGCACCGGCTAATGGAGCCTCGGGTGCTTAAGCCAT TTCATCGCAGATTTCTGATACGCCCCATCAAACGTGGCGTTCTGACAGTG TGCTTCAATAGCGGAACATTAAACATTCAATACACAGTAAATTCAGGGTT AACCTCTCCGGAATACAATGAATAAATGCAGAACTCGCAGCGCTTNTCTC CGGAATACAATGAATAAATGCAGAACTCGCAGCGCTTTGAGTCAATAAGC AGGACCAAATTCAGTCTATCTGAACTTGCTGTGAACTGGAGATTGTGTTG TGCCTCTCCAGGGTGCTGGAGTTTGTGTTATGCTGTTTGAACAGTTTTCC TGAAGAGTGGAGATTGCTCGGGCACCTTGAAGTTTCCGTTGTGCCTCTCC CGGGTGCTGAAGTTTGTGCTTGTTTGTTTGTTTGAACCTTTGTTTATTCA TGATAAGCTCAAATCGGCACGCAGGCCGCTTTTCATTGAGGTCATGAGGG AAGAGGGAAGGGTCAGATACAATATAACAGAGATACACAGTCATTTGAGT CCTAATAACTCTATCAACATAATCATTACATGTTTATGGTACAACAATAT ACAATTTCTACAACATACAACATAAAGTAGGGCGAAAGCTGGTTCATGGT CCGTGTCCGTTCGTTTAGTTCATTTCCGTTACTTCNCCGTTCCGTTGCTG TGCTGTTTGAACAGTTTTCCTGAAGAGTGGAGACTGCTCGGGCACCTTGA AGTTTCCGTTGTGCCTCTCCCGGGTGCTGAAGTTTGTGCTTGTTTGTTTG TTTGNTCATTGTGCCTCTCCCGGGTGCTGAAGTTTGGGTTATGCTGTTTG AACAGTTTTCCTGAAGAGTGGAGATTGCTCGGGCACCTTGAAGTTTGCAT TGTGCCTCTCCATGGTGCTGAAGTTTCTGCTGTGTTGTTTGAACAGTTTT CCTGAAGAGTGGAGACTGCTCGGGCACCTTGAAGTTTCCGCTGTGCCTCT CCCGGGTGCTGAAGTCTGTGCTGTGTTGTTTGAACAGTTTTCCTGTAGAT GGAAAGCTTCAGGAGCACCTTGAAGTTTCTGCTGTGCCTCACCTGGGTGC TGAAGTTTGTGTTATACTGTTTGAACAGTTTTCCTGTAGATGGAAAGCTT CAGGAGCACCTTGAAGTTTCCGCTGTGCCTCTCCCGGGTGCTGAAGTTTG TGCTGTGTTGTTTGAACAGTTTTCCTGTAGATGGAAAGCTTCAGGAGCAC CTTGAAGTTTCTGCTGTGCCTCACCTGGGTGCTGAAGTTTGTGTTATACT GTTTGAACAGTTTTCCTGTAGATGGAAAGCTTCAGGAGCACCTTGAAGTT TCCGCTGTGCCTCTCCCGGGTGCTGAAGTTTGTGTTGTGTTGTTCGAACA GTTTTCCTGAAGAGTGGAGACTGCTCGGGCACCTTGAAGTTTGCATTGTG CCTCACCTGGGTGCTGAAGTTTGTGTTGTGCTGTTTGAACAGTTTTCCTG AAGAGTGGAGACTGCTCGGGCACCTTGAAGTTTGCATTGTGCCTCTCCAG GGTGCTGAAGTTTGTGCTGTGTCGTTTGAACAGTTTTCCTGTAGATGGAA AGCTTCAGGAGCACCTTGAAGTTTCCGTTGTGCCTTTCCTGGGTGCTAAA CCATTAGCTGTTATAGACGTGCATCTTGCCAGAAGGCTTGTACTTAAACA GACGCCTTGATGATATTACAGCAACTCGGTTGTCGAGTGTTTGCCCCTCC CAGAGGGGGACAATATCGACTGTCTCAGCCGTTTTAATCTGTCCTCACCT GGAGCGACGACATTAAGTGGTTTGGGATGTGGAATTTCACCGCCTTATCT TCAAAATGTGCCTGAAAATTCCACAATCTGGAGTCCCCACATGGTTCAAC GCTTCCTGGTAACGCTTCCAGCTGCTAACCTGTTACCGTGGTTACTGTAA ACAGAAACAATATTAGTAGAAGGGACCAGCCTGTCACCATGGTTACTGTA AACAGAAACAACATTTGTGGGAGGGACCAGCCTGTCACCATGGTTACTGT AAACAGAAACAACATGGGGTTGTCAAACCTTAATTGATAATGTTTAGCCA TGAATCCTCCTCAAACAGTCAACAAGCGATTTCATATTTATGATACTTAT ACATACAGTTCATGCACAAGTCAGCATGTATCATGCACATTATGTGATTC CCCTAGTTGCTAACAGTCCTCAGCAAATATATGGGATTGTTGAAATGTTG TTGATGCCATAGATTCTCATTAAACAGTCAACAAACATTTCATATTTGTG ACACATACAGTTCAAGCACAAGTCAGCATATATTATGCCTAGTTGCTAAC AGTCCATAGCAAACATGTGGGGTTGTGGAAGTCCTGCTGGTGTTAAGCTA TAGATCCCTCCTGAAACAGTCAAGAAGCAATTTCATATTTATGATACATG CAGCTTGTGTACAAGTTAGCATATATTATGCACATTATGTGATTCCTAAT AACTAGCAACAGTCCTTATAACAAGTGTTGTTGAACTCTTGTTGATGATG TTTAGCCGTGGATCATTCTTAAAAGTCAACATGCAATTACTTGCTGTGAC ACATGCAGTTCATATATTATGCGCATTATGTGATTTCCCTAGTTTATTCA TCTATTGTAAAATGCAACAGTACATTACACCGACTCTCAAGGCAGCGTAG CTGATACTGGAGAGTCGACATGTATGGACAGACAGATACATAAGCAATGG GAAATTTACACAACACAAGTTTAGATACAATGCTACATTCAATCAATAAA CATCAGCCTACAATCCAGTTTAACATTGTTGAGTCATATGATGAAAATGC ATTAGATACATTATTATATACAGTCCTTCGCAAACAACTGGGGTCGTTGA ACTCCTGTTGATGATCTTCGTCAGGTGCCTTTTTGATGAGTCCCATCGGA GCAGTGAAAGTAAATCTCCCCTTACTGCTCGGTTGTGTTGACGTCAGCAG CGCTGATGGTGAAAGTGAAAGTGAAATGTGCGGGATGTCCCAGATGGGTT TCGTTCTGCCTGACTTCAGATCAGGTTTCAGGAGGAGGAAACTCGTCATG TGTGATACACTGTTCCCCGCATCCGTGCACTTTCACCACCACTTTCACTA CCTGTGTTCTTACCTGTGCACTTTCACTACCTGTGTTGTGTTTGTGTTAC CGGTTTGTGATGCATGTTTGGGTTAGTTTTCTGTTGGGTGGTATTTATTA TGCCCACTTCTAGAGGTATCTGTAGAAAAGTGATATCTATAGTCTTAGGA AAGAGATATTTGCAGTCAATAGTAAATCAAAGTAGATGGGTAGCTGCTCT GAGACATTTTGACAGCAGGACTAAAATAGTGCACACAAATGAAGCTAGCA TTTGGTGGTATCAATTGTTCTTCTGTCTACTTGATACCTGTAGTCTTAGG GAAGTGATATTTCCAAATCATTTTGACAGGCAGCACTTACTGGTGTGTTA CGCTGAAGAGCGGTTAAACCGACTGTACAGATACAGATGCAGATAATTGT GCCTACTGCAGTTCGCAGACATGAATTGATAATGCCTATAGTTGAGAGAC ATTCCGACAGGCAGCACTGAGTCTAAAGTAGTGAGGCTGATGTTCGGTGG TAATAATTGTGCCTACTGGCTACCTGATATTTGTAGTCTTAGGGAAATGA TATCCAAGTCTTAGAGAAGTGCTATCTGTAAGTCTTATTGAATTTCGAGT GTAGGATGTCAGACATGGATTGATAACTGCTTACTGTAGAAGAGACATTC TAACAGCAGAACTAACTCCAAAGTAGTTCCTGGCAGTGTTAGTTTTATGT ATGGTATATCTGTAGTTTTAAGAACTGATATCTATATTCTTAGGAAAGTG ATATCCAAGTTTTAGAGAAGCGATATCTGTAAGTCTTAGTAAATTCCGAG TGCGGATCGCAGACATGGATTAATAACTGCATACTGTTGAAGAGACATTC TGACAGCATCACTAACTCCAAAGTAGTTCCTGGCAGTGTAGTTTTAGGAG CTTATATTTGTAGTCTTAGGGAAGTGATATCCCAGTCTAAGAGAAGTGAT ATCTAATTCCTAGTAAATTTGCAGACACAGACTGATAACTGGGTACTGTA GAAGAGACATTCTGACAGGCAGCACTAAGTCCAAAGTAGTTCCTGGCAGT GAGGCTAATGCGGGCAGACAGTGATGGAATGTCGCAATTTCCAAATCAAT ATCAGAAACTGCGTCTGAGACAATAGAGAAGATGGAGATCATTTTACGCA GTCTGTCTCGGGCCACACCAAGGATTCGGTGGTTCTGGGATGCAGAAAAA ATAATACTGAGCTACAGGGACACTGAAAACAGAGTCTAGCTTACAAAAAT CCATATCACTACTAAAATCAACAAACCCACTTACGATGAAAAACGTGGGT CTCTTCATTTTCCACTGCCTTCAAAAAAGAAGTCAAACCCAACCATAGTC AACCTTAGTTAACTTAGAATTTTGACAGTAGTCTAGATAACTATTTTTGA TTCCCATGTATTTCCATGTACTTGTTTGTCTGCAATTAGCCTTCGGGCAT GAACTTGCAATAAAGTTATTATTATAATTAAAGGGCCAGGTTGATGCCTT AGTGCACACAGTTTAGGTACTTCTCGTAATTGATAGATCACCAACTTGTC TTGTTTACATTCATTTTTCTTTTATCTATTTTGTGTTTATTTATGTCCGT ATGTTGTCATTGTATCTTACTCTTGTTTCATATTCATGTATTAGAGTAGA GGGCATTACATAAGCAATTTTATGTCATGCCTGGGCCTGATACGGGTGTT CCGGACCGTGTGATAACTATCCGGATCACATAGGGTTCGGGAGGGTTATC ACACAGGCTTCCATAGAATATTTCGAACGCATTTCGAACGCGCCGGCTGT GCGGCCGTCGGAAATTCAAATACTGGATTCGGAGATTGGAATCAATGTTG CTACACTTTCTTGTTCGAAGACACAAAACTCCCTCAACTTCTGGCGCATT CCGCATTGAGATGTATGTTATCTCGGGTGAGTATGACCAAGGTATGACAT AAATAAAATACAACACGTTGTATTCCGCATCACCCTCGGTCCCAGCCCTC CCGCGGGTCGGATCGCCCTCCGGCCTACGGCCGTCGGGCGATCCGACCCG CGGTCGGGCTGGTACCTCGGGAGATACGGAATACCCCGTGTTGTATTCTA TATGTGCTGTTTGCCCTATACTCTTAAAATACAATGTGAATGAAATAAGA TAAACAGTTTATACAGCTCAGCCCACATTGCAGCCAAATGCTGAATCACG TAGGGAAACTTTAGTAGGTAAAGTCTTGCATTAAAACAATGACTGTAGTG ATAAGCCTGTGCTGTTGTTCGTAGCAGTCTGAATCCCTGGAGCATGAATC CCCAGGGAGCTCGTGACACCGCGGATCACAAACCATCTGTTGGCGCTCTT TAATATTCCGAGATTCCGATCTGCGGAATTCCTCCCGGAAACTCGACGTG ACCCCCAAATAGACGCTAAGCTATCCTCCGCCTGCACCGCGACCTCTGAC CTCGCTAGCAAATCGATACGTTTCATCGGCATGGCAACGGGACATCCCGC CGGCAGACGGCTCTGACAGGCTGGGCTGATAGTACAACCTGGGGGAGGCA CTTTCACTTCCTGTTTACCTGGCTGGGGGGGGGGGGAACTTTCACTTGCA TTTTACCTGGTGGGAGGGGGCACTTTCACTTTCTCTTTACCTGGCGGGAG AGGGCACTTCCACTTTCTCTTTACTTGGCATGGGGGCACTTTTACTTTCT CTTTACCTGGCAGGAGGGGGCACTTTCACTTTCTGTTTACCTGGCTCCCT GTATTGCTGTCTGGCAGTGGAGAGGGAAAGTGGTCCCATTACTTGTGCGA GAGTGAAAGTTAGACAGACGGCCGGTCGCAGCACCCCTAACTGCTGCCGT CCCCAGCCAAGCGTGGCCCTTACGAGCCGGCCAGGCGAGCGGCCGTGCGC GGGGAAGTGGGGAAAATTGGACGCCATCTTTCATATCAGGGAAAGTCCTG AATGTCTCCAGCCATTATATTTCAGGCTGGACTGACGGAGGAAATGAACA TTTCCTGCTGCCCGAAGCATAACCACACATTCATAACCTCAGTTGTGCAC CTTCTCAGGCATAACCGCACATTCATAACTTCCCTGGTGTAGATTCACAC ACATCGGGGAACATCTCACTGAATCTGAGGTGTGACTTCCAGCTTGTCAG GCACGCGGCTCAGCCGGTTATATAACATCAAATGGATAGTCAGACCTGCC CTAAGCATAACTTTTCATTCACAACTTCCCAGGTATAAGCTCACGTGCAC ATGGCCACAGCTGGTTATTTAACATCAGCCCTGCCCTAAGCATAATCTTA TTTTACTTTCATAACTTCTCAGACACGTGGCCATGGTTAGTTAGATTACA GCTGGTTATGTAACATCAAACTGTGTGTCAGCTGTCAGCATGTATTACTT CCAGCTTTACTTTCATCCACCACATGTAAGTGGTGAGACTTCTGCAGTAT ATGTCAGGGTTCAGCTCCACTGTGGGTAACGGGCTTGGAAAAAACCTGTC TCTCTGTGTACTAGTCGTAGCACAGATGACAAGTGAAAGTTTATGGTTCT GTACACTGTGTGTAAGTAATGAGATACCTGCAGTGTGTTCTGTAGTCCTT ACATTATCATGGTTTATCCCCACTGTGGGTAAAACCTTGTCTCTCCTTGT ACTAGCTGTAGCACAGATGACAAGTGAAAGTTTATGGTTCTGTACACTGT GTGTAAGTAATGAGATACCTGCAGTGTGTTCTGTAGTCCTTACATTATCA GGGTTCATCCCCACTGTGGGTAACGGGCTTGGAAAAACCTTGTTTCTCCT TGTTTCAGAGCTGACAAGTAATTTCAAGTTTCTTATTTGTTGAGTGGCCT TATAAGTACAGCATAGAAAGTTGTCCTTTCCTTTACGTATCTTTACCTGT TATTAAGTGAAAGTGAATCCGAAGTGAAAGTGGTTCATTTGTGCAATTGT TAGATTTCCCGCTCAGTATTGATTCCAGCCGGCCCCGAGATGGAAAAGAA AACTTTCTCCACGGGTGTACTTTCACTTTCATGTCACAAAGAACACAATC AATCCCCGCGATGGGAAATTCTGGCAAGTCATTTTCCACGGTTCCTCACC AGCGTGGAAAATAGGCAGAAATAAATAAAACCAGACAGGCCTGAAATCAG CCGGCTGGCCCACTGTTAGGGACCATTCACTTATCAACATGGGGGAGGGA GGAATCAGCCGGCTGTCCCACTGTTAGGGACCATTCATTTATCAACATGG GGGAGGGAGAAATCAGCCGGCTGTCCCACTGTTAGGGACCATTCATTTAT CAACATGGGGGAGGGAGGAATCAGCCAGCTGGCCCGCTGTTAGGGACCAT TCTCTTATCAACATGGGGGAGGGAGGAATCAGCCGGCTGGCCCGCTGTTA GGGACAGTTCCTTTGTCATCATGGGGAGGGAGGAATCAGCCGGCTGGCCC ACTTCTAGGGAACAGTCATTTATCCATGTGGGGGAGGGAGAAATCAGCCG GGCTGTCCCACTGTCAGGACTGTTCATTTATCAACATGGGGGAGGGAGAA ATCAGCTACCCACACTGGCGAGGGGCCACTCATTGAAAATTCTGAGGGAT GACTGGTGAGGGACTGTTCATAAGTCACCATGAGGGATGAAGCTGCCGGT AACCCACACTGGTGAGGGACCACATCTGGGAGAAAAACAACCGAGTTGAT ACCTGCCGGCCCAGACAGAACCAGCTCCTGTGTTACCTGATCCGGGTTGG CAGGTTTCCATATCAGACTCACTTTCCATTGAGCAACTTTCACTGCTGAA CAGCTTTCCCCTGGCAGAGACTGGCTTCCCCATAGTTTGTGATTTGTAAG ATTGTTTTACATTTTTATTTACAAGGAGTGTAACCTTCACAACTATCATT ACTGTCAAATTAGATCATGTCAAGTGAAGTATTTTATATCTATTCCTTGT AGTTTACATTCGTGTATGGCCACTCGATGTATGAGGTTGGAGTTGGAACT TCCGTACGGATTTCTTTCTCTGTGTTGGGACGGGGGACGATGTAACACTT TCACTTTTACATGTAGAGTCCATGCACGTAGAGGGACGGGGGGACGATAA AACACTTTCACTTGCAGACCAGTACTCCATTGCTCACGGCGGGAACTGTC CGGCGCGAGCGTGTGGAACTCTAACCGCGGCCCCCCGGGAGCGCCGATAT TGACCCAACAGGAACGGTTAGCTTCCCGCGAACGTACCGGTCGCCATGAG CCGACACCCGGCAACCCTGCTGCATCTGTAAACAGCAAGGATCAATAATA TTGATCCTGGCATTGGTGTGGGCGATACCCACACTGGTGGGTAACCCTTC ATAGTGTTGTCAACACTTCACTTTACTTTCACTTTCTTTGTTCAGTCAAG TCACGTACAAGTCAGGCCAACTTTGACCTATTTTCAGGTAATCTACAATA TTTCTTAAAAACAAAACGGCAATAATAATAATTGACATACTCCATGCACT AGGTTTCCTTGGTGATGTTTCCATGGCGATGTGGAGGCTGTTGAACCAGA TAAGTTTCTCCTGTGTTTGCTGTCAATGTTTCCATGGCGATGTTTCCGTG GCAATGTTTTCATGATGATGTTTCCATGGCAATGTTTCCACGGTGATGTT TCCTTGGCGATGTTTCTGTGGCGATTTGGAGGTCGTTGAACCAGATAAGT TTTGCCTGTGTTTGCAGTCGATGTTTCCGTGGCGATATTTCTGTGGTGAT GATTTCCCATCGACACTAATCCTGCCTGAAATGCCGCTATAGATTTCACA AGCGCCTGCCCAAATAAGGCAAGCCCCCATCACTGTTGCACCAAATCATC AATACTGCAGGAAGGAGAAATAGCTACATCTTAGGGGTGATCCATTATAT ATGCACGGGGGGTTCTCCATTTTACATGGGGAGGGGGAAATAGCTGCATC TTAACCATTTGAGACGATTGCACTGTAGATGCTGGGTTTCCATGACAACA GTAGTCCATCTGTGGTGCTGTTGGAAAATGTTTGAGAAGATTGTACTGTA GATGCTGGGTTTCCATGACGACAGTAGTCCATCTGTGGTGCTGTTGGAAA ATGTTTGAGAAGATTGTACTGTAGATGCTGGGTTTCCATGACGACAGTAG TCCATCTGTGGTGCTGTTGGAAGATGTTTGAGAAGATTGTGCTGTAGATG CTGGGTTTCCATGACGACAGTAGTCCATCTGTGGTGCTGTTGGAAGATGT TTGAGAAGATTGTACTGTAGATGCTGGGTTTCCATGACGACAGTAGTCCA TCTGTGGTGCTGTTGGAAGATGTTTGAGAAGATTGTGCTGTAGATGCTGG GTTTCCATGACGACAGTAGTCCATCTGTGGTGCTGTTGGAAGATTGTGCT GTAAAACATTGATGAAACGTCAGGCACAAACGCCGCCGGGCTCACAGAAA TCCCACCTGACCTCTGACACGACCGACACAAATGCCGCCGGGACTGCGGG AATCCCGCCTGACCTTTACATGACCTTTGGATGGCAGGACTGATTGACGG GTGAGCGGGTTCAGGGTTGTCATGACGATATGGGGTAAAAACCACGGGTG TAGCTACAGTTTACCACAGGGTTATGAAAATATGGTTACATGAGGTAAAA CCCACAACTAGCCACAAACCAGATTTGTAGCAAGTTGTGCTGTGATGTCA ACCTAAATGCTACATCTGTAGCAGTTTGTACTGCATGTCGGCCATGACAG ATTCGGCCTGGTTCGACCTCCATCAGTTTTAGAAAGTTTGATTACGGGAG AGATTGTCGCAGGGTCTGACTGATGCGTTAGCTTACCGCGGGAACCTCGC TGTAATGAAATCTCTTTTCTAACATCATTCAGCAGGCAAAGCAGCCACTT CCATGGCTCACCCCGTTTCCATGGAGATGGATGCAGCCTCCTCCATTGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCGCTACAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCGCTACATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGCAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGCAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGG CTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCC ATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCAT GGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGG ATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCC TCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCAT GGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACC CCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCC ATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGAT GGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAG CCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCC ATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCA CCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTT CCATGGAGATGGATGCAGCCTCCTCCATGGCTCACCACATTTCCATGGAG ATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGT AGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCT CCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCT CACCCCATTTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCAT TTCCATGGAGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGG AGATGGATGTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGAT GTAGCCTCCTCCATGGCTCACCCCATTTCCATGGAGATGGATGTAGCCTC CTCCATGGCTCGCTACATTTCCATGGAGATGGATGCAGCTCACCCTGTTT CCATGGAGATGGATGCAGCTCACCCCATTTCCATGGAGATGGATGCAGCC TCCTCCATGGCTTGCCCCATTTCCATGGAGATGGATGCAGCCTCCTCCAT GGCTCGCCCCGTTTCCACGGACATGGATGCAGCCTCCTCCATGGCTCGCT ACATTTCCATGGAGATGCATGTAGCCTCCTCCATGGCTTATCCCGTTTCC ATGGAGATGGATGTAGCCTCCTCCATTGCTCTTTCTGTTTCCATGGTGAT GGATGCAGCCTCCTCCATGGCTCACCCCGTTTCCATGGAGATGGATGTAG CCTCCTCCATTGCTCTTTCTGTTTCCATGGTGATGGATGCAGCCTCCTCC ATGGCTCACCCCGTTTCCATGGAGATGGATGTAGCCTCCTCCATTGCTCT TTCCGTTTCCATGGTGATGGATGCAGCCTCCTCCATGGCTCACCCCGTTT CCATGGAGATGAATACCGTTGCCATGTGAGGAAAGTGATCACTGTAGGTA CATAACACTAGTACTGTGTCTGCCCGCTGAAAGCCACCAGGAGTCAGAGT GTTCCTCTTTGGCAATCAATGGGAGGTCCTCACCCAGTATAGCCCCCCCC TTATGATAAATGGGGGGTCCCTGCCCCTAACCCCCCCTTATGATAAATGG GGGGTCCCTGCCCCTAACCCCCCCTGATGATGAATGGGAGGTCCCTGCCC CTACCCCCCTTATGATAAATGGGGGGTCCCTGCCCCTAACCCCCCCTGTT GATGAATGGGAGGTCCCTGCCCCTAACCCCCCCTGATGATGAATGGGAGG TCCCTGCCCCTGCCCCCCCTGATGATGAATGGGAGGTCCCTGCCCCTGCC CTGCGCTAAAGCCGAATCGATAGCTCCCAATGGGGATGAGCCGCGATAGG AAAATAACTGCACAGTTTATGGTTGGGGGGATTTATGCTGGGCCCTTTGT AACCCTCCCGTTTCCCCGAAACATGTGCAGAAATGATGATAAGGTTTCTC TGGCTGCAGATTTCTGCTTATGGCGCCGTTTTGGGGCTGCATAATGCTGT TTTCTCTGGTAAATATGAATTTCAGGGTAAAGTGCCCATTTGTGGTGTAA ATACAGTTTTCATGTGTAAAATGCCACTTTGTGGTGTTTTTCGGGTAAAT GCGGGTTTCAGTGTAAAATGCCCATTTTGTTCTACAGATAAAAGCCATCG CCTGCAAACACGAGTAGTAAAAAATACTTTCCACCAATTTTTCACAGAAG GCAGATTTTCCCTGCAGTGTGTAAATATTCAGGCCTTCTACCTCCAGCCT TTCCTCATGTTTGGGTGGAGTTTGGTGTCTACTCTTCTGGTGTAATTTGA TAGCTCTGCTGTGATGTAATCCGAGTTGTCTCCCGTAATTTGCTCCAGTG ATAATTACAGACTTGCTTTGACCTGGGAGATTTAGCGGAAAGATCGGCTG ATAGACTGAGACCTTGTTCCTCCATCTGTGGTGATAAAGTGGCGAACTTC TCCCAATCCAATTTAGCTATACACTTGTTCTTGTTCTGCGGCGAGAAAAA GATGCAATTTTCCATTCCCTCCCGTCTGCTCCAAGGAAACCCTCCGGAAT TTCATACAAATTCCCTCATTTCTACCTCTTCAGCCTCTAATCAGGAATTT CAGGCGGAATTTTCCTCCCAGCTTGTGCTTTAACTGCGGTGATATTCCGC AGTGCGAGGAAAGAGGAATGGATTTTCTAGTCGTCAAGTCGGCTATCAAG TCTGATCTTTATAGAGTAACTAATTGGATAAACTCAGCTTTATTTTTAGT GGACATAAAAGATCTGCGCATGGCTGGTGTCTGTTGGTTTCCTCACTCCT GATCCCCCTTGCACCCTCAGAGGAGGGCCTGCATGGGGGGGTCCCGACAA CACTCTACGCTAAATTCGGAGGGCCAGCTACGTAATACGCTAAATTCAGA AAGCCTCCCTACGCTCTACGCTAAATTCAGAAAAGCCTCCCTACGCTATA CACTAAATTCAGAAAAGCCTCCCTACGCTCTACGCTAAATTATGGAGTGG TCGGCAACGCTCTACGTAAAATTAAAACGGCCGATTACGCTCTACGTAAA AGGGGCATGCAGGCCCTCTCAGAGATGTAAAAATCACCTGCCACGATATA AAAAATTGTAAGAAGGGTGGTGATATGCCGGGGTTCTTTTGGAATGCTTT AGAGGATGCTGCAAAACTAAAGGAAGTATGACTGAAGTTTTCTGCATCAT GCAGGAAAGGCAGAGAAACTTTCGGTGTTTGAGTGATTTCCTCTCTCCTC AGCGTACTTCCATTTTGCACCAGGGCTGTCTCCAGCTTGATATCTTTTTC TGTCCCACTTATTGTTTGGTAGCCGATTTTGTAATTTTCATTGTTGAATG TGTCATTTTAAGCTAAAAAGAAAATACATTTTTCATCAGTTCTATCTCAC GAAATGGATATTTTTTTTCCGTTCCAAGAAGCAAATTTCTGTCCTTGGAC GGAAGGACGGGTCCTGGAGACAGCACTCTGGGAGATCTCCTGCTACAACT GAAGTTTTAATTTCTGCATCATGCAGGAATGACAGATCTAGAGAAACCTT CGGTGTTTGAGTGATAAACTTGGTAAAAAGCAGAGGCTCCAAACCTGCCT GCCATGTCCCGTGGAACTGATACGACGACTTTTGTGTGAGGAGTTGTTGT TTGAATGGGTTGGAGCCTGGACGTTGTATCTATAGGGAGAGAATCGGCCC TAAACAACCCGAGTAGTTCCGCCCTGTTTGCCTGAGATAAGGAAATTGCT GGTGCTGATTAGCATAAATTTGCATCAGGAGTCTGCTGAGTTAAGCAGGT TGTTGAAATATGTGGCTTACGAATTTCCCGTAAAAGGTCGAGAGAATGCT TTGAATTTTTTTTCTGTGTCACATTTGTTATACTGTAACTTAATTTTAGC TTATTTAACGGTCACTAATCAACTGCTAAAACTTCATTATCGCAAATTTT TGATCACTAATATTTGAGACAGTAATGTTTGTTCCCACCGTTAAAATTAA ATTCAGTGAACTACTCCCTTTCCCCCCAACCGCTAAAATTACTGACCGCT ATATTAAAGTGATTTACAGTATTGTGACATGAAGGTTTGTTGTGGACATG TCTAGTCATGTGTGTTTCATTGAGCAATTGATAGACGCAATATTTTAATT GAGGAGCAGATATCTTAAAGAAGATTGCATACATCTTTAAAAGGCGCCAC CAGGCGATATGTATTTCTGGTAAATAAACAAATAAAACAACACGAATTAA GCAGACTGCATACATCTTTTATAATTATGACAAAGTTTATTGCAAGTACA AGCCTGAGGGCTGATTGCAGGTACAAGCAACACATACAATAATGAAAAAC TATATGATATTAAGGGCTATATCCAATGTACATGGTGCTAGTTTTGTAGG TTTTAACTTCTTCTTTTGAGGTAGACGAATATACCTACGTCTTTTAATAT CATATGTGGGTTCTTTGATTTTAAAAGTATACTGTTATCTCATGGTCAGC AATAGTGGGAAAGTAAGAATGAATTTTGGACACGCTTGTACATAATTGCT TACGTTCTTATATCCTCATAAAATGTTGAGATGCATACACCTTTAAGCAG ATTGAACACACCTAAACCAAACAATAGAATGTCTGTTGGTAGTGAAGATT GTGTTTTGTGCTGCTCCCCATGCTGTCAGTCTCGTCAGTTCTAAAGTGCT CATTTTGCTCCTGGCAGGAAACTGGCAATTAATCCAGGCTAAGACGGAGT TAGACATTATATCCCGAGTTCCCGGAAAATGAAAGTTCTTGTTGCACAAC AAAGGACTATCCTGCCGGCATGAGTCTTAAAGTTTCCTAACATTGAAAAC CTTTTAATTTGTCAAAACAATCGGCAGTCTTTGATACCTTTTATTACTTT AACAGTTCAGAACAAGCGTCTTTTAGGAACCTTAATATGCTTTGCACATG ACTTAGTTTTATTGCTACATTCTGTAGAGGGTTCAGTATCTAATTATTGC TACATTCTGTACAGGGTTCAGCATTATTGCTACATTCTGTACAGGGTTCA GTTTTATTGCTACATTCTGTAGAGGATTCAGTATTATTGCTACATTCTGT ACAGGGTTCAGTTTTATTGCTACATTCTGTAGAGGATTCAGTATTATTGC TACATTCTGTACAGGGTTCAGCTTTATTGCTACATTCTGTAGAGGATTCA GTATTATTGCTACATTCTGTACAGGGTTCAGCATTATTGCTACATTCTGT ACAGGGTTCAGTATTATTGCTACATTCTGTACAGGGTTCAGCATTATTGC TACATTCTGTACAGGGTTCAGTATTATTGCTACATTGTGCACATGACTTA GTATCATTGCTACATTCAGTACAGGGCTCCTTATCATTGCAACATTCTGC AAATTGCTACTTCAGGTTTAGCCTTGACTGTTTCTTCCATTTCCAAACTT AGGAGAGAATAAAAAAACAACTCTTATCATTGCTACATTCAGTACAGGGC TCCGTATTGTTGCAACATTCTGCAAATTGCTACTTCAGGTTTAGCCTAGA CTGTTTCCTCCACTTCAAAAGCTGGGAGAGAATAAAAAGATGAAAAAACT CTACTCTATCATTGCCACATTCAGTACAGGGCTCCGTATTGTTGCAACAT TCTGCAAATTGCTACTTCAGGCTTAGTCTTGACTGCTTCCCGCATTTCCA AAGCTGGAGAGAATAAAATAAAAACAATTGGCTGGAGGAACGTTCTGATC CCTTTTCATTACCGGCGTCGCAGCAAAGCTCCTCATCTTAAGTTGGGGGC TTAAGGAAGCCCAACGGACGGGAGTCTGATCGGAATCTCGCCTTTCGGGT CCTTTATTTCAGGCAAATTGCTCCCCGCATGGCAATCATGCTGCGACTCA CCCTGATGCTACTAATGGGGGGGGGGGGNGCATGGCAATCATGCTGCGAC TCACCCTGATGCTACTAGGGGGGGGGGGGGGGGCAATATCGTTTGTTGGT TCTCAGACCTACAAAAGAGGCCTGAAGTCAGTGGAGGGAAAGTCAGACTC TGTACTAAATAATCACCAATGAACCAATATGAAAACAGAGTCAGATGGGA AACTTTGTACTAACTAATTATCAATATGAAAACAGAGCTCAGAAACCAAT AAACCAACCTGAAAACAGAGTCTGAGGGGAAAGTCTATGCTAGATGATTA TCAACATGAAAACAGAGCTTAAACCAAAAAAACGACATGAAAATAGAGTC TGAGGGGAAAGTCTGTACTGAATAATTGCCAATCAGCCAATAAACCACAT GAAAACAGTCTCAGAGGAAAGGCTGTACTAAATTATCAACATCAAAACAG AGTTTTAAATCAACAAACCAACATTAAAACAGAGTCAGGGGGAAAGTCTG TTGTAAATTACTATTAACTTGAAAACAGGGTCTAAAAATTAGGGGAAAGT CTGTGCTAAAGAATCTTTAGAATGAGAAGTTAAAAGTCAGAGGGGAAAGT CTGAACTTTAGTGTGTCATCTGATCCCTCTGCCCTCCGTCTTCATGTTTA CCTCTTGCTGAAATTTTATTTGAAATTGTCTGAGAAACAGGGAACTTAGC TGGCATGGCCTAAGCACTCACACACACAATGGACCATTTTGTCGTATCCT ACCTCACCATATCGACCCAGCGGTACATTGCCATGACAACTGGCCGAGAT TTACGCCAGTGGGAATGTTTCCCGGGACGCGGGGATGAATATCCCGTCAG GAGAGGTATCAGGTTACAGGATTTAACGAAAGCTTTTGTTCTCACATGTT ACCATTCTAGTCAGCTTGCTTTTTGATGTGTCTTTTCTGTTTGTGTCAAT ATTCTAGCAAACAAAGTGTCTGTTTGTTTGAGTTTCCCCATATTTTAGCA AACAATAACTAGTGAAGCAATGGATGGATTGTGATGATGGTTGGTGGGAA GACAAAAGTCAAGGTCGATGAAGGGCTTCAAGATTGTTATCGATGATGAT AATAACCAGACATAATTGTAAAAAGGTTGGTGTAATATAGGCACAGAGAG GCCCAGAATGGGGGTTTCTGGAGACATGTTAGTGTGATATAGGTGCAGAG AGGCCTAGAATGGGGGTTTCTGGAGACATCTTAGTGTGACATAGGTGCCG AGAGGCCCAGAATGGGGGTTTCTTGAGACACCATCGTGTAATATTGGTGC CGAGAGGCCCAGAATGGGGGTTTCTTGAGACACCATGGTGTAATATTGGT GCAGAGAGGCCTAGAATGGGGGTTTCTGGAGACATGTTAGTGTAATATAG GTGCAAAGAGGCCCAGAATGGGGGTTTCTGGAGACATGTTGGTATGATAT AGGTACTGAGAGGCCCATGAACGGGGTTTCTGGAGAAATATTGTTTTGAT GAATGTAATGTAGCATGTATCGTTAATCCATGCGGACTCAGGATGGGGGT CAATACTCCATGATATGCAGTAATAATCAGTAAACAGCCCGGGGGGAAAC TCCTCACTTCACCTGTGGTGCAGACAAAATCTGCCGCTAAACTTGCCACA AAAAGTGCCACAAATTATCTCACAAAACTGCCACAAAAGTGTCCCAGGAG AGACTGCTCGCTTCACCTGTGGTGCATGTAGACAAAATCTGCTGTGAAAA CTGCCACAAAATCCGCCACAAACTATGTCACAAAAATTGTCACATTAAAT TGTGTCACAACAGAAATTGGTCTGAGGGAGCCTGCTCACTGCACCAGCAG TGCATGGAGACAAAATCTGCTGCAGAATTGCCACAGAATCTGCCACAAAC GACATACATGTCACAAAAATCACTACTAAATCTGCCTTCCTTTCTGAGAA TTGTGCTGCTTATGCCAAGAAAATACGTAACATCGTCATCAACATGACCT TCATCAGTGTAAACAGCACAACACCATATGGTGTAAACAGCTCACGACCA TATATGGTGTAAACAGCTCATGACCATATATGGTGTAAATAGCTCACGAC CATATACGGTGTAAACAGCTCACAACCATATACGGCGTTTGTCTGTTTTA TCTGGTGGCTCATGTTAATGTTATTTCATGCATTGTTATCTGTATCTATT CAGTAATCAGTAGTAATAAAGACTCAATCATATTCTTCTATCTGTTGGCT AATGTCAGTTTAAAGACATGAGACTAGGGACAGATGAGACGCCGGGGGAA GCATAGAAAGTTCTTAAGTTGCAGACAAGCAGTAAAAGTTGGCCGGTTGT TATGGCTGTGGCCTTGGACTGACTGTTTAGTCGATACAGCGGGATTTTGT TGAGCTTCGCGGGACACAAAAGACATTTCTGATCACCCCATGGTCGTTTG GCACCGATGGCTTTGCCATTGCTCTGGTTTTAATGTGCGTAATATCAATA CAAGCTGGGCGCATCGCTCCACTAGCAAACTGCTCAATTTGGCACCGGAC CAGCCCCGGCAACTGGTGCCGTGGGACACAGGATCAGTGGGGCTCTATAG AACCGTGGATGTTCCTGTAGGGTTCTATAGAACTGCAGATGTTCCTGTGG GGTTCTATAGAACTGTAGATGTCCCTGCGATATTCTATAGTACTGTACAT GTAGATGTCCCTGTGGGGTTCTTTAGAACTTTAGATTTCCCTGTGGGGTT CTAAAGAACTGTAGATGTCCCTGTGGGGTTCTATAGAACTGAAGATGTAC CTTTGGTGTTCTATAGAACTGAAGATGCACCTATTGTGTTCTACAGAACT TAGCCTAAAATTCTGAAGAACTTGTCCTTGCTTTCCACCTTGCTTCTCCT TAGCAGCTGCAACAATCTTAAACTTACTGCTTTCAATCTTGTAGATGTAT TTCCCAAGACACATGTGCGTCTTATCTCCTCTTATCTGCTCTTACTGTAA ATCACTTTAATATAGCAGCAGGAAAATATAGCGGTTTGGGGAAAATGGAG TAGGTCACTGCACTTAATTTTGACGGTTTGAACAAACATTACTGTCTCCA ATATTAGTGATCAAATATTAGCGATGATGAAATTTTAGCGGTTGACTAGT GTCCGATAAATCAGCTAAAATGAAGTTACAGCTAACAAATCAAGAATAAC AGTATCTGGTTGAAGAATGGTTCTTGTGTCTCGCCTGCTGGAAGACGTTA GCAGGTTTACTTAAAGACGTTGTTGGCCTTGAGGCACTGCTGTTAAAGTG ATATCCAGAATCTTAATCTTCAGCCTTAAGGAGGTGGCAGAGATCTTGTG TGTTTTCTTGTTTAATTGAAGATGTTGCGAGTTTCTTGGCTGATTGCAGA GTTCCAGAAAGCTGATTTCCCAGAAGTTTAATCAGGCTACGAGGAGGTGA TCTTCCCCTGCCGGCAACTCTGCCTCCGAACCATCGTAAAACAGCCAGCG ACAGGGCTTCTGAAGTAATTTAAAACTTTAATATATCAGTACTTAAGGAG CAATTTCTGCTGTCTGAGGAGGTTTGAGATGTTCTTAGTTATTCTCCAGG AGAGATCGTAATCTTGGTTTCTGGTCGAGTGGAGAAAACAGGAGGAGGGC TGGGGGCGAAGTAAGATCTTGTTATAACAAACAACTAAACTAGACTCCAG AACTTTGCATATACAAACAGCTAAGCTCCACTCTAGAACTAACAAACAGC TAAACTAACTTAGCTTGAAAGTTCATCTGTGTTGGTAGAAATCATTCTCA TACAAGTTTTAACTGTAACTTACTCCTTGACAAAGACCGGTTTTGTACAG TCAAAAATTTAAGTAAGTCCAATTTTTGTGTTGGAAATTACAGTTAAAAT TTGTTTCAAAACAGCTAAACTATACTGCAAATGGTATGTTTACTTCATTA ATCACCAATCAGAAATACCTTTCATTATGCTCAATTTCTCTGTTGTGTCT CCTACTACAAAACAAACAACACGTAAGAATAGCCCATAATGAAATGTTGT CATACCTGAACCTACATGTAAGTCACATGATTGTGTTGCTTTGCTCTACA AGACTCAGCCCAAAATGCTTTATTTAAAAGACTTGCCTTGTCTTGAGACG TTGTGTCCTTGGGGGAAAGTGGCTGGTGCTGGATATTAGTGGGCAGATTA ATTCCCCTCGTCATGAATCTCCCCCAACCCTGCGTACCTGACAGTAAAGT ATGGGGCCGGAGAGTGACCAAGTCAGCGGATCGATGCCGGGTTCTTTGAT GGAGTTTCTTCATTTCCTTTAAGTGCGCGGCTGTGTCCTGTCAATACCGG GCAACGGATCCATTAGTGAGACATGCCAATAGCACACATGACGTCTGCTT TCTTAATAACCTTATTGAACTGGACATTCCGGATACAGGAGATGCCAATA GCACATGATGTCTGCTTTCTTAATAACGTTATTGAACTGGACATTCCGGA TACAAGGGGATATAGAGGGGGGTACTGTAACTGCAGAAATATTTGCGGGG ATTTGATTTCGTGGTAGGAAGAAAATTGAGTGTTTGCAGTGGTTTTGAGT GTGCGTTTGAAACAATAGTAGCACTACAGTCACACAATGGAATGGCTTTT TGCGGTGGTTTAAAGTTTGCGGTAAAGAGTTCACTGCAAAAACCCTGAGC ATAAAACCACTGCGAACATTTTTGCATTTTCAGTATCTCACTGGACCCGC AGCACGTTGGGGACCTCGCTGCAACCAAGTGATTTGGAAGAACGCTCAAC AAATTTCATTCTTTTCACACTTTGTGTGCTTTGTTGTCTTTTTAGTCATA CTAGAGCATTTTGCAGGATATTCTTGTTATCAAGTCAAGGGTAACATAAA TCTAATTTAGGTCGCAGCGAGGTTGCCAAGTGTCGCAGTCCAGTGAGACA CACACTTATCTATCTTAATACAAGGGCATATAGCTAACCTGATATAAAAT GCTCACATGTCAAAAGCTGCTTGTGGAGAAAATGTAGGTTACTGAGAGAT GGGCCTTACAAGGGCTTCCGTCTTTTTCATGTTTTATTGCAATTAGAGAT TGCAAACCTCTATCCCCCAGCAGAACATGCCGAATTGCAGTGCTCCCTCT GGCAGAATATACAGGAACTGCAGTGCTCCCTCTGGCAGAATATAAGGAAA CTGCAGCAGAACCTCACTACTACTATTTCAGCACCAGGGACAGACTCAGT TGTGAAAGAGATGTACAGTGTCATGCAAATGGCTGTTTCAGCAGTAGGAA CAACCTGAAGCGTATTTAGACCATTATAAGCAACATTGTGGCACACTTGG ACACTTGTAGGCATTGTACAAGACCTTGTATAAAACTGTACAAAACATTG ATTAAAAAGGCTCTTTGTACACAACCAAGTTTCTTATTCCACCAACATTT TGGTGACTGTCACTTTCCTCATGGCAGTTGTGAATGGTTCACATTGCACT GCAAAAATAAAGTATCAGCAAATATACACTTGGTTGCAAACAAAGAGTAT TTTTATCCAGTGACTTACCAACCTGATGAACTATTCACGGATGTACGAAA CATTGTTATTTGAGCCTGACCATGCTGTCCTTTTTTCCACATGTACTGTC CTGGTAACTGCTGTGCTGACTTCTTGCTGTTCCATCCGAATGACCTCTGT TGTGCTGTCGTGGCTGGTGTGCTGTTCCCTACTGTCCTCCTGTGCTGTGC TGTCTGATGGACAACTTCCCATCCCTGCATATCACAGGTAAGTCAAACCT GTTGTTTACATTGTGTGGAAAATGTACCTGTAAGTCTTAGTTAGGGGCCA TCTTACAACAGATACTGGATGAAGATGGCCCATCTCAAAATGCACACTGC TTGGAGCTCTTGTCAGTTTGCCTCCTGCAGTAACACTGGACCCATGGGGT CCTCTTTTCTGATACAATGGCGGGGGGGGGGGTCCTCATTTCTGTATAAA TGGGGGTTCCTTAAATCTGAACCAGTGGGTAGAGGGTCTCAATTCTGAAC CAATGGGGAGAGGGGTCTCAATTCTGAACCAATGGCGGCGCTCCATATGA ACCAATGGGGAGAGTGGGTCTCAATTCTAAACCAATGGGGGAGGGTCTCT CAATTCTGAACCAATGGGGGAGGGTCTCTCAATTCTGAACCAATGGGGGA GGGTCTCTCAATTCTGAACCAATGGGGGAGGGTCTCTCAATTCTGAACCA ATGGGCTGTCCTAAAAGTTTTTCACCCCATGTTACAAATAGTGTGGCTGC TTATCAATTGTTAGTAGAATGTAGATTGAGACTTTATAACTCTCCACAGG TGAGTAAAATATTTGGTTTACATTGTGATAAAAATGTACCTGTGACCATG GTTAAGAATGTATTATACAACTAAGACATCGTTGCGCTTAATACACCAAT GCAATTGATGTTTCCCTCCTTCAAACACCCAGGTAATACAGACAAGTCCA TATTTCCGATTAATAGATATCTAACTATTGATTATAAGACATATCTTTTC TTACACATACATACAAACAACATCACAAAGAAGCGAGCAGTAGTCAAATT CACTTCCTGGACTACTTGTGCTAGCTTGACAATGTATTGGTCTGTCAGTA AACTATTCTTTTGCTTGACCCATACTCAATGCAGTTGGCATAGTACTGTA GTAGTAGTGAACTTGCAGTGGTCTGAACACCCTGCAGCTGCAATCAGTCT TTCTTCAAATCTCTCCAGTTCATCGCAAGCTTCCTTAGTTTTCTTTCTGA CTGCAATCCTAGTCCTCTTTCATTCAGGTCTGCCCTCAGTAGACTCAGTA GGTTCTTGCAGTGTCTTCCTTTTCTGTGGGCATATATGTAAATGGTCTTC GTTTTGTCCTAATTCATTTTAGTAATGCTGAAGAAGAGTGATGGATGTCA CTCAAAACGTCCGCAATTAAATCTCCAAATTTTATCTAGTTGTAGAGTTT GATTTGACTTTATATATTGTTTACCTGGATGTCTGACCTTCATAAACGTA CTATTTTTGGTGTAAATGGTCTTCATTCGCTCATTCATTATATGATATCC AGACGTCAACCCTCCTCCTTAAGTAGGTGATAGATGTTTCACACCTGTAG TTATCTCTGTCTAAGGTTCACCCCGACAGATCTATCTAGATGATGCACCA GAGTAGGTGATGTGTCTTCATTAACCCAGAGGTCCTGAGAACCATTTTCT AACCCCTCCACACACGTGGGACTCCTGATGCTGCAGTATCAGGTCAGTGG GTGGGCTGGTTTGTAAGTGTGATCCATCAATTAGATAGCGCTCTGCCATA AGGACCATCAATGACTCTGATAGCGTTCTGCCATAAGGACCATCAATGAC TCTGATAGCGTTCTGCCATAAGGACCATCAATGACTCTGATAGCGTTCTG CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNCTCTCAATTCTAAACCAATGGGGGAGGGTCTCTCAATTCTGAAC CAATGGGGGAGGGTCTCTCAATTCTGAACCAATGGGCTGTCCTAAAAGTT TTTCACCCCATGTTACAAATAGTGTGGCTGCTTATCAATTGTTAGTAGAA TGTAGATTGAGACTTTATAACTCTCCACAGGTGAGTAAAATATTTGGTTT ACATTGTGATAAAAATGTACCTGTGACCATGGTTAAGAATGTATTATACA ACTAAGACATCGTTGCGCTTAATACACCAATGCAATTGATGTTTCCCTCC TTCAAACACCCAGGTAATACAGACAAGTCCATATTTCCGATTAATAGATA TCTAACTATTGATTATAAGACATATCTTTTCTTACACATACATACAAACA ACATCACAAAGAAGCGAGCAGTAGTCAAATTCACTTCCTGGACTACTTGT GCTAGCTTGACAATGTATTGGTCTGTCAGTAAACTATTCTTTTGCTTGAC CCATACTCAATGCAGTTGGCATAGTACTGTAGTAGTAGTGAACTTGCAGT GGTCTGAACACCCTGCAGCTGCAATCAGTCTTTCTTCAAATCTCTCCAGT TCATCGCAAGCTTCCTTAGTTTTCTTTCTGACTGCAATCCTAGTCCTCTT TCATTCAGGTCTGCCCTCAGTAGACTCAGTAGGTTCTTGCAGTGTCTTCC TTTTCTGTGGGCATATATGTAAATGGTCTTCGTTTTGTCCTAATTCATTT TAGTAATGCTGAAGAAGAGTGATGGATGTCACTCAAAACGTCCGCAATTA AATCTCCAAATTTTATCTAGTTGTAGAGTTTGATTTGACTTTATATATTG TTTACCTGGATGTCTGACCTTCATAAACGTACTATTTTTGGTGTAAATGG TCTTCATTCGCTCATTCATTATATGATATCCAGACGTCAACCCTCCTCCT TAAGTAGGTGATAGATGTTTCACACCTGTAGTTATCTCTGTCTAAGGTTC ACCCCGACAGATCTATCTAGATGATGCACCAGAGTAGGTGATGTGTCTTC ATTAACCCAGAGGTCCTGAGAACCATTTTCTAACCCCTCCACACACGTGG GACTCCTGATGCTGCAGTATCAGGTCAGTGGGTGGGCTGGTTTGTAAGTG TGATCCATCAATTAGATAGCGCTCTGCCATAAGGACCATCAATGACTCTG ATAGCGTTCTGCCATAAGGACCATCAATGACTCTGATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATC AATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGC GTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGA CCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTC ATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCTGCAAT AAGGACCATCAATGACTCTCATAGCGTTCTGCAATAAGGACCATCAATGA CTCTCATAGCGTTCTGCAATAAGGACCATCAATGACTCTCATAGCGTTCT GCCATAAGGACCATCAATGACTCTGATAGCGTTCTGCAATAAGGAATCAC ACTTTTGATGTTAGCTTTTTGTCACAAGGAAGGAGAGTTGTAGTGTTTTC TGGGCAGGTTCATTTTATAAGCAGTGACTGTCACTGACGAAAGACAGCGG ATAATGTCTGAAACGCCTAAAAGTTCACAAAACGTGTCCAGTTGCTTGAG TAACTTGTGTGTTGAGTATCTGCACATGTATCTATATAGCTGATATAATC GCCCTTCAGCATAACAGACCAGCTTTGCAAGCACGCGATGCACAGTAGCT GATTATATCACACTGAACGACCTGTCACACCTAACCTTTGCACATCTAAC TGTAAGCACTGTTTAAAGCTATCTGGTGATGTTCCTTACTACCTGTATCT CTTACCTTCATCAATGTATCAAAGCTTCTATTATTTTCTGGGCAGATATT CATTAAAATAATATGAATCATTACCTGTAACTGTTAACCATATCCTTAAT GGGGGTTCCAAGAGCATGCTTGTGTCAAGAATACCAATCACACAGACTAT GTCACATAAGATGTGGAGCAAATACCCCCAGGTTTGGTCCTGGACTTGTT AAGTTATGGAGAGAAGCTGCCTGGGTCTCCCCTGAAATGACTCAACTGAT CCTCGAATAATTTCATACCCCATCTGTAAGCAGCAACGCCTGTGCTGCAT TGCAAGCCCTTGCCAAACTGTTGTCTAATGTAGCATTAATGCCAGAAATA CATATGCAGCACTAATGCTTGGTTAGTGCACACTGCCATGGTAATTTCAT GGTAATTATGGCTGTCCAAAATCCAGCATTAATGCCCAATGTGCTCTGCT AAGGAGCGCGTAGTGCGGCATTAATGCTACATTAGACAATAGTTTGGCAA GGGAGGTGAACCGGTAAACAATTGCCCTGAGGAAAGTGATAAAGGGTCAC TGAAATGTGGGTTGAATAAATCTCTTGGCTGTGTACAAAGAGTATTTTTA TTCAATGACTCTACTGGCGTGTGTGTTATACCCAAGGACGGTTATACATG TACATGCAGGCTATGTAGACACATTGTGATCATTATGTATTATGTCTGTG CATTGTATTTGTATCCAGGGAGCCTGAAAAACAGGTCAAGAGACCTGAGT GTGTCTGCTGGCTAAATGAATAAATGAAATGAAATGAAATACAGATACAG ATACTTGTGTGTGGTTGGAGCACATCAAATCTGTCAGTTGTTCAGAAAAC TGTTGGACAATCCCCTGACATGACACCACGATCTGTGTGGTCCTAGCCCA TCAAATATGTCAGTTGCTGGGCGATGAGGAACTCTCCGGCTCAGCCTGGA GCCTCAAAGGTTTCCGCCTGTCTCATCAATAAGCTCCAAGGTCGCGGAAA TCGATTGTTGTCTGTCAGGGACAGGAAAGGTGTGCTGAAGGATAAGAGTT AAGCCTGGGGCTCAGCGGTCGTAATCGCAGGTACAAACACAGGTCCTTAG GGTGGTTATGGGTTCTAGCCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCTAGCCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACC CCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATG GGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCAAACCCCACAGGCTGGGTGGTTATGGGTTCTAGCC CCACAGGCTGGGTGGTTATGGGTTCTAACCCCACAGGCTGGGTGGTTATG GGTTCTAACCCCACAGGCTGGGTGGTTATGGGTTCAAACCCCACAGGCTG GGTGGTTATGGGTTCTAGCCCCACAGGCTGGGTGGTTATGGGTCCAAACC CCACAGGCTGGGTGGTTATGGGTTCTAGCCCCACAGGCTGGGTGGTTATG GGTCCAAACCTCACAGGCCGGGTGGTTATGGGGTCTAACCCCACAGGCCG GGTGGTTATGGGGTCTAACCCCACAGGCCGGGTGGTTATGGGTCCAAACC TCACAGACAAGTGTTTTGCCTCATATGGATGGTCAGAGGGCATTGATTGC AAAACTTTCTCAGCTTGGCTGATGTGATCTGGGTGTACTCTAAGTGTGAA ACGATGCACGAATGAGGTTGGAACAAGCATGATCGAAGGCAGGATGGCTG GTATTCACACAATACCCTAATGCACAGGATTGACATTTTCCTGCCTCTAA CTTTGGATAAGAAGACAGGAACAGATGAGTTCCGCTCCACACGGATGGGC AAGACCATGAATAACACGGATGTCTCAGCGCTGCTGATGCGCTCGGGGTG TGAAATGATGCATGAATGGGGACGGAATGTTCTACAGTTGATGTAGGTTC TGATTTACAATAGAGGCAGGAGAGCTTCTGCAATGCAAGAATGAAATAAA GGAAAATGACAAAAACCAAATCCTGTGTTAACAAATTGATAAACGTTCCC AAAAGAAAAGGCCTGAGGAATGAATCTTTCTGTGCCATTGATGCACTTTT AGAGCGTGAAACACTGCATGAATGATTTTCAACCATTCTTTTCCAGGTTT AGATGGAGTTCATCCTTTATAACAGAATTATGACACTATATGGGATGCAA GGAGAATTATGCAAAGCTACCACGCTTACCTGTGATGGGAAATAATTAGC AAGAAAAAAATTTGTGCCAGTACTGTATATGAAAAATATTCTTTTGTTAC ACATTGTTTTGCTTCCTTGTAAAAAAATTTTTTTAATGTAAATGTGAACT GTTTTCTATTGTCTTGGCAACAGGTATTGCATGCAAGGAAACAGTTGCTC ATGCAACTGGATACAATTTTGGAAAATTGTCGCTTTGTTTTCACGTGTAC CTGGATGTCTAACCTTCATTGACGTACCAAGTATCCCTAAAGAAGAGTGA TGGATGTCACTCAAAATGTCCAAAAGTAACCTCTGAATATTATCCAGAAG TAGGAATTGAATTGTGTTTGGATATTGTTAACCTGGATGTCTAACCTTCA TCAACTTTTGGCAATTTTGAGAAAGTTGGTCTTCACTGAGTCTCTCTTTC TCAGCTGCGCACCGCAGCCTATAAGGGCCCGTTCACACTTGAGTTTCGTG TTGATACCTAATATAGAACTCCTACGTAATTGAATATAGGAGAAGCAGGA ACGGGCTCTAAGCAACTTTAGTGAAACTTCCACAGTTTATGGGGGAAAAT TGGCTCCATTTAGAGCCGACATCAGTCATGTAAGGTGCAGAAGGTTATGG TTATTAGCGCTCTGTCGACAGCCGACGGCAGTAATTTGATTCCTGCTGGT TTTAATTGTGTTAGAGCTAGGAAATAACAGGACCGGGACGTGACAGCAGC CTCATGTCACAAACAGGAGGGTGGAATTAGGGAGGGCTGCAAAATTTACT GTGCTAGTTCTGGGAGTTTCTGCTTCATTTTTGGCCCAGTCAAAAGCTGG CTCCATTATGAGTCTTAGTGNTCATTTTTGACCCAGTCAAAAGCTGGCTC CATTATGAGTCTTAGTGGTGTTTTGTGTAAATTTGTCCAGGACAAGTTAG TTTAGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTG AGTTTTAGTGGAGTTGATCCCCAGTGTGAGCTTTAGTGGAGTTGATCCCC AGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTG ATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTG GAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTT TTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTG TGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCC CCAGTGTGAGTTTTAGTGGAGTTGATCCCCAGTGTGAGTTTTAGTGGAGT TGATCCCCAGTGTGAGTTTTAGTGGAGTTGATCCCCAATGTGAGTTTAGA GTAAATCCCCAGTGTGAGTTTTCAGTAGATTCAAATGTTCAGGTTCTCAT TCTGGTTCGTCTCCCGTGTGGCTGAGGGTCCCTCCCCACTGTGGAAAGTG AAAGTGTGTGACTGAGGGTCCCTCCCCACTGTGGAAAGTGAAAGTGTGTG GCTGAGGGTCCCTCCCCACTGTGGAAAGTGAAAGTGTGTGGCTGAGGGTC CGTCCCCACTGTGGAAAGTGAAAGTGTGTGACTGAGGGTCCGTCCCCACT GTGGAAAGTGAAAGTGCCTGGTTTTGGGTTCCTCCCCACTGTGGAAAGTG AAAGTGTGTGGCTGAGGGTCCGTCCCCACTGTGGAAAGTGAAAGTGCCTG GTTTTGGGTTCCTCCCCACTGTGGGTGCTATCAGCCTTATCAGCATCAAC AGAAACACTTTCACTTTATCACAAACACTTTCACTTTATCACGCAGTCGT TAAGATTTCTAACAGGAAGTTAATCTGCAGGAAACTGACTTGAGACGCAG TCATAACATCAACTAGCGGGCACAAACAAGTTAACGAGTTGGTTAGTGAT GATTATTTGTTGTCAGATATAGGCAAACAAGTTGGATAGTGTTAAATATT GGGGCAGCTACGAGGTGATTAATTGGTTAGTTATATTTAGTTAGTGGCCA GGATAGTTGAAAAGTGTCCAGGTTAGTTATTAGATGGCCCAGCGGTAGAG TGTGAGATTGAGAGAGACTAGTGCGGTATTATCAGGGCTAATGTCCCACC AGTACTTGGATAGGCGAGTCATCCAGTGATCTAGGCTTTGGATTTTGTAC AGTGATTTAAGCTGTTGTTTTCAGCCAGTGATTTAGGCAGGCATTGTCTG TGCAGAAGACCAGAGCCATAGCACCATTACAGTCGGGTGAAAGTGAAAGT GATCGTTAGGCTTTAATTGTCCATTGTTTGTGCAGAACTCCAGGACCGTA GCACCATTACGGAATGAATAGTTGTCGTGGTGATGAGGAAGGGGTAAGAT TGCAGTTTTATGGGATTGTCTGCGGACGCCGGGCTTAAGCGACAGACTAA TGGTTCGTGACGTCTGCTGGCTATCAAACAGCAATATGCACCAAGGCCAC AGGAACGGGGTGTACCACACAGGAATGGGGGTGTCAGGCTCTGCCACTGC AGAACAGGGGTCGGGCTGTGCCACACAAGAACGGGGGTGTCAGACTCTGC CACCTCAGAATGGGGGTAAGTTACAGACTAATGGTTCGTGACGTCTGCTG GCTATCAAACAGCAATATGCACCAAGGCCACAGGGAGGGGCTGTGCCACA CAAGAGCAGGGGACAGGCTGTACCACACAAGAATGGGGGTGTCAGGCTGT GCCACTACAGAGCGGGGGTGTTGGGCTGTGCCATTACAAAACGACACAAC GGGGGCTGGGCTGTGCCACCTGGGAATGGGGGTCGGGCGGTGTCACCTCA TAACGGGGTGTCGGGCTGTCCCACCTCAGAATGGGGGTCTGACTGTGCCA CCTCAGTAACGGGGGTTGGACTGTGCCACCCTTGAACGGGGTCGGGCTGT GCCACCTCAGAACGGGGGTTGGACTGTGCCACCATTGAACGGGGTCGGGC TGTGCCACCTCAGAACGGGGGTTGGACTGTGCCACCCCAGAATGGGTGTG TCAAACAAGCCCACCTCAGAACAGGGGTGTGGGGGGGGGGTGGTAATGGT CATATCTGTCAGACTTTGCCACCCCAGAACAGGAGTCAATTATTTGTAGA AGACAAAACGATGATCCATTTAAACACAGTTTAGTGTCAGGGAAGCAATG CACCCGTATCAGCCGGGATGATGTTATCTGGGTTTGATCATCTGCCGACA AAATGCCTCGGCTGTCAGTGGGCAGGGTTATTGGTCCCCATGGCAACAGC AGACCTCATTAACTCAGCCTTCAAGTATTCATTTTGTGATAGTAATGCTT TCATTTGGAGCAGTAATGTTTTATTCTGGAGAAGTAAATTTTTTTTCTGA AGAGTAATGGTCTATTATGGAGTGGTTATGCTTTATTTTGCAGTGGTTAT GCTTTATTTTGAAGCAGTAATGTTTTATTTTGGAGCAGTAATGTTTTATT TTGGAGAAGAAATTTTTTTTCTGAAGAGTAATGGTCTATTATGGAGTGGT TATGCTTTACTTTGCAGTGGTTATGCTTTATTTTGAAGCAGTAATGTTTT ATTTTGGAGCAGTAACGTTTCTTTTGGAGGAGTAATGCTTTAATTTAGAT ATGTAACAGGCAGTGTCATTATAGTGGGGCATTACTTTATGGAAAATGTA TCTAATAAAACGTATATGCTAGTTAGAGGTATAAAACAAAAATTAAACTG TTGTTGACTTATTTGAGTTTTTGTCTAAAAACATGTGACTGTCTGTCTGT CTGTCTGATTGTGTGTGTGTGTGTGTCTGTATGATTGTGTGTGTGTGTGT CTGTCTGTCTGATTGCGGGTGCGTTTCTGACTTTGCACAAAGGGAGTGAA TTCTGCCGTCTCTGACTCCTTCCTTGTTCATTAAACATGACTGCCATAAG ATGCAAGATGCCAGACGAGCATGGTTTCAGGTTACCCGAAAGTTTTACAA TCTGATTAGCACTACCGCCTGAGCCTGGAGTTGGCATCTGAACTTTACTT ACTCGTCCGTCTGCATAATTCATGCCTAATGCGATAAACCTTCTCAACAG CAGCAATTACAGCTGTTTTCTCTACATGTTCACGACACAGTGTAGGATTT CTGCCCGCTCTAACAAGCAGGGATTGTTGTTGGGCTTGGGGTTCAATTCC CAGCAGAACTTCTTGTTGTGTTGAAGGGTTCGATTCCCCGCAAGACTTCT TGTTGGGTTTGGGCTCGCTGATGTGAGTTGTCTCCGTACAAACTCCTGAG TCCCGCAGAAGTGCCTGGTCGTAGATGTTCTTGTGAAGAGAAGGTAGAAG GAAGGGCCTTTGGCTTGTTGGCAAGCGGATGCTAAAAGGTTGAGGCTACC TTCACCACAACAGTTGGTGAAGAGAAGACAGAAGGCCTTTGACTTGTTGG CAAGTGGACAAGTGGACACTGAAAGGCTGAGGCTATCTTCACCAAAACAG TTGCCGGGTGCACTACAGACTTTTCCTTACTGCAGGGGCAACTACAGAGT TGGGAAAGGCAACAAGTCGGGTTTCAGTGTCTGACATTATGGATGTTGCA GCCTAGAACATCCCCAACCCAGACGTTGCCATGGCGAGTAAGGACTCCCC AGCGATGGACCCCCTGGAGATCCTGGCTGCGCTGCAGAAGCAAGCAGACC TCAGCCCAAGCTCCAGTATAAGCAGCCGCATGAGTTCACCATTCACAACC GGTTCACCATACACAACCAACTCGCCATTCACAACAGGCTCACCATTTCA AACTGGTCCACCGTTTACAACTGGTCCACCATTCACAATGGCCTCACCTC GACCCAAACTGTGCTTTGACACCGCCGGCCAAACCACCTTCGGACCAGCC GGCGCCACTTTCCTTCCAGCTGAAGCCATCATGTTTCCAAGGCAACACAT CCTTCTGCATGGCATCCCGGCAACCAGACGTGTCACCATGGACACCGTTG CTAAGCTACGGGACGAGCAGGAAGAGGCCGATCTGAAACCGTCGAATTTC GTCCACTTCGCCAACAACTCGACGCTTCACGGGTTAAACAAGGTCTTCCC GGAGGATTCCCGCGGGCTGTGCGTGCAGCGCGCGCTGTGGTTGGTGGTTG TCATGACGATGATGTGCCTGTTCCTGTACTGGTCACTGACGCACATCCTG GTGTACTTCAGCTACCCGGCCGTGACCAAGATCGACGAAGGCGACGAGTC CCAATATTTCCCCGCCGTGACCTTCTGTAACGTGAACAAGTACCGCCTGT CCGCCCTGTCGAACTTGGACTTCTTCCACGTGGGTCGTTCCCTAGGTTAC CTGCATCCCAACAAGTCGCTCAAGGCACCGCAAAACCCTGACCTTGACCT GAACCGGGTGGACGCCATCCGCCGCCTGGCCGACTTCTCCGGGCTCCCCG CCAACACGCAGAACTTCAGCCTGGCCGAGATGCAGGACCGCACGGGACAC CAGCTCACAGACATCGTGCGGAAGTGCAAGTTTCGCGGGAAACCCTGCTG CATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTC GCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGC AGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCC GGTAAGTACCTTTGGCAGGAAATGCAAGTTTNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATGGGGGTA CATTGAACAAATATTAAAAGAATCCCATTCGCACTTTTGGCATACAACAC TTCAAAATACGATTTTAGAGGGTATTTTGGGGAGAACATCGGCTATTTTC CTCATATGGGGTCACTGACCTTTAGGTCACATCTTTATTCATCTGGCCAG GTGGACTAATTCGGTCAGCCAATGAGAGAGCGCGTTTTAACATACACACG GTTTATCAAGCTCAACCTGATTGGTTAGAATATTCAATTTAATTAGGGGC ACTACTAGAACTCTGACAGGTGCAGACAGGCACAACTTCAATACTCCGTG GCTCCCATCCTTGTGTTGTTATTGTTGTATCCTACTGTGCAATTGAGAAG GGTTCAACATGGGCTGGGTGATACATGTTGCATTTGCTCCTGCAAATGTT GCCTTTCTAGTTGCTGATGCTTCATTATATGATGACTACCACACACACCC CATGTACCGTGAATGGCCTTCAGTACTGCAATGTCCATAGACATCCCCCA TGTAACAGACCCCCCCCCCTCCTGTACCAGGGGGTGTATTCGTGATGACT CACCCCCCCATGTGCCATAAGTAGCCGTCACTTCTGTAATGTCCACCCCC CCTCCTGTACCAGGGGGGTGTTTTCGTGATGACTCACCCCCCTGTACCAT GAGTGGCCTTCACTCCTATAATGCCCCCCCTCCTGTACCAGGGGGATGTT TTCGTGATGACTCACCCTACATGTACCGTGAGTGGCCTTCATCCCTGTAA TGTACACCCCCCATGTACCAGGGGGTGTTTTCGTCATGACTCATGACTCA CCACACCACTCCCCCCCCTGTACCATTAGTTGCCTTCATCCCTGTAATGT CCCCCCCCCCCATGTACCAGGGGGGGTTTTCGTCATGACNCGCCATTCAC AACAGGCTCACCATTTCAAACTGGTCCACCGTTTACAACTGGTCCACCAT TCACAATGGCCTCACCTCGACCCAAACTGTGCTTTGACACCGCCGGCCAA ACCACCTTCGGACCAGCCGGCGCCACTTTCCTTCCAGCTGAAGCCATCAT GTTTCCAAGGCAACACATCCTTCTGCATGGCATCCCGGCAACCAGACGTG TCACCATGGACACCGTTGCTAAGCTACGGGACGAGCAGGAAGAGGCCGAT CTGAAACCGTCGAATTTCGTCCACTTCGCCAACAACTCGACGCTTCACGG GTTAAACAAGGTCTTCCCGGAGGATTCCCGCGGGCTGTGCGTGCAGCGCG CGCTGTGGTTGGTGGTTGTCATGACGATGATGTGCCTGTTCCTGTACTGG TCACTGACGCACATCCTGGTGTACTTCAGCTACCCGGCCGTGACCAAGAT CGACGAAGGCGACGAGTCCCAATATTTCCCCGCCGTGACCTTCTGTAACG TGAACAAGTACCGCCTGTCCGCCCTGTCGAACTTGGACTTCTTCCACGTG GGTCGTTCCCTAGGTTACCTGCATCCCAACAAGTCGCTCAAGGCACCGCA AAACCCTGACCTTGACCTGAACCGGGTGGACGCCATCCGCCGCCTGGCCG ACTTCTCCGGGCTCCCCGCCAACACGCAGAACTTCAGCCTGGCCGAGATG CAGGACCGCACGGGACACCAGCTCACAGACATCGTGCGGAAGTGCAAGTT TCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTG GCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACT CCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTTGCGGGAAACCNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCCCATGTACCAGGGG GTGTTTTCGTCATGACTCACCCCCCTGTACCATGAGTGGCCTTCACTCCT ATAATGTCCACACTATAATCAGATTTTCCTGGACTCCAGCTGACTTCATG TCTCTTATAAAGTGGAAATCGTCCCATTTCCCCCTCATTATGCCATTAAT AGCCAATTGTGCAAAGGCCATCCCACCGCACCAAAGAGCATTTAGGGTCG TCAGGAAAACATTAATATGATAAAAACAACTTTATTGCCAGTTCATGGAC AGAAAGTGATAGCTATTAGCCGACTTTCTGCATTTTTAGCTATTACACTT CTGCTGAAAGGCAGGGAGAACGGTCTCTGGGAGAACAGTCTCTGACTGTT TCAAAATCTTATCCAGTTGCTTGAGCAATTATTTTTGGCATATCTTATTA CCTGGATGTCTAACCTTCATCAACAGAACGGTCTCTGCATTGTTTCTTAC CTCTTACATGTGAGGCAGCATGTCTTCCTCAAGGCTCTGTAACGGGTCTT AAAGGACCAGCCACTTCTGCAGGATTCAACGTCTTGGACTTTTGAAGGTG GGGCTGAAACTTAAGCACCTGTTGTACCTAGCAACACTTCAAGACTTGTG AGGGCTGACTACATAACTGCTTCCATTGTGAGAGCCGATACCACTGACAG GGCTGCATTGTGAGCTGAGTCGGTTCTACCTGCAGTTGGACTTTACCCTC CAATGTTGCTGTAAAAGTTGCATTTTGGGCAGACTTCATCTGTTTTCAGG TTGGGTCTGTATTGTGAGAACTGAATAGATACTGACAGGGCTGCATTGTG AGAGTTGAAAGCTACAGGAGTTTACCCTCCAATGGTGCTGTTGTATTTTG GGCAGACCAAACCTGTTTGCAGCTCGGGGCTGTATTGTGAGACCTGGTCC AATACATGGGGCTGAAGACCAGAGGTTTAGGGTGGCTGCGATTCAACGCT AACTCGGGCGACCTTGACACGACTGTGGTCGCCCCTCCCGCTGCGTTCCG CGACCCTCCGCTACCGACCTGGGCTCACGCTGCGTTCCAGGACCCTCGTT TGACGACCTTGACTCCCTCAGACATGAAGCATTCAACCAGCCCGAAACGC CTCCTCATGCCAGCAACACAGCCAAAACTGAAAATTGAGACAAAACCAAA AATTGAGCCAAAGTTGTTAATGGAGGGCAAACGGTCGGATCTGACTCACT TTGCCAACAACTCGACCCTGCATGGTCTCCCACGGGTGTTCCCGGAGCAG AGTAAAGGCTGGGACGTGCGGCGCGGCCTGTGGGCGGTTACCGTGGTTAC GATGATCCTGGTGTTCCTGTACTGGGGCGTGAGCCACATCGGGACGTACT TCCGTTACCCGGTCACCACCAAGCTCCATCTGCAGGAGGCAACCGAGTTG TTTCCCGCCGTCACCATCTGCAACCTGAACACCTACCGAGTCTCCCAGCT GACCCCGGACGACCTGTACAGCTGGGGGGAGCTGATGGGCATCCTCCACC CCAACAGGACGCTGAGGGACCAGGGCCTGCCGTACTTAAACAGCAGCGAG GAGAGAATCCTAGAGCTGGCCCGGTTCTCTGAGAAACGGCACGAGAACGT CTCGCTGTGGGAGGTGCAGAACCGCACCGGGCACGATCTGGGAGACATGG TGAAGAGATGCACCTTCCGCGGGGAACCCTGCACAGCAAACATGTTCACA CCTGTAAGTAACACCTGCAACGCAAACATGTTCAAACCTGTAAGTAGCCT CACACCTGCAACGCAAACATGTTCACAACTGTAAGTAGCTCAAACACTGC CTCCTAAAAACGCTAAGAACGTAAAACACAACCCATTTAAAATGTCAAAA AACTGCATCCTCAAAACAGCAAGAATTTTAAACATTGCTTTGCACTACAT GTTTCCTACCTCTGAAGTTAGGCTTGTCAACTTAGTCTGTTATGAAGTTT TATAGTGTAGATTTCCAATAACTGTTTCTGGCACCCCCGAGAGGGCTTTC AACATACATTGTAGATATGGATACGACGATGAAGGCTAGACATCCAGGTA GTTGGATACACAATACAAATTTGAGTTACTCAAGCAACTGGATAAGTTTT GTAAGATAGCTATGGATGGCAATATAAATTTTACCCTCTTTCTATGAACG TGTATAGAAACGTACATGTATGTAAAACAGCTGGTACAAAAACTCATTTC ATTCAGCAGTGCAGCCAGGAAAATGGTGACAGGAGATTGTGAGGAGGTTT CTCACTTCTTAATTATTGACACTTTCTTGAGTATCTTTCTTAAGGTTCAA CACATTGATGATGGTCACAAAGGCAGTTTTCTTGTGAGCTGTCTCTTGGC TATTCTGTTAAGTTTTTCTGTGAGTTTTGTCTTTGCTAATGATTCATTTA TTTATTTATTTATTAGACTTCACAGAGTGAAATCTGAGAGGTATTGGCAA CATGATCGATGCATCCTGTTGCTATTAGTTGTGTCAGGATGTAAGGTTTA AGGTAAGGTGACTCTTTGGCTGATCCTGTTTTCAGGTTTAGGAAACTTAC AGTCATTTCCAAGTCTTGGAAACTTACAGCTGTGTTGGTTATCCTGTAAA GTTTTTGGTTGACAACAATACAGATAGCTGAAACCTACAGCACAATTTAA GTTTCAGAAAACTTACAGTACAATTTCAGGTCCAGGAAAGTTACGGCTGT GTTGGTAACTTGTAAAGTTTTGGTTAACAACAATATCAGTAGCTGTTATA TATTAGGGGATATTAGCTGAGGTGTCTCTTGCTAATCCCCAGGAAACTTA CAGCCCATTTTCAGCTTTAGAAAACAGCCCATTAAATTGAGTCACATGGG AGGGGGTTAATATCAGGGGACAGAAACGCACATTTTGCCTCGTTAATAGG AATTTTTATGAAGAAGTTCGCAAATTATTGAATCAGACTCTGGCCTTTGA TCCATTATTCAGAAGGAGTTCTCTCGGATGGAGGCGGAAATCTAATTCTG ATCGGGTTGGATGCAGGATGTAGTTGGATAACGCGATTAGAGTTTTATAA CTCTGTTTTGTAGTCCGTAACTTTGCTCCGTGTCGGTGATTAGCTGGGTT GGCGTGGGTAGTGTTGGGGTTCTTGTCTGGCCACATCACCGGTGCTGGGA TAGTGGGGCTGGTTTGGAACCAATGCTGTGGTACTTTGGACAGATTTGGC ACCGACATTTTGGAACCAGTGTTGTGGTACCTCAGACACCAGGAGTGTTG TGGTACCTCGGGCGGATTTGGAAACAGCACTGTGGTACTTTGGACAGATT TGGTACCAACATTTTGGAACCAGTGTTGTGGTACCTCAGACACCAGGAGT GTTGTGGTACCTCGGGCGGATTTGGAAACAGCACTGTGGTACTTCAGACA GGTTTGGCACTGGGAGTGTTGTTGGGAATATTGTGATGCCACAGACGCTT CAGACGGTGCCATGGGATTGATGTACATGTTGGTGGGACTACGGTGTTGG CAGTGTGGGGACTTTGTAACCTCCAGCCAGTGCCAGGTCTGATGACCAGT GTGTTTATATCAGCTCCCCAACCCTCAGACTTGCTCCTCCTCAGCAGAAC TGACTATTTTTTGGCTCATTGAATTTTTTGGACCAACTTGTTGGTAGATA GGCGGGTCAGAAAAGGTTCAGAGATCAGGTGCTCACTTCACTTGGCACTT CAAGAAGCTCAAGGAGCTGCTTCTTCAAGTGAAAGTGAAAGTTGTAAGCA GGTAGAATGAAGAGAGTCCTGCAGAGGCTCCTGGGGCGTGGCCCACGGGT CTCCACGACAACGGTTGCCGTGCAACCGGGAGATCTCCCGGAGAACATCC TGCCGTTCGGGACACCGCTGAACTCCAGTGCACTGGCGGTGTTCGCACAT GACCCGGACATCCCCGACGACCGTTTCCGTGGTGATGGTCTCCATGACGA TGAGCTGAATGGCGTTCTGGCCACCATGATGGTGAAGCTGGACGCGCCGG AGGAGTTCTCGGACAACGAGTCTGTCCGCGGGAAAAACGACAAGAACAAG GAACGCGACAGTCGCCATGGCAACCAGGGAGGGAGTTGCCACGGCAGCCC AAACAGCTACGACGGGGACGAAAGCACTGTCAGCTCCCGTCACTATAGCA ACACCATGGCAACGTTAAACAACAACAACGTCCCGCCCCCACGGAAGGAA GACCGTGACCGCAAGTCTCACATCTCGCGGTTCGCAAACGAGACGACGGC GCACGGGTTCTGGCACGTGTTCCCGCCGGGCTACGCGGCGGGGTGCGCCG GCTGGACGGTCCAGCGCGCGGTGTGGGCGGCGCTGTTTGCCTGGGGCGTG GCCATGTTCCTGTACATGAAGATCGTCCACATCCAGATGTACTTCAGCTT CCCCCACTCCACCATCATCGACGAGGGCGCCTTCCACACCGACCGGTTCC CCGCCATCACCATCTGCAACCTCAACAAGTACCGCCTCAGCCAGCTACGC AACTCCGACTTCTGGCACATCGGCCGGTCCCTCAGCTACCTGGACGCCTC GCGCTCCCTCCGACCCGAACCTCTCATCAACCGCACCCTCCCCAAACCCG TCCCTGCCTACACAGACCCACAGAACCTCGCCGTGCTCTCCAACCTGTCC GACTTTCCCGCGAACTGGCGCGAGAACCCGCCGCCCTTCTGTCTGCTGGA CGCCCAGGACCGCGCAGGGCATCAGCTGGAGGACACGGTCCTGGACTGCC ACTATCGCGGAAAGAAGTGCTGCAAGGACTGGTTCAAACCGGTAAGTACT GGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACC GGTAAGTANTGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCAC TCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCT GCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTT CGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGG CAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTC CGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGC ATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCG CGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCA GGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCG GTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCAT TGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCG GGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGG AAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGT AAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTG ACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGG AAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAA ATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAA GTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGAC ATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAA ACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAAT GCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGT ACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACAT GTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAAC CCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGC AAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTAC CTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGT TCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCC TGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAA GTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCT TTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTC ACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTG CTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGT TTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTT GGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCAC TCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCT GCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTT CGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGG CAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTC CGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGC ATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCG CGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCA GGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCG GTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCAT TGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCG GGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGG AAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGT AAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTG ACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGG AAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAA ATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAA GTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGAC ATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAA ACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAAT GCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGT ACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACAT GTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAAC CCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGC AAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTAC CTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGT TCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCC TGCTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAA GTTTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCT TTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTGCTGCATTGACATGTTC ACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTCGCGGGAAACCCTG CTGCATTGACATGTTCACTCCGGTAAGTACCTTTGGCAGGAAATGCAAGT TTCGCGGGAAACCCTGCTGCATTGACATGTTCACTCCGGTAAGTACCTTT GGCAGGAAATGCAAGTTTTGCGGGAAACCCTGCTGCATTGACATGTTCAC TCCGGTAAGTACCTTTGGCAGGAAATGCAAGTTTTGCGGGAAACCGTGCT GTGTCGACATGTTCACTCCGGTGAGTATTTTTGGCAGGAAGTGCAAGTTT TGCTTATTGTCCTGAGATAGCTGGCGTTGCTCTTGTATGGTTACTGCAAA GGTGTGCAGAATGAGATGTTTAGCTGTGGTCGCTGGTCATTGTTGTTGCT AGAATGGGTCAGAATCTATCTGGCATTTCCGTAGGCTGTGTCATAGGACA GGCATATGCTTGAACTTTCACCCTGTGTCATAGGACAGGGATATGTGTGA ACTTTAACCCTGTACCATAGGATAGGGATGTGTGAACTTTAACCCTGTGC CANTTCAACCAGCCCGAAACGCCTCCTCATGCCAGCAACACAGCCAAAAC TGAAAATTGAGACAAAACCAAAAATTGAGCCAAAGTTGTTAATGGAGGGC AAACGGTCGGATCTGACTCACTTTGCCAACAACTCGACCCTGCATGGTCT CCCACGGGTGTTCCCGGAGCAGAGTAAAGGCTGGGACGTGCGGCGCGGCC TGTGGGCGGTTACCGTGGTTACGATGATCCTGGTGTTCCTGTACTGGGGC GTGAGCCACATCGGGACGTACTTCCGTTACCCGGTCACCACCAAGCTCCA TCTGCAGGAGGCAACCGAGTTGTTTCCCGCCGTCACCATCTGCAACCTGA ACACCTACCGAGTCTCCCAGCTGACCCCGGACGACCTGTACAGCTGGGGG GAGCTGATGGGCATCCTCCACCCCAACAGGACGCTGAGGGACCAGGGCCT GCCGTACTTAAACAGCAGCGAGGAGAGAATCCTAGAGCTGGCCCGGTTCT CTGAGAAACGGCACGAGAACGTCTCGCTGTGGGAGGTGCAGAACCGCACC GGGCACGATCTGGGAGACATGGTGAAGAGATGCACCTTCCGCGGGGAACC CTGCACAGCAAACATGTTCACNCTTTGGGGGAAGGAGGGGGGATACTGCT GTGTGTGTGTGTGGGGGGGGGGAACTGTTGTGTTCTCTAACAAATAGTTT GTCTAAATTGATATACACTCCCTTACTTTCTGCCAAAAGGCACTTGTTAT CATTGTCGATGCTACATTTATGACTAACATCCCCCCCCCCCCCATGCGCT GTGAGTGGCCTGGAAGGTCCACAGCCCCCCCCCCTGTACCAGGGGGGTGT TTTCATGATGACTCACCCCCCTGTACCATGAGTGGCCTTCACTCCTATAA TGCCCCCCCTCCTGTACCAGGGGGATGTTTTCGTGATGACTCACCCTACA TGTACCGTGAGTGGCCTTCATCCCTGTAATGTACACCCCCCATGTACCAG GGGGTGTTTTCGTCATGACTCATGACTCACCACACCACTCCCCCCCCTGT ACCATTAGTTGCCTTCATCCCTGTAATGTCCCCCCCCCCCATGTACCAGG GGGNACTGAAAATTGAGACAAAACCAAAAATTGAGCCAAAGTTGTTAATG GAGGGCAAACGGTCGGATCTGACTCACTTTGCCAACAACTCGACCCTGCA TGGTCTCCCACGGGTGTTCCCGGAGCAGAGTAAAGGCTGGGACGTGCGGC GCGGCCTGTGGGCGGTTACCGTGGTTACGATGATCCTGGTGTTCCTGTAC TGGGGCGTGAGCCACATCGGGACGTACTTCCGTTACCCGGTCACCACCAA GCTCCATCTGCAGGAGGCAACCGAGTTGTTTCCCGCCGTCACCATCTGCA ACCTGAACACCTACCGAGTCTCCCAGCTGACCCCGGACGACCTGTACAGC TGGGGGGAGCTGATGGGCATCCTCCACCCCAACAGGACGCTGAGGGACCA GGGCCTGCCGTACTTAAACAGCAGCGAGGAGAGAATCCTAGAGCTGGCCC GGTTCTCTGAGAAACGGCACGAGAACGTCTCGCTGTGGGAGGTGCAGAAC CGCACCGGGCACGATCTGGGAGACATGGTGAAGAGATGCACCTTCCGCGG GGAACCCTGCACAGCAAACATGTTCACACCTGTAAGTAACACCTGCAACG CAAACATGTTCAAACCTGTAAGTAGCCTCACACCTGCAACGCAAACATGT TCACAACTGTAAGTAGCTCAAACACTGCCTCCTAAAAACGCTAAGAACGT AAAACACAACCCATTTAAAATGTCAAAAAACTGCATCCTCAAAACAGCAA GAATTTTAAACATTGCTTTGCACTACATGTTTCCTACCTCTGAAGTTAGG CTTGTCAACTTAGTCTGTTATGAAGTTTTATAGTGTAGATTTCCAATAAC TGTTTCTGGCACCCCCGAGAGGGCTTTCAACATACATTGTAGATATGGAT ACGACGATGAAGGCTAGACATCCAGGTAGTTGGATACACAATACAAATTT GAGTTACTCAAGCAACTGGATAAGTTTTGTAAGATAGCTATGGATGGCAA TATAAATTTTACCCTCTTTCTATGAACGTGTATAGAAACGTACATGTATG TAAAACAGCTGGTACAAAAACTCATTTCATTCAGCAGTGCAGCCAGGAAA ATGGTGACAGGAGATTGTGAGGAGGTTTCTCACTTCTTAATTATTGACAC TTTCTTGAGTATCTTTCTTAAGGTTCAACACATTGATGATGGTCACAAAG GCAGTTTTCTTGTGAGCTGTCTCTTGGCTATTCTGTTAAGTTTTTCTGTG AGTTTTGTCTTTGCTAATGATTCATTTATTTATTTATTTATTAGACTTCA CAGAGTGAAATCTGAGAGGTATTGGCAACATGATCGATGCATCCTGTTGC TATTAGTTGTGTCAGGATGTAAGGTTTAAGGTAAGGTGACTCTTTGGCTG ATCCTGTTTTCAGGTTTAGGAAACTTACAGTCATTTCCAAGTCTTGGAAA CTTACAGCTGTGTTGGTTATCCTGTAAAGTTTTTGGTTGACAACAATACA GATAGCTGAAACCTACAGCACAATTTAAGTTTCAGAAAACTTACAGTACA ATTTCAGGTCCAGGAAAGTTACGGCTGTGTTGGTAACTTGTAAAGTTTTG GTTAACAACAATATCAGTAGCTGTTATATATTAGGGGATATTAGCTGAGG TGTCTCTTGCTAATCCCCAGGAAACTTACAGCCCATTTTCAGCTTTAGAA AACAGCCCATTAAATTGAGTCACATGGGAGGGGGTTAATATCAGGGGACA GAAACGCACATTTTGCCTCGTTAATAGGAATTTTTATGAAGAAGTTCGCA AATTATTGAATCAGACTCTGGCCTTTGATCCATTATTCAGAAGGAGTTCT CTCGGATGGAGGCGGAAATCTAATTCTGATCGGGTTGGATGCAGGATGTA GTTGGATAACGCGATTAGAGTTTTATAACTCTGTTTTGTAGTCCGTAACT TTGCTCCGTGTCGGTGATTAGCTGGGTTGGCGTGGGTAGTGTTGGGGTTC TTGTCTGGCCACATCACCGGTGCTGGGATAGTGGGGCTGGTTTGGAACCA ATGCTGTGGTACTTTGGACAGATTTGGCACCGACATTTTGGAACCAGTGT TGTGGTACCTCAGACACCAGGAGTGTTGTGGTACCTCGGGCGGATTTGGA AACAGCACTGTGGTACTTTGGACAGATTTGGTACCAACATTTTGGAACCA GTGTTGTGGTACCTCAGACACCAGGAGTGTTGTGGTACCTCGGGCGGATT TGGAAACAGCACTGTGGTACTTCAGACAGGTTTGGCACTGGGAGTGTTGT TGGGAATATTGTGATGCCACAGACGCTTCAGACGGTGCCATGGGATTGAT GTACATGTTGGTGGGACTACGGTGTTGGCAGTGTGGGGACTTTGTAACCT CCAGCCAGTGCCAGGTCTGATGACCAGTGTGTTTATATCAGCTCCCCAAC CCTCAGACTTGCTCCTCCTCAGCAGAACTGACTATTTTTTGGCTCATTGA ATTTTTTGGACCAACTTGTTGGTAGATAGGCGGGTCAGAAAAGGTTCAGA GATCAGGTGCTCACTTCACTTGGCACTTCAAGAAGCTCAAGGAGCTGCTT CTTCAAGTGAAAGTGAAAGTTGTAAGCAGGTAGAATGAAGAGAGTCCTGC AGAGGCTCCTGGGGCGTGGCCCACGGGTCTCCACGACAACGGTTGCCGTG CAACCGGGAGATCTCCCGGAGAACATCCTGCCGTTCGGGACACCGCTGAA CTCCAGTGCACTGGCGGTGTTCGCACATGACCCGGACATCCCCGACGACC GTTTCCGTGGTGATGGTCTCCATGACGATGAGCTGAATGGCGTTCTGGCC ACCATGATGGTGAAGCTGGACGCGCCGGAGGAGTTCTCGGACAACGAGTC TGTCCGCGGGAAAAACGACAAGAACAAGGAACGCGACAGTCGCCATGGCA ACCAGGGAGGGAGTTGCCACGGCAGCCCAAACAGCTACGACGGGGACGAA AGCACTGTCAGCTCCCGTCACTATAGCAACACCATGGCAACGTTAAACAA CAACAACGTCCCGCCCCCACGGAAGGAAGACCGTGACCGCAAGTCTCACA TCTCGCGGTTCGCAAACGAGACGACGGCGCACGGGTTCTGGCACGTGTTC CCGCCGGGCTACGCGGCGGGGTGCGCCGGCTGGACGGTCCAGCGCGCGGT GTGGGCGGCGCTGTTTGCCTGGGGCGTGGCCATGTTCCTGTACATGAAGA TCGTCCACATCCAGATGTACTTCAGCTTCCCCCACTCCACCATCATCGAC GAGGGCGCCTTCCACACCGACCGGTTCCCCGCCATCACCATCTGCAACCT CAACAAGTACCGCCTCAGCCAGCTACGCAACTCCGACTTCTGGCACATCG GCCGGTCCCTCAGCTACCTGGACGCCTCGCGCTCCCTCCGACCCGAACCT CTCATCAACCGCACCCTCCCCAAACCCGTCCCTGCCTACACAGACCCACA GAACCTCGCCGTGCTCTCCAACCTGTCCGACTTTCCCGCGAACTGGCGCG AGAACCCGCCGCCCTTCTGTCTGCTGGACGCCCAGGACCGCGCAGGGCAT CAGCTGGAGGACACGGTCCTGGACTGCCACTATCGCGGAAAGAAGTGCTG CAAGGACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGG TTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGG TAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGG TTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGG TAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGG TTCAAACCGGTAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACCGG TAAGTACTGGTTCAAACCGGTAAGTACTGGTTCAAACTGGTTGGTACTGG TTCAAACCGGTAAGTACAGGTCAAAAATGGTTAGCACTCTTTCAAACTGG TAAGTACTGGTCAAACCAGGTTCAAACTGGTAACTACTGGTAAGATTCAA GGCAAAATTGGATGTGACTCGGCAAATAGACAGAACCCATAAACAACCCC AAACAGTTTGACCTGTCATTTCCCCCCCAAGTTATGAGTATCTGTTTCTA TATCTTTATAGACGGTATATCCACCCCTCTGCATAACACACCAGCTTCTG TATCTGTATATCCGGTATAACCGCCCTTTGGCGTAACACCCCAGCTTCTG TATCTGTATATCCGGTATAACCGCCCTTTGGCATAACACGCCAGCTTTGA GTAAATCTGATCAGAGCACACGAGTCGTGCTGATGACAGATTTGTCCTTG ACATTTGCAGCAAATTGGAAAATCTTGACCCCAAGTTGACCCTTGACATT CCTTTGTCAATATCTCTGACTGGGGTTAAAGGTCGCAATCACAGCCCCTA AATCAGCTTGGAATCCTAACATGGTGCCAAAGGATCAAGTTTCATCTGAC AGACAGAAGGTCAACAAGCGCTATGTGTCAAGGTTATTTACTTAATCCCA AGTCACTGCAAGGTCACCTGGGGGTCATTGGGATGTCGCCAAGGGTAACG TTGCCATGGTTACATCTATAAGAGGATATTTAGGTAATCTAAAGATTGAG CTGAGCAATCATACAGTGTTGAGGGAAATGCTTGTAATAAGTTGTAGGTC ATTCAATAAATCAAGTTACAGATTGGGGAAAAATAGGAGTTTGCAGTGTC TGCATCCCACTTGGATAAATAGGCTTTAGAACAATGAAGATAGTGTTAAT GAATTGGAAAATGTGTTTTTAGTGGAATATTGTTGAACAGAAAATTTTCT GCAGTCTGTTTTTGTCTGGATTTCTTGAAATGTTTCTGTGGATCTGTGAA GTTCTGCAGAATATGTTATATTCTGAACAAAACCCCATATTGCACCCCGG GGGTATTAAGAATAGGTGGTGCAGGTACAAACAAAACTGTTCATTCTGGT TTGATAATGTGTGAAAGCGAAGCCCTGCTGAGCTGTTGGTTGTAACATGG TCATGTGATGCCCCCTAACAGTTAGAGCTGGAACTGCACCTGTATTGTAT GTCTGCTGTGGAGAAAACACTTTGCCTTTTCCTGACCACACATCAAGTCA AGTCAAGTCACGTCAATGCCTTTATTTTGCTTTTAGATACTTTTTTGGCT TACGCAGCCACTTTTCAACATTTTGGCGGGTAACGGACAAGAGTGAAAAA ATGTACATGTACCCTTCAGCATAACACACCAGCTTCTGTATCTATATAGC AGGTATAACCGCCCTTCAGCGTAACACACCAGCTTCTGTATCTGTATAGC TGGTATAACTGCCTTTCAGTATAACACACCAGTTTCTGTATCTGTATAGC TGATATAACTGCCTTTCAGTATAACACACCAGCTTCTGTATCTATATAGC CGATATAACTGCCCATCAGCATAACACACCAGCTTCTGTATCTGTATAGC TGGTATAACTGCCTTTCAGTATAACACACCAGCTTCGCAGGCTTGCGGCG CGGCAGCAGACCTGTCACACCTAACCTTTGCACATCTAACTGCCAGCATT CTTTAATGTGTCTACAGTACTTGTTGGCAACGAGTTCCACTCTACGATTC GACTATTTGAACACATCAATCCTAGGTTGTAACTTTGGTACATGAACATG GAGGCATGGAGTTTGACTCTCCGATACGAATATTTGAACACATCAATCCG AATATAACTTTGGTACATGTACTTGAAGGCATGTCTATATTTCTAGGTTG TAACTTTGGCACATGTACTTGAAGGCATGTCTATTTCTAGGTTGTAACTT TGGTACATGTATACTTTGAGGCATGTCTATTTCCTGTTCCCAATATCACA GTGGGATCAATGTCAAGTTTGCCGGGAGACAATCTCAGACAAGGGGCTGC CCCGACGGCGAAACCCCGTCAGAAACCCGCCAAATCTGTTTACAACGGAG ACGGCCCGACTGGTGGGGGCATCGGCTGTATCCGATCCAATTTGGGGCCT GCGCTCTTCCATGTAATAAGGTAGTCAGGAATCGATATGTAAGCCCAGGG CCTGCCACAGGCAGGAGGGAGGGTGGTCAGAATGTCTGCCGATTTGCAGG GATGAGATTTACTGTCATGAGCCAGATGATGATTACTTCTATTGAGTCCG GTTAACTCAGTCAACTACAGCCCCCCTGGGTACAGGGTTGGTGCAGTCGG AAAAATGCGCAAAGGTACACTGAGAACCCCCCAGAAGTTCACTGTTACAC CCCCCTGGGTTCATTGAAGACCCCACAAGTCTATTGTTACAGCGGGAAGG GTGGTCAGAATGTCTGGCGATTTGCAGGGATAAAATTTACTGTCATAAGC CAGATGATAATAACTTCTATTGGGTCTGCTTAACTCAGTCAACTACACAA CTACAGCCCGATGGGTACAGGATTAGTGCAGGAGGGAAAATGCCCAAAGG TTCACGGAGGACCCCCACAATACTACTGTAACACCCCCTGGGTCCACTGA CGACCCCCCACAGGTCTACTGTAACACCCCCCACTGAGGACCCCCCACAA GTCAATTATAACACCTCCCTGGGTTCATTTAAGAACCCCCCTGTCCACTG TAAACCCCCCCTGGGAATAGTATTTGTACAGGAGAAAAATGGCCAAATGT CCACTGAGACCCCCCCCCCCTAAATGAGTAACTCCCCCCTGCACAAGTCC AGTGTTACTACAGTACAGGAGGGAAACTGCCCCAGGTAACCCTGATGTTG TGGTACAGAGGAAGCCTGCTTTTGTAGTACATGGGCTCCCCCTGCTGGAT AGCTGCAGGACTGCAGTTGTACAGACTGTAGGGAGAATCTCAAGTGACAC AAAGACTCACTTGCATGAAGCACTGTTGCCTATATATGGGGATTAGTCAT GTCAGGCATTTACAAGTGCAGCCATGTTGTTTAACCCTCTTCCTGCAAAG TCTACTTACGGCACTAAATTTGTATTGGATTCAGGGTTAGGCAGCAGAGA GAAGGTTAATGTGCCATTTCTAAGTCAACTCAATGCTTTTTAACCTTCTC CCTGCTGAGTATCCCTTCGGCACCAAATTTGTGCTGGGATACAGGGTTAG TTTACAGGGAGAGGGTTAATTTGCCATGATTGTAAAGTCAACTGAATGCT GTTTAACCTTCTTCCTGCATAAGTAGCATTTTGCGACCAAATTTGTACTG GATTCAGGGTTAGTTTGCAGTGAGAGGGTTAAAGTGCCGACGTTGATTCC TGTCCTGTGTTCACGCTGCCTCATGATTCACCAGGAATTCTTTTCCTTTC TCCCCCTTTGTGCTGTCACCCTGATGCGGTCTCACACCGATGTTTCTCCT ACTCTGCGGTCTCACATTGCTGTTTCTCCCACCCTGCGGTCTCACACGGC TGTTTCCTGCCCTCCTGATGCTCGGATCTGTAGGTGAGTAAACGTGGTGA TTGTTGGTAACTGCTTGAATATGTCTGTTTTCTTGTGTGACCTCTGACCT CTGACCTTGAAATGAATCGTTGCTCATCTATTCTACCATCCAACCACACA CCAGGAAACACGGCTTCACTGACCAATCAGAGATAGGGTCAAATGTCATT TCAAGGCTCGGCTGACTAATCAGAAAGAAGAATTGTGAAATCAGATCATT ATGTTTTCAAATTTCTTCTTGGAATTTCTGGAAATAAATCCTGCTGAAAG GACTTTTTTGTATTTCCGCTCATCTTGTGAGGTGCCAGAGTCTCCCTTAG ACATCTTCAAATTTAATAAAAGTGGAAAAGCAAGCTTCTTATTGAACACC TTTAAACTCAACCACAGTTGGGAAGTCACAAAAGTTGCAAAATATCAAAC CCTGCATTATCAAGAAAGTGTGTTTCGGCATCAAAGCAACATGAACTGTA GTAGAGAACAACACAACCTGGTTTGGTCAGGATTTTTCTAGCCTTAACTA GTGTTCCCCCTGGAGTGTGGTGGATTGTTCTGTATCTATATAAATGCGCT CTTGTACTAATGACTTCGTCCTTTAAGATTTCTCATCTTTCTTGTAACCT GTGGAAATCTGAGATGAAGAGATCAGCGGATGATTGAAAAATTGGGAGCA AATTACAAAAGTGGAAAAGCAAGCTTCTTATTCAATACATTTTAACTCAG AGAAGTTGTGAAGTCCAAAAAGTATCCAGCCCTGCTTTCTTCTGCTACTG AAAATTAAACCAGTCTTGTCACCTGCAACCCAGATGAAGATGGCGTCTTG GTAAACTGGGTATCCAAAGTTTCTGCCAGTTCTTCTCTTAACAGAACCCC AAATAATAAGGAAAAATCCATTCTATTCCATTTTTTATGGCTGCAGAAAG GGAAAATGAAGTTTTTCATTTTCCAAACTTGCAGCTGTTTTGGCTAGTTT TTTTAGGAATTTAAGACGCTGTAAATTTGGTATCTACGACATCTCAGAAT TTCACTCAGAGTTTTCCTTGGTGTTCGACATGTTGCTGCGCGGAGAATCC TTGTTCTCTCGTGACATTTACTTGGCTGCGCTGCGATAGAAACTGTTCCT GCTGCATTTTGCGTCGCATAATGTGCTGCCTAGGAAAACAGGCCGCGATA TTTTTACTTACACATGATACGTTTACTAATGATTGTTCACATGTTACATC ATTGTTTACTTGTTACATGGTTATTGTTGCCATGTTACATGAGAATTGTT CACATGTTGCACATGATAATTGTTGGCATGTTACATGGTTATTGTGCACA TGTTACATGATTAATTAGTTATTACATGATTGATTGTTGAGATGCTACTA TCATGATGGCTATTCTTGACATGTTTCATATTTATTATTTACATGTTACA TGTTGATTATAGGTTTATAAAAGTGATTGAATTGAATGAATGAATGAATG AATGAATGAATGAATGAATGAAAAAGTAGATGTGTTGTTGTGCATTTGTG CTCTCTGATAAGTCTGATGAGGGGTCTGTGATTGACAGGAGTCAGTCTTA CCTTTGATTGACAGGTGACAATCTGACAGTGCTGTCATGTCAATATATAA GCACTTGTTTTTTATTTTATTAAATTTTCAGACAGCTGGGTAGCCCATTC AATTTTAGCAAATAGATTTTCAGTTGGGTCCAGACTATAAAACAGTAAAA TCATCAGTATAGCATGGAAAATGAACTTATGACAATTGTAACATAAGTAA CACTACAGACCATCTATATAATGCACTGTGCCATTGCCTGGTACATTCTG AAAAAACAACCAGTTTCCCCAAATCTTCAGTTATCACAAAAGAAAGCTTG GCACTGCATCAATCACAGAGACAGAACTGTTTTTTGTGTGAACTTCAGGC CATTCCAAGTTTTTTCCTTGTGTCTCAGATCCCACCTTCCATTGCTGAGG TCCACAGTTGTACCTTCAACCAAGAAACTGTGATTGGATTTCACAAAAGA AGCAGTTGTGATAGATTTTTAAAAAGAACTGACATTTTATTCAGTTTACT CATAACGCATTGCATGCATCATACCCATGATGCAATAAAAGATTGTGCCA CCATCTTGGATTCCCTTTGAAGGTGACCTTGTGTGGAGCAGACATTGAAC CTTTTATTTTGCCATAAATTTAATTTTTTTTTAAATTTTTGGCTACATCT ATTGTAAAAAAAGCACCCCCAAAATGTTTTACTGGTACTGGTACAGACAG TTTCAGGCCATTTTCTTTTGCCTTTTTTTGACTCAAAACCATCTGAGAAC TAATGGAATAACTTGGTGTGGTCTGACTAGAAAGCTTGTCAAGAGGAACA AAGGTAGGTGAGTGACTTTAAGAGTCTACTTCAGAAGACTTGGACCATTA GAAGCAGTCTCGGTAAGTAGGTCTTAATTGTATTATTAGATATTTGGGAA ATTTTGCACCTTAGCTAGTACACATTGAGAACTCATCGTACCTACATACC AGATCTATCTACAGGTATAGGCTGGTCCCATAGCTACATATCAAATCTAT CTATGTGTAAGGCAGTAGACTGATCTCATAGCCCTGACCACAGTCACAAC TTATGCAAGACAAAAACACAGGAAATCAAAAAGAAATGTGACTGACATGA AGCTAACTGCCTTTAGGCCCCCTACTATCAAATTCATGTGGCCAAGGTCT ATTGAAATGGAGATGGGCGCCGCCCTAAGCACCATCTTCTGTGGGAAGGA CTTTTAACTAGCATGTCTGTAGTGTGTACATAAACATACATCTTATACCA CATGATACCTGCTCGCTGCCGCAGCTTCATATTTCCCCATTCTGGTCAGA CCACCCTGCCGAGCCTGCCTGTGGGTGGCGGAGCTGAAAGCTCATTTTCA GTTCTTAATGACTGTTTAAGTGAGCGGGGAGGAAGCATTGACGTGCGTCA GGCAGCACGCCAGCCGTGAAGGTCACGGAACGAGATACGGGAGGCCTCGC TGATCTAGGTGTGCAGACTCTCATCTATTTATTAGTTTGAATATTGGACT GTTGGGCAACACAGGAGATCTGACAACCAGATTTCTCCTCCCTTCTTGGT CTTGTTTTTCTTAGTGTTTCATCATCATCATCATCCGTCGACCTCTGCAG CAGAGGACGGGGCGAGCCCTTGTACAACCGAGGCCCACATCAGTCTGTCT GACATGGCTGCTCCCAAGTCCTCCAACTCAATCCCTGTGTCCCTTGAGAT AGTCCTTGGGAAGGTCAGCTTCCTGGAGTGTGTTTTCCCGTGTGGTTTCC ACAGTGTGAGAGATGAGACAATCTCCTCGCTGGCCCGATGGCAGTGGCCA GCAAACCGGACTCGTCTCTGTTTTAGTGTTTATCTTAGGGCCATGTCAGT CCATTCTCTATCCTCCCATCTTTTCCTGCCTCTCTTTTGTCCCTCCCTGG ATAGTTCATGGCATGATAAATGTGACTTGTCCCGATGACCGTAACACATG ACCGTACCACTGCAGTTTTTCCTTAGGGGGTTAATAGGGCTTTGTATAGA CCAATGTTTTGCTTGACTCTCCTCTGTATGTCAGTATTTGAGATGCAGTC TCTGTATGTGATCCCCAGAATGTTCTGGAAGCATTTCATTACTGTTGTCT GGATTCTTGAGTTTTTCTGTCATAGTCCAGGAATCACAAGAGTACAGGAA CACAGAGGTGAACAGGAAAAGTAACCACGCAAACACATATGTAATGTTAC ATGTAATAATTTTCTACTGTCCACTTTCTGAAGTGGCAATGTTGAGGGAT GAGGTTGATGATTGCAGACAGAGCTGCCACCTAACGTTTGCCTCCAGAAT AGCAGCAGCTGACCTTGTTCAGTACTGCCCCCTAGCAAGTGTAGCAAGTA CTGCAGCTGTGGCCCACTCATGCCATGACAGAATTGCAGCCCTGGCTTTC AAAGTGGTCAATAACTTTGCTGTTGAGCACAATATTGACCAATATATCTA AAAGCATCTCTACCTGAGTCTGCTTCAGGCAAAAATCATCTTACAATTCT GAAAAAGTGAGGCAAAACTGTTAAGATCTGTTCTGTCCTTAGTGCTGAAG TCATGTCTGGTTTTGTCCTTAGTGCTGCACTCATAACTGTTAGGATCTGT TTTGTCCTTAGTGCTGAACTCATGTCTGGTTTTGTCCTTAGTGCTGCACT CATAACTGTTAAGATCTGTTCTGTCCTTAGTGCTGAACTCATGACTGTTA GGATCTATTCTGTCCTTAGTGCTGAACTCATGACTGTTAAGATCTGTTCT GTCCTTAGTGCTGAACTCATAACTGTTAGGATCTGTTTTGTCCTTAGTGC TGAACTCATGTCTGGTTCTGTCCTTAGTGCTGAACTGATGACTGTTGTGA TGGTTTCTTTTCTTCAAGGGGGTTAAGTATCATTTAGGTGTGTGTGTCTA ACATTGCATAAGGGTGTGAAGTGTAGTTATTGTTATCACAGAATAACTAA GGATCAGTTTGTTTGGACGTTATTGGTATCTGCACGAAGAAAAGCAACAG AGAATGAAATTGCCGGGACTTGATAAGTAAAACTTTCTCATGCTATAGAA GTCTTTAAGTGTGAGGAAGGGTTGTCAGAGTAGTTTGTAGACGTCTGTAA CTTTAAAGCAGGAAGTATAAGAAGCCGTTGACGTCTGCCTGTCTGCAACT TTAAGGGGATTCCGCCCGAGGGGCCAGAAGTGCAAGGTCAGCCTGACCTT GCCATGATCGAAAGCAAATAAGCTATGAATAGTCAATGTGCAGGGGAGGG GGGCACCTCAGACCTCAGTGTTTGGAACAGCAAGGGACTGTCTCAAAACT TTGATGTCTGAAATGGCCAGGGGCAATCTCAAAACATTCATGTCTCGAAC GGCCAGGGAAGATCTAAAAACTTAAATGTCTGGAAGAGGCAGGGGCAATT TCAAAACCTTTTAAAGGCTTTTCACACATTTCAAAACAGAATGTGGGGAA CCCGTTTCTTTGTGCTGCACAATTATGTATCAACATTACATGTCACAAAA CATCCCATGCAGGCAAAGAAACATTCAGTCTCTTACCCTGAATTGGTATA GATTGGTACAATTCTATCCAAGAACGATTACATACAAAGGCACAAGAAAA AAATGCTGACAATGCAATGATAAGGCAAGGAAAAGTTTATCTATTGTCCT TTAGGATGATTCCAAATTTGCCATGATGGTACATTCCTAGCTTAAGCACC AGCCCTGCTTATGTTAGTGGGGTGCAGAACAAAGATATTGAAATCAGCCC CCCTGGCAACAGTGTTGGACGTTGGCAGAGAATTTTCAGCACATTTTGGG GGGCAACTCACTTATGGAATCAACCATGCTGTGTTTCGTTCGTTGATGGG AGAATGAGATGGTATTACCTCTGGCAAGGCGCATCATACTCACTTCCCCG CAGTCAGAGGAAGTCATGTTTGATATGAATGCGATCGAAGAAAGCGGTCC CTGACATGTCAGACTTTATACCCTCCCTGTGAAGATGCAATTCCATTCCG TGACATTACACGCTACTTCCTGGCTGTGATACGGAATCGATCCTGACGTA TCATGTCGTTCCTGCCTTACAAAGTTGATCCATGTCGTTCCTGACGCACA AAGTGGATTCGTGTTCGGCTGAAAACATGAAACCTGATATTACGGCCGGC GCTACTGCTGAGGTCAGCAAGGTCGCGTGGCCTTGATTGTCCTTGTTCTC TCCATGCAGATAACTCAAGGTCAAAGTCACTTAGCTCATCTTTTTGACCT TGGCTGGAGCCATAGTCAGACTACAAAACTTGCCGATTATTTGGAGAGTG GCTGCCGATAAATAGTGTAGCAAATTTTTGGGATTCTGGAGATAAACAGT GGCAATTTTGGGGAGAGACTTACTGATAAACAGTGTGGCAATTTGTGAAG AGGCTGCTGATAAACAGTGTAGCAATTTGAGAAGAGGTTGCTGATAAACA GTGTGGCAATTTTGGGGAGAGGCTGCTGTTAAACAGTGTGGCAATTTGGG GAGAGACTTACTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATA AACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTT GGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGA TAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAAT TTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCT GATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCA ATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTG CTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGG CAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGC TGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGT GGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAG GCTGCTGATAAACAGTGTGGCAATTTGAGGAGAGGTTGCTGATAAACAGT GTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAG AGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACA GTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGG AGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAA CAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGG GGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATA AACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTT GGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGA TAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAAT TTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTGCT GATAAACAGTGTGGCAATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCA ATTTGGGGAGAGGCTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTG CTGATAAACAGTGTGGCAATTTGGGGAGAGGTTGCTGATAAACAGTGTGG CAATTTGGGGAGAGACTTGCTGATAAACAGTGTGGCAATTTGGGGAGAAG CTGCTGATAAACAGTGTGGCAATTTGGGGAGAGGCTTCTGATAAACAGTG TGGCAATTTGGGGAGACGCTGCTGATAAACAGTGTGGCAATTCGGGGAGA GGCTTCTGATAAACAGTGTGGCAATTTTGGGGAGAGGCTGCTGATAAACA GTGTAGCAATTTGAGAAAAGAGGTTGCTTTTGGGAGGCGTATGATGTATA ATGAATATCTCTCAGCTTTGAGCAGATCATAGACTGACTTCTGTAGATTT TGGAATGCTCTAGAATGTGTAATTGTTTCTTAATTTTTAATCATGGCAAA CATCTCTGATTTTAAACTATGTGTGCCTTGCGTTAAATGTAATTTAAGGC ATCATAGTGGATCAAATGGTCTTTTCGCCCTTGAAGTGTGCTTTCCTGCC CAAAGCTGGCTCCCTGTGCACAGCACTGAGTGGTTCCTTTGATGTGAAGT TAAGAGTTTATTCCGGCAGTAAAACCTGTGAAATGTGAGCCATGAGTGAA CGGAGTGATCAGACAGGGGGAACCTCGTAAAACATGGGTTAACGTTCTGT GGATGACAGCAACACCAAATATGGTTAGTGTCTGATGGACTTATTGTGCA CCAACACCAAATATGGTTAGTGTCTGACACTGCACCAACACCAAATATGG TGTCTGACAGACTTATAGTGTGCACCAACACCAAATATGGTTAGTGTCTG ATAGACTTAGTATACACCAACACCAAATATGGCTAGTGTGCACCAACACC AAATATGGTTACTGTCTGACAGACTTAGTGTGCCACAACACCAAATATGG CCAGTGTCTGACAGACTAAATGTGCACCAACACCAAATATGGTTAGTGTG TGTTGTGCGGCTTTATAGTCCGGCTGCTTTAAAGAGATCAAACGTAATGT CAGGTGGTTGCCGCTAGCGACGGTGAGACCAGGGATGATGTGCGTTGTGA TTCGCCGGCAGATTCAGAGAGATCAAATGAAAGCCATCTCAAAAGAAGCC TTTATGTTGTCGGGTCAGGTAGGATGGTTGCCCCTAGCAATGGTGGGACG AGGCATGGGCCGTATCGTGATTCAGAGAGATCAAATGAAACGCAACTCAA AAGAACAAAGATGTTGGAGGGTCAGGTTTGATGGTTGCCCCTAGCGACGG TGGGACAAGGGATGGGCTGTATCGTGATTCAGAGAGATCAAATGAAACGC AACTCAAAAGAACAAAGATGTTGGAGGGTCAGGTTTGATGGTTGCCCCTA GCGACGGTGTGCGGCCTGATTGGCCGGCTGATTTATAGAGATCAAGCAGC AGCACAGAGGAGGCCATGAAAGTGAAAGTGATGTTGTAGGCTTGCCCCAA GGCTGAGAGATCCGCAGCGCGAACTCTCACTTTCATCCCAACAGCAACAT TTATTATTTAATAGCTGGGATTATCTTCACTCTCCTGGAGCACTTTCACT TTTCCCAATGTCAAGTGCACGAAGCGGCCGTTATCAGAGCGCTGACAGGC GGAGTTCCTGTTATCTAACTCGTGTGCTTTTGACTAGCGTCTGTCAGACG GCATTTGTGGTGTAGCAGTTTCTAAACTCACCTTAAATGGGTTGTGTAGC ACTTTCTAAAGGGTGTTACAGTTTCTAGAGTCCCCTTAAAGGGCCTGTGG TGTAGCAGTTTCTAGAGTCCCCTTAAATGGGTTGTGTAGCACTTTCTGCA CCCCCCTAAAGGGTGTTACCGTTTCTAAACTAACCTCAAAGGCCAAGTGG TGTAGCAGTTTCTGAAGTCCCCTTAAAGGGCCTGTAGTGTAGCAGTTTCT AGAGTCCCCTTTAAAGGGCCTGTAGTGTAGCAGTTTCTAGAGTCCCCTTA AAGGGCATGCGGTGTGGCAGTTTCTAGACCCCCCGAAAGGGGCAAATGGT GTAGCAGTTTCTCAACCCCCCTAAAGGTCTTGTGGTGTAGCAGTTTCTCA ACCCCCCTAAAGGGCTTGTGGTGTAGCAGTTTCTCAACCCCCCTAAAGGG CTTGTGGTGTAGCAGTTTCTCAACCCCCCTAAAGGGCTTGTGGTGTAGCA GTTTCTCAACCCCCCTAAAGGGCTTGTGGTGTAGCAGTTTCTCAACCCCC CTAAAGGGCTTGTGGTGTAGCAGTTTCTCAACCCCCCTAAAGGGCTTGTG GTGTAGCAGTTTCTCAACCCCCCTAAAGGGCTTGTGGTGTAGCAGTTTCT CAACCCCCCTAAAGGGCTTGTGGTGAAGCAGTTTCTCAACCCCCCTAAAG GGCTTGTGGTGTAGCAGTTTCTCAACCCCCTTAAGGGCTTGTGGTGTAGC AGTTTCTCAACCCCCTTAAGGGCTTGTGGTGTAACGGTTTCTAGACCCCC TTGAGGGCATGTAGTGTAGCAGTTTTTGTTTAATTATTTCGCACAGGTAA AAAGGAAATGATACATACATAATCAAAATGGTGCTGGGGAAAGTAGAGAT CAATCTTATCTGTATGATTCCTTCTCCATTTTTCTTACCCCCTTAAGGGC ATGTAGTGTAGCAGTTTCTAAGCAGTTTCTAGACTCCCCTGAAAGAGCAT GTAGTGTAGCAGTTTCTAAGCTCCCCTTGAAGGGCTTCTAATGTCGCAGT TTCTAAATCAGGAGATCACATTCCCATCTTCATATCCTAACCCAAGTTTT ATTAATGAATGTCTGACAGCCATGCTGGCCCCCCAGGCTGCTGGGTTAGG CTTGCTGTGAGGGAATTGATTTTGGTTTACTGAAAAGCTTAATCCAGAAA GCAATATTATGTCACACGAACTGATATGTGACGTCCTGATGACTGGAAAG GAAAAGCTTAGCGTTCGCTCAGGCAGGAATTTCTTAAGTAGATTTACCAC ATTTCAACTCAGGATCTTGTGGCATTTCTCATGTATATTTGCCCCATTTC AGGATCTGAAGATCTTGTGGCATATTTTATGTAGATTTGCCCCATTTGAG GATCTTGAGGAATTTCTTATGTAGATTTGCCATATCGGAGGAACTTGAGG CATTTCTTGAGGCGCGTCTGTAAATCCTGCCGGGATCTTCGTGGCGGGAA GACGAATAGTTTTGTTAAATATCAATTTTCCGCTGGTTGATTTGATGGCA GAGAATCGACCTGCCGTCTGGGCTGATGAGGAGGTCCTCAAGTGGGGAAT AAATCTCCCCGAAATCTGATCCCGCTGTACAGAAACCAAGCCCCATCCAA GATTTCAGAAATCTGATCCCCGTCTCAGATTACAGAAATCTGATGCTCAT CTCAAATTACAGAAATCTGATTCTCATCTCAAATTACAGAAATCTGATTC TCATCTCAAATTACAGAAATCTGATTCTCATCTCAAATTACAGAAATCTG ATCCCGTCTCAGATTACAGAAATCTGACCCCCATCTCACAGCACAGATTT AGTCTTTCCTGCAATCAGTTTTTCCAGGAATCAGTCTTTCCTTAAAGTTT AACCTAGGTGATCGGGAAAAACCGCTATTTGTTTTTATGGGGAAGGACAA CAGGCCTAAAATGTGATGACAACTGCATGAGCTGAACAAGATTAGAAAAA GGGTTGGATTTGTTACTGTTATGTCCCAACCTCTACATAAATCTGTGTAA TTTGCTGCCAACTACAGGCACAGTGGGATGGAGGGAGGGCAAACAGTGGG GACTTCTTCAGTCAGTCTCTTGAAAGAAAAATTTACAGTGTCTGCATTCC AGCCCAGCAAACTACAGGCAAACCAAGCTGTAGGACACCAACTATTCAGG GCAGTCTTTCCTGGAATTAGTTTTTCCTGGAATCAGACAAATTATTTGTA GAAATCTAAAGTGAGATCACCCCGGCAACCCAGCCCTACATGTAAACCAA GCTGTAGGTCATCAACTCTCCCTGGCAGTCTTTCCTGGAATCAGTTTTTC CTGGAATCAGACAAACTATTTGTAGAAATTTAAAGTGAAATCACCCCAGC ATCCCAGTCCAGGATAACTACATGGCAACCAAACTGTAGGTCACCAACTC TCCTGGGCAGTCTTTCCTGGAATCCTGTCAGACACTTACCATATTTGGTG TTGGAATCAGACAAAATATTTGTAGAAATCTAAAGTGAGATCACTGCAGG ATCCCAGCCCAGTAGACTAACAGGCAAACCAAGCTGTAGGTCACCAACTC TCCTGGAATCAGTATTTCCTGCAATCAGTTTTTCCTGGAATTTTATAAAC TATTTGTGTAAATTTAAAGTGAGATCACTCCAGCATCCCAGCCCAGTAGA CCAAGCTGTAGGTCACCAACTCTGCTGGACAGTCTTTCCTGGAATCAGTC TTTTCTAGAATCAGTTTTTCCTGGAATTTTATAAACTATTTGTGTAAATT TAAAGTGAGATCACCCCGGCATCCCAGCCCAGTAGACCAAGCTGTAGGTC ATCAACTCTCCTGGACAGTCTTTCCTGGAATCAGTCTTTTCTGGAATCAG TTTTTCCTGGAATTTTGTAAACTATTTGTGTAAATTTAAAGTGAGATCAC CCCGGCATCCCAGCCCAGTAGACCAAGCTGTAGGTCACCAACTCTCCTGG ACAGTCTTTCCTGGAATCAGTCTTTCCTGGAATCAGTTTTTCCTGGAATT TTGTAAACTATTTGTGTAAATTTAAAGTGAGATCACCCCGGCATCCTAGC CCAGCAAACCCAGCTATAGGTCACCGACTCTCCTGGGCAGTCTTTCCTGG AATCAGTCTTTTCTGGAATTAGTTTTTCCTGGAATTTTGTAAACTATTTG TGTAGATTTAAAGTGAGATCACCCCGGCATCCCAGCCCAGTAGACCAAGC TGTAGGTCACCAACTCCCCTGGGCAGTGTGAGAAATGATCCTGGCCCGTC CAGCCCATCAGTTTCACTGCAACATGAATATAGATTGGGCTTTAATTGTC CACGCATGATTTCTCCCGCCGCTGGCTAATTTCCCCCACACGTCCCTGAA GTGCCCGAAATTATGGCCGATATAATTGCCAGAATTAGCCGTCCGCAGAA CGGAACGGATTTCTTCGTTATGCAGACTCATCAAATGAGCATCGGACAGT TTGGCCATTCCCTGCAGTACTGGGGAGCAAGAATGTTTTATTCTTATACT TTTTACCCATAGAGTCACACCAAACATGGGCGTAGCAATGTAGTCATACC AAACATGGGCGTAGCAATGTAGTCACACCAAACATGGGCGTAGCAATGTA GCAATGCCAAACAGTGGCATAGCAATATATGTAGACATATAGACATCCAA ACATGGCAATATATGTAGACATATATGGTCACACAGAGCACAATAAAGGG TAAACCAGACAGGGACATGATAAGGGGAAACAGTGCCTCAGACAGGGACA CAATAAAGAGGAACCAGCGCCTGCCTTTGATCAATCGCAGAAAGTATCGC GCGATCCATCGTTTCGCCACTTGCTGATTCCAGCGGTGGAGTAAAGACAA AATCAATTCTCTCCATTTCCTTATATTGTTGCAGCCGGCTATAAGGCGCT ACTGATGGATAGGTATAGGGCAGGGGTAGAGCAGTTCTCAGGTTTGGGCC TTATATTGTTGCACCATATTTAAGGTGCTTGTGATGGATAGGTATAGGGC AGGGGGAGAGCAGTTCTCAGGTTTGGGCCTTACATTGTAAGTTGCAGCTG GTTATATTAACTTAGGTGCTTGTGATGGTGGGTGGGGTTTGGGAGAGTAG CTTGCAGGTTTTTATTATCTCCATGAAAGTTATCTCCATGAAAAATGGAG ATATTGTTTTGGGTGTGTCTGTTTGTCTGTTTGTGTTTCCGGACCACTCC AGTCAGCACAACTCAAGAGCCTCTTGATGGATTACAATGATATTTGGTAT GTGGGCAAGTGTTGTGAAGCCGAAATTCAAGGTCGATTTTGGGCCCCCTG GTATGTGACCTTGGTACTGCAGCAGAACTTCAATTTTTGTATCTTTTGAC CTGGACGTGCTGTAGTCTTGATTTTTGGGTGGCAGATAGCTTGTGATGTA ATAAAGAAGTGGTGTAGGTTTGGGCCACCTAGCAGCTTCCTCTGGAACTG CAGGGGTGTTTTTGTGAGGAGAATAACTGAACAAAGGAATAACAGATTTC CATGATATTATTTTGGTTGAGATGCAGTCAATGCTGCCCAACAAGCCAAA AGCTTGAGGCTGTCAGTTGAGAACGATGAACTCTCAAAATCAAAGTCAGT AAGACTGGAAACCTGAAGAACTCTGACAACGTTTCAGTCAATGTTCTCTG TAGCCACAAACAGGTAAATGTTAAAGGCACAATGATATATGATACACTTA CTGTTTTCAAAATCATATCCAGTTACATGAGTAACTCCTATTTAGCGTAT TGTTTATAATGTCTTAGTCAATGGTCTCTGTTACTAGAAACAGGTAAATG TTAAAGGCACAATCATATGATACATCAACGCAGTTATTGGTTGAGGGAGG CGTTGACTTGAAGAAAGTCCATTTTGAGACAGGCTAGAGCTACATGTTTC ATCATGCAACCATAAGGGATCCGGAGATAATGCTATCATAGCCTATGCTA GACCACCAGAGAGCTAGTAAGATGTTTCATCATGCAAATGTAACTAAGGG ATCCAGAGATATGCTATGCCAGACCACCAGGGAACTAAAGACAATTTTTA ACTATGAGATGGGTTAGAGTTGGACCACCAGGGAATTGGAGACAATTTCT AACTGTGGGATGAGTTAGAGCTAGACCACCGGAGACCTAGATGTCTCATC ATGAGACCTTAAGGGATCCAACGTGCTGCTATGCTAGACCACCAGGGAAT TACAGACAATATCTAATTGTCCCCCATGCTTTATTAACAGAAGCTGTAAT TGCTGTTGATGAACATCCTGTCGGACAGGGAATTGATGAAGTCCTACATC GTCAGCAAAGCCTCGTTAAGGGCCAATTAGCTCCCAGCTGTGACGAGCCC CTCAGCTCGGCAAGCTGCGAAACGCGCCGATGAATATTTCAGGACAGATT GTCTGGTCCATTTGCGGTGGCGATTCCGCGATTTGTCTGAAGGACGTGCA AAGTGGGGATCACCTGGGGGCGCGTTCTACCACAACATGGTTTGAAAAAT AAGAAATTCATCATTAATGTGAAGTACCATTTGTCCAGTTTGCACATTTT TGAGTTTTTGCAACACATTGATTTTTGGAATACTCCATCTTGTACGGGGA TTTTGAGGTGTATACAATGTACATGCACTCTCTGTTTTGGAAAATGACAC AACAAAAAAATAAAAATAAAAACTTTATTGCACAACAATTGTACAAGGTA CAAAGTGTGGCATTCACTGGTACATAGATAACATTCTATTATGCTAATCA TATATTATGGATGTAAAGTACTGGTAGTCCATTTTACACATTTTCGGAGT TTGGAATACTCCATTTTTGCAATGCTGTGATTGTGGAATACTCCATTTTT GCATGGGGAATAGATTTTGGGGTTCAGATATTAATGATGATGTCTTTCGG CATGAAATATTCTGTGAAGGAAGGTCATGACAGTACTGACTGTGGGCCAT TAAGTATTTTGCTGCCACAGCTTTATGTCTACTTTAGTCATTTTCATATA CTTATTATTAGAAGAAACTTCTGAAATCAGGGGGTATGTACAGGGGGAAT TTCCACATTCAGATGGACTGTCTCCATATTTCCTAAGGCATATTTCAAAC ATGCAAAATAGTATCCACCCCTTCTTCTGAATCAGCAGAAACTGCCAATG TACAGCTTTCAGGCTCTGTGCTCATGTTAATACTACAATTGAGAATTTTT CTACAGCTGAGAACCGACAAACGAAATTGGTGTGGCCTAATCATTGCCTC ATCAGTGATCAGTCAACCTTATGAGACGGCTCAAATAACACAGACAAAAC AGCTAATATCCTGCCCANCAAATAACACCGACAAAACAGCTAATATCCTG CCCAAACTGTGGCCCCCTGCGGGACACATGAATGAACTCTTCCATCCATC ATCACGTTGCCATGGCAACCATTGCCACGGCGGGGATTAAGTCAGCCAGA TGCCGTCTCAAATTACAACTCACAGGCCAGAACTGGAAACATTTATGTTT TAAATCTTTCTTTCAGTTCAACTTGGGAATTTTGTTGGATGGAATATGCT GGTGTGTTGATGAATACATCCTGTGAAACCGTTTTATTGTTTTATCTGAA TTTATCACTAACAATGTGAAGGGGAGGACAAATCAGGTGCAGTAAGCACT ACAAATTTCCCTCCCACACACTTAACACATAAACATCAACAATATATTTC AGTAGAAACCAACTGAATATACAAATACGCAAAGCATATCTTAACATACA ATTCACAATGACGCATAATCCAGATATTGATATCTCTTGAATCTTGAATG GGACATTAATGATGTCAACACGGAGAACAATATTGATATACAATGAAGCG AGAACTCAATGGAGCCTTGCGTCAACACTGGAGCTACCCCCACAAGTGGT CCGCTGGTACATGGGAGACTGTTTGACACGACTATTAATGGCTACTGGGT GTTTTACACGTAACAATCAAATTCAACACGATTTCACCCTGTTGGATCAG CAGGAATGTGTGTTTTTACTTCCCAACAATGTGGAGACTTTCATTTAACC GTTTCACGCTTGTGTGGCTGCTACACCGTTAGGGTTTGGTGTAATTGTTT TTATGTTTGTTTAATGCTGCCACAATGTGATTATTTCCTATCACTGTCCC CCGGGTAATCGGTGCATGGCTCGAACCCAAACCCAGCCGTGCCGGCCTCT CTTGCCAGTCCTGATCAATAAGTTATCATCTATGATCTACTGGTTACAGG AATCTACTGGTTACAGGAATCTACTGGTTATAGGAGTCTACTGGTTACAG GAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACA GGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTAC AGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTA CAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTT ACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGT TACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGG TTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTG GTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACT GGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTAC TGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTA CTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCT ACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATC TACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAAT CTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGAA TCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGGA ATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAGG AATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGGTTACAG GAATCTACTGGTTACAGGAATCTACTGGTTACAGGAATCTACTGTAATTA GTGCATGGGTTTTACCCAAACCAGCCCCTCCTGTCATTCTTCATGAATAC CAGGGGTAAATGTGATGCTTCTTGTTCCTTTGCTTTTCCGTTTGAAGGCC ACACCAATTTACCAATTAGTCTTCACCCCAACAAGCAAATTTCTGGAGAT GAGTCCTGGAGACAGCCGTGCTATCAATGAAACACCCCAAGTCGGCAGTC TCTCCGTCTTTAATATTGCATGTCGTGATCAGGTTTACAGTGTTGGTAAT TACCTGGTTCTCAGTGAGCTGGGCTGCATGTGACACGATTAACACCTAAA TGTCCATGTATAACAGCCACCTTTGACATGATGAACTCTCACACACCTTC ATCTTTGTGTAAAACAGCCACCTTTGTGATATAATTAACCCTCACACAGA TACATGACCATGTATAACAGCCACCTTTGACATAATTAACTCTCACACAC CTTCATCTTTGTGTAAAACAGCCACATTTGTGATATAATTAACCCTCACA CAGCTACATGACCATGTATAACAGCCACCTTTGACATAATTAACTCTCTC ACAGCTACATCTTTGTGTAAAACAGCCACCTTTGACATAATTAACCCTCA GACACATACTGTACACGTCTTCGATGTCAGTGCCTTTCATAATGATGCCC TGATCAGGTGTACAGTGTTAGTGATTACCTGGTGCTGATCATGAGTGAGC TTGGCTGTATGTGACATAATTAACCTTCAAACAGACACATGTTCATGTAT AACAGCCGCCTTTGTGACATAATTAACCCTTACACAGCTACACGCCCATG TATAACAGCCACCTTTGACATAATTAACCCTTACACAACTACATGCTCAT GTTTAACAGCCACCTTTGTAACATAATTAACACACATACATGTCTATGTA CATTTGTATAACAGCCACCTCTGACATAATTAACCCTCACACAGATACAT GTCTGCGATGTCAGTGCCTTTAATATTGCATGCCGTGATGATGTTAACAG TGTTAGTATTACTGTGACTGGATCTGCGTAAGCTCGGATTGACAGCTTCA GTTCCAGCTCTTTGTACTGAGTGGTTGACGTAATATCCCTGAATGTTTGT ACCAATGAGTGGTCCCCATTAAAGTCTGCAATGCCTTTAATATTGTATGC CTTGATGATGTGGTAGTAATTACTGTAACTGCTTCTGCGTAAGCTCGGAT TGACAGCTTTTTGAATTATTTCCACCTCTCTTTGCACATAGTCGTTGACG TAATATCCTCAAATGTTTGTACAAATGAACACTCCCCAGTCCGCAGTGCC TTTAATATAATTGTATATTGTGATGATTTTACAGTGTTAGTAATTACTGT GACTGCTTCTGTGTAAGCGCGGCTTGACAGCCTCAGTTCCACCTTTCTTC GTGCCAATTAGTTGACGTAATATCCCTGAATTTTTTGTACCAATGAACAC TCCCCAGCCTTTAATATTGTATGCCTTGATGATGTTTACAGTGGTAGTAA TTACTGTACTTCTGCATAAGCTCGAATTGACAGCTTTAATTCCACCTCTG TTTGTACCCAGTAGTTGACGTCATACCCCCAATTGTTTGTACCAATGAGT GGTTCCCGGCCTTTAATATTGCATGCCATGATGATGTTTACAGTGGTAGT AATTACTGTGACTGCTTCTGCGTAAGCTTGAATCGGCAGCTTCAGTTCCA CTTCTATTTGTACCGAGTGTTTGGCGTATGGTCCCTGAATGTTTGTCCCA ATGAACGGTCCCCGGCCTTTAATATTGCATGCCGTGATGATGTTTACAGC ATCAGTAATTACTCTAACCGCTTCTGCGTAAGCTCGGATTGACAGCTTTG GTTCCACCTCTGTTCATGCTGAGTCAAGTTGACGTAATATCCCCGGATGT TTGTACCAATGGACGGTCCCCGGCCTTTAATATTGCATGCAGTGAGGATG TTTACAGCATTAGTAATTACTCTAACTGCTTCTGTGTAACCTTGTCTTGA CAGCTTTGGTTCCACCTCTGTTTGTACCGAGTAGTTGATGTGACATCCCC GAATGTTTGTACCAGTGAACGGTCCCCGGCCTTTAATATTGCATACCGTG ATGATGTTTACAGCATTAGTAATTACTCTAACTGCTTCTGTGTAAGCTTG GATTGACAGCTTTGGTTCCAGCTCTGTGCCGAGTAGTTGACGTAATATCC CCGGATGTTTGTACCAATGAGCACTCCCCGGCCTTTAATATTGTATGCCG TGATGATGTTTACAACATTAGTAATTACTCTAACCGCTTCTGCGTAAGCT CGGATTGACAGCTTTGGTTCCACCTCTGTGCCGAGTAGTTGACGCAATAT CCCCGAATGTTTGTACCAATGGACGGTCCCTGGCCTTTAATATTGCATGC CGTGATGATGTTTACAGCATTAGTAATTACTCTAACCGCTTCTGCGTAAG CTCGGCTTGACAGCTTTAGTTCCACCTCTGGTTGCCCCTCGGAAACAGGA ATTATGCGTCCCTCGTGACGTGTAATTTGTTCCCCCTCCATAATTGTCAT CTGGATTTGTTTTCCCGGCGTAATTATGGAGTAATAGACTCAATTCTGGG TTGATCAATTTCCATAAGCTGTGTTTAAGTCCGTTCTGTCTCAGTGCTTT TTGTTTGGAAATTTGTCAGAGATTGGGGTTTGTGCCGTGTCAGCAGAACG GCTAACCCGGCCGGGTGTCCCTGTGTGAGGGTGCGTGGGTAGCTGTGTGG GTGGATGGGTAAGCTGTGTGGGGTGCCTGGGTAACTCTGGGGGAGATTTT CTGGGAATCCCTTGCTGTGTTTTATTGTCTTATTTGGGTTTATTGCAACG TAAAAGGGAGGTCAAAACAGGTGAATACACTGTGAGCTTACTAGTTGCCC TCCGACACGCTAAAGGAAATAAATATCAACAGTACACTACATTAGAATTT AACTCTTCTTCTTCTTGACTTGGCTTCAGAACAGTATTAAACAGTATTAG AGATTAAACATATCTACAAATATACAATACAGCGCTCAACACAACAATGA AGCATACTGCATTATATTTTGATATTCTCCCATGTAAGTCCTGTACCTTT GTGGGAATATTGCACAGTTTTTTAGAAGGGTAAAACCTGTCCCTAAGTGT GTTAGAATATCATGTAAATTCTGCACAGTATATAGAAGGGTAGAACCTGG GTTTTGTTAGAATATTGCGCAGTTTTGTAGATGGCTGAAACCTGTGCCTG AGTGTTTGAGAATATTATGTCAATGCTAGAATCAGTGGCAGCCAGCGGGA GAAGCTTGTTTCAATGAGTGTTTAATCCTTGCAGCTTGGTTCCTCCTGTA CCTATGTGGGAATATTGTACAGTTTTGTAGAAGGTTGAAACCTGTTCCTA AGAGTGTTGGAATATTATGTAAATTCTGCAGTTTTGTAGATGGCTGAAAC CTGTGCCTGAGTGTTTGAGAATATTATGTCAATGCTAGAATCAGTGGCAG CCAGCGGGAGAAGCTTGATTCAATGAGTGTTTAATCCTGGCAGCCTGGTT CCTCCTGTACGTATGTGGGAATATTGTTTTGTAGAAGGTTGAAACCTGTC CCTAAGAGTGTTAGAATATCATGTAAATTCTGCAGTTTTGTAGATGGTTA AAAGCTGTCCCTGTTAGAAAATTATGCAAAAGCTTGAATCAGTGGCAGCC AACAGGAGACTGGTGTGTGCTCAATCCTGGCAGCCTGGGTCCCTCCTGTA CCTATGTGGGAGTATTGTTTTGTAGAAGGTGCCTGAGTGTGTTAGAGTGA ATTCTGCAGTTTGGTAGAAGGTTGTTAGAATATTATGTAGATTCTGCCCT GTCCTGAGTGCGTTAGAATATTATGTAAATGCTTGAATCAGTGGCAGCCA ACAGGAGATTTGTGTGTTCAATCCTGGCAGCCTGATCCATTGTGGGAATA TTGTACAGTTTTGTAGAAGGCTAAAACCTGTCCCTAGCCTGGGTTTGTTA GAATAAATCCTGCAGTTTTGCAGAAGGTTGTCCCAAAGAGTGTTAGAATA TTATGTAAATTCTGCCCAGTCGTGAGTGTGTTAGAATATTATGTAAATGC TTGAATCAGTGGCAGCTGACAGGAGATTTGTGTTGTCAATCCTGGCAGCC TGATCCTTTGTGGGAATATTGTTCAGTTTTGTAGAAGGTTGAAACCTGTC CCTGGCCTAGGTGTGTTAGAATAAATTCTGCAGTTTTGCAGAAGGTTGTC CCAAAGAGTGTTAGAATATCATGTAAATTCTGCCTAGTCGTGAGTGCGTT AGAATATTATGTAAATGCTTGAATCAGTGGCAGCCAACAGGAGATTTGTG TGTTCAATCCTGGCAGCTTTTCCTGTACCTATGTGGGAATATTGTTCAGT TTAATGGAAGGTTGAAACCTGTCCCTAAGAGTGTTAGAATATTATGTAAA TTCTGCCCAGTCGTGAGTGCGTTAGAGTATTATGTAAATGCTTGAATCAG TGGCAGCCAACAGGAGATTTGTGTGTTCAATCCTGGCAGCCGGGTCCCGC GGGAGGGTGCGTTCCCCGTCCCAGCCGATATTGAGTTCCATCAAACGGCG CTCAGTAATTATCCACAGTGCAGCGGGCTGATACATATGGATGCCGCGCC CCGCAGGTGAGGAGCCCACTTCATATGGAAGGCACGCCGCCGCTATGCAA ATGCCTCACTGATAGATGGACTGCCTCGTTTGCTTGCAGCCGTCAGCTCT GTGCGCTGGATTCAGACATCGCTCGGTGTGGCGGCGACGCTAGTGTGAAG CTGAGGACCAACCAGGGGAGGAAACGAACTGTGGAGGCAGAACTCTGGCA GGGTGGGGCTGGGACGGCGTCTCTCCCGGGTAAGGTTGGAGAGGAGGAGG AGGAGGATTCACTCCCCTGGTTTTACTGCCCACTCCACCACCACCGATGC CACGCCAACATTCCGGGACTCACCAGCGTCACAGCAACGGAACACCAACA TTCCGGGACTTACAACGACGTCACGGCAACGCACCGAGGATCCGGGACGC CTTGGCTGCGCTCCTCCTGTGCTCGGGAACCTCCAGCCCGTCCGTGGAGC ACCTGCAGTCCTGAGAAAATCTACCCACCAGCAGGGAAGTCTGCAGTTTC TCTGTCTGCATTTTTATTGATTGAGGCTCTACTGCTGGTGCCGTAAAGCC GGATTCCTGCTGCAAATATTCCCCCCTGATCGCAGGTAGGCGGAATTGCT GTGTGGACAAAGTTGTTCCTCGCCCGGGCGCTCCGGGGAGTCTTGTAAAT AGACTTGACATTGAACTGCCACTTCACTCCGTCCATTCTCCGATCGTGGC GCGGAGACGCAATATTAATCATAAGGGCTTCTTGCAAGGCAAGCTTCTCA CCCATCCGATGGATTATTGTTGTAAATAGACCCGTGTTGTGCACCGAGGT GCCTCCTTTTTATACTTCGTGCCAAGTCGGTCCTACGGTCACCGCGGTTA CCGGACTGACCTCTATGCAGAAACGCGACCTTGCTGTCACCGCCCGTATC TTGGTTGCTTATTCGGAGGAGAGAGAGTCCCACTGGCCAGAACCCATGCA CATGAAACTGGAACCACGCACGNGAGAGAGAGTCCCACTGGCCTGAACCC ATGCACATGAAACTGGAACCACGCACGTGAAAATCACCTGTGCTTTGGAA CCACGCACGCAAAACCTTTCTGTGGAACCACGCAAGTGAAACTTACCTGT GCTTTAAAACCACGCACATGAAACTCGCTTGTTTTCTGGAACCACGCATG TGAAATTCACATGTGATTTGAAACCACGCACGTTGAAACTCACCTGTTTC CTGGAACCACAGACGCCAAACTCAGCTGTTTCCTGGAACCACTGACGCCA AACTCACCTGTGCTTTGGAATCACGCAAGTGAAACTTGGAGCCCCGCACA TGAAATCTTCCTGTGGAACCACGCACCTGAAAACGACCTGTTTGCTGGAA CCCAGCACATTAAACTGACCTGTGGAACCACGCGTGTGAAACTGCCAAGT CTGCAGGAACCACGCGTGTGAAACTACCCTGCGGAAACACGCACGTGAAA CTGCCAAGTTTGCTGTGAAACTGCAAAACCACGCGTGTGAAACTGCGGAA CCATGCACGTGAAACTGACATGTTCGGTGGAGCTGGACTGCTGCCCCTGC TGCGACTGCGGACAATGCTGCTGCGGCTCGAGCACGGCCGGCTCCGAACC CCGAGACGCCTCGTCGGAACTCGGGGACGGAACAGACATCAACGGCGATC AGACATACTACCGGAAACAGGCGCAGACGATGTCGGACTTCGCGGCGGAC TCGACGCTACACGGGCTGCCGCACATCTTCCCGGGATCGCCGCTGAGTGT GCGACAGATCGCGTGGGCGCTTGCGTTCGTGGGCTCGCTGTCGGTGCTGC TTTACCAGTGCTCCGACCGCGTGAAGTTCTACTTCCAGTACCCGCACATC ACCAAGCTGGACATGGTGCTGGCGGCACAGCTGGACTTCCCCGCCATCAC CATCTGCAACATGAACATGTTCCGCTGGAGACAGTTCACCAAGAACGACT TGTGGTACATGGGGAAACCCCTCAACATTCTAGACGAGAACAACAACCTC CGCTGCTCTGAATATGCAACCTCGGGAGACATACAAGCGCTAAAAACGAA GGCGAACTTCGATTCTTTTAAACCCTCGCCCTTCAGCATGATTGAATTTG CGAACAGAACGGGCCATCAAATCGAGTCTTTTCTCTTAGACTGTAAGTGG AAAAACTTCACTTGTGGGCCGGAATACTTCACACCCGTAAGTCACTTCTC TCTTACCTTCATCTGTGTCTTACACTGTGTGTCTTAGACGGTCAATGGGG GAGGGGGGAACTAACACTTCACACCCGTAAGTCATTCTCTTACCTTCTTG TGTCGTGGTATGTCTTAAATTGTATGTCTTAGAATGTGGGAAGTCTTAGA CTTGGATAAGGTGGTAAGAGGGAAGGGAGAGTAACATTTCACAGTTCTTA CCTGTGTTGTGAGTCTTTGACTGTGGTGCCTTAGATGTGGCGCTTTAAGC ATGTGGTAACCTCGCATTGTTGGGGAGGCAGCAGCAATGGTAGTCTCAGC TTTCTCCACCTTTTTAAACTTTCCCACCTTTCCCCATCTGTCTCACCTTT CCTCACCTGTCCCACCTGTCTCACATTTCTCACCAATTCTCACCTGTCTC ACTTTTTCTCTCCTGTCTCAATTTCCCCATCCGTCTAAACTTTTGTCACC TGCCCCACCTTTCCCACCTATATAAACTCTTCTCACCTGTATGAATTCTT CCCACCTGTGTAACTCCTCCCACTTGTCTCACCTTTTCTCACCTGTCCAA ACTGTTCTGACCTTTTTGACCTTTTCCAGCCTATCTCACCCTTCCCCACC TGTCTGACCTTTTCTCAACTGACTAAACTGTTATCACCTGTCTCCCCTTT TCTCACCTGGCCACATTTTCCCACCTGTCTCACCTTTCCCCACAATCAAT CTTTATGGGAACGCGCCTGGTGACAGAAAAGGAGTCTTCCTACTTTAACC TTCTCCCTGCTGCCCAACCCTGTAAACATGAGAGAAATGGTGGCCAAACG GCTACTTCAGTGTGCTAAAGGTTAATAGGAAATCATCCGTCTTGAGGTGT TGAGTAAACTTTCACTGTACATTTAAAATATGGAAACAAATCAAAACAGA AAAACTCTCCTGATAAAGACTGCTCGATGGCCATCTATCAAGACCCTTAA CCAACTTCATGTATAACTGCATCTGCATCTGTCTAGCCAACATAACTGCC CTTCGGCATAGCACACCAGCATTAAACAACCTATTATTAAACCTTTGCAC ATCTAGCTCATGCCCGTAGCCAGGATTTTGATTGGGGGGGTTCTTTTTAA TGTTTGAGGGACCAGCGAGCGCCGTAGGCGCGAGACGAGTGCCGCTGGCG CGAGCTTCCTAGGGGGGTCCGGGGGTATGCCCCCCTGAAAATTTAAAAAA TGGAACCTTCTGATATGGCATTTTCTGTGTTTTTGAGAGGATTTCAAAGA AAGAAATCAGAGACAAAGTGAGCAGTTTTTCTTGGATTCCAGCCCCGCTG GTGATACAAATAAGTCCACCTTGAAAAAAAACTTGGACGTTAAAAAGTGG ACCTTCGAAAGTGTAAGATTTAAAAAATTGTACCATCTGAAAGGCCATTT CCTGTTTTTTTGAAAGGGTTTCAGAGGAAAAATCAGAGACAAAGTGAGCA GTTTTTATAGGATTCTAGCCTCTGTGGCCTTGCTGGTGATACAAATAAGC CCGCTTTGAAAAAAAATCTTGAACATTAAAAAGTGGACCTTCAAGCCTGT GAAAGTGGACCTTCAAGCCTGTGGGGGGTTCTTCCGAACCCCCCGAACCC CCCCTGGCTACGGGCATGTAGCTGAAAGCCTTCTTAAAGCTGTCCAGTGA AGATGCTCCTACTGTACTTGGTAACTAAAGGAGGAATTCTAGGGAAAAAT GAATCTTTGAACACCTCCATTCTGGGTTGATAACTCTGGCACGACTATTC CTAATATTCTTTTTCAAGCTGGTATTATCAGTGGGTGTGATTTATAAGTC ATTTTGTACATTATGCATGGTCTAGACATTTTTCTTCTCTATCTTCAATG CATAAAACATAGTAGATTTCCTTTGGGAGCGATGAAGTAGTTTTGAGCTG ACCCTCGCAGGTGTCCCTTATCCGCGCCGCTGTCCATCCATCACATTTTC CTGGATCAGGTTTCTCATGAATTATTCCGGGAAATGTTACAGGAATCCTC CCTGGAAAATCCACCGTTCCCACCATTCCTGCTGGCATTATTCTGTCTCA ACTTCCAGTAAAATGTTACAGGAATGCAGCCTGGAAAATCCACCATTCCT GTTAGCATTATTCTGCCCCAACTTCCAGGAAAATGTTACAGGAATCCAGA CTGGAAAGTCCATCATTCCTGTTAGCATTATTCTGCCCCAACTTCCAGGG AAATGTTACAGGAATCCAGACTGGAAAATCCACCATTCCTGTTAGCATTA TTTTGCCCCAACTTCCAGGGAAATGTTACAGGAATCCAGACTGGAAAGTC CACCGTTCCCACCATTCCTGTTAGCATTATTCTGCCCCAACTTCCAGGCA AATGTTGCAGGAATCCAGACTGGAAAGTCCACCGTTCCCACCATTCCTGT TAGCATTATTCTGCCCCAACTTCCAGGCAAATGTTGCAGGAATCCAGACT GGAAAGTCCACCGTTCCCACCATTCCTGTTAGCATTATTCTGCCCCAACT TCCAGGCAAATGTTGCAGGAATCCAGACTGGAAAGTCCACCGTTCCCACC ATTCCTGTTAGCATTATTCTGCCCCAACTTCCAGGAAAATGTTACAGGAA TCCATCCCAGAAAATCCACCGTTCCCGCCATTCTTTTTTGCATTATTCTT TCCCAAATTCCAGGAAAATGTTACGGGAATCCACCCTGGAAAATCCACCG TTCCCCACCATTCCTGCTGGCATTGCTCTGTCCCAACTTCCAGGAACATA CTTGTTTAAAAGCAGCTGAATCACACTTGGCAGGCCTGCAATATTATTAA CAGTGCTACATGATCGACATCTAGTTTCACAGACCAAGAAATTGGGACAA TGTTGCATCGCTTCATCCTCATGTGTTTGATGGCCAGATATATCACAACT GCCAGGCCAGTTATATGCCAAGCTGTCTGCTTGGGAAGGTTGGTTTAACA TGATTTAGGCTGAGGCACTGTTAAAGCTGTTTGTAGGCCCAGTGGCTGGT TATGTTTACAAAATAGAAGCTAATGATGATACCAATTATACACATGCAAT GTCAGCCAATGCTGAATTGCTGCAGGGTTTACAATCACATGATATACAAT AATACACATGATACATATTGGCACACTTGCACTTGCAAGCTGAGAGTACT GTATAACCACCCTTTATATATCTATAGGCCCTTAGCATTGGCTGGTTATG GTAAAACTGTTTAAGCTGTGTCAGTATAACCACCTTTTGCAGACCCATAG CAGTGGCTGTCTTTTATTGAACAACTTGTCAGGTCTGGCTCTAGGCACTG ATGAAGCTATGAGAATAACTGCCCTTTGCAAGCCAAGTGGCTGCATGGTT ATGTTAAAGCTCAGTATAACCACCCTTTGCAAGCCAAGTGGCGGGTTATG TTAAAGCTGTGAGTACCACCACCCTTTCCAGGCCCTTGGCATCAGCTGTT TGTATTACATGTCCTTTTATTGAACAACTTGTCAGGTCTGGCTGTAGGCA TTGTTGGAGCTGTGAGAATAGCTGCCCTTTGCAGTGGCAGGTTATATTAC AGCACGGCTAGCTGTAGGCGCTGACAGTGTTGTAATGAAGAGGCCGTCTG CAACAAACGATAAGCACGTCTCAGCAGACGGAATTTTTAAACACCTCATC ATGAGCAACTTTGACGTCTGTGGAAGTTTGATAATCGTCTGTCCAGCCGC GACGCAGACAGACGTGAGGCCTGAGGCGTTGCCAGGGCGANAGGCCCGCG GCGTTGCTAGGGCGATGGGAGGCCTGCGACGTGCAGCTTGTCCTGTGTTG GTTTGCAGGGCTGCAGGATTTGATTTTACTGCAGCTTCTCCAATGTTGGT TTGCATGGCTGCAGGGCTGCAGTTCAATTTTACGGCTGCAGTTTGATTTC ACTGCAGTCAATGTCAAGCCTTGGTTTATCTCTATTTGTTTCTGTATAGC CAGTATAACCGCCCTTCAGTGTAACACATCAGCTAGTTATATTACACTGA ACGACCTGTCACACCTAGCTTTTCCCCTAGCTAACTGCAAGCATTCTTTA AAGCTATCCAGCGAACTACTGTGTACTTGGTGATAATATCTCAATACGAC TTCACAGCTAGACTCTGTGGTTCGTTCATGCATTTGTTGCTTCAGCAGAC TGTTGGGAATAACGGTGGGCTATAAATACTCATGTTAGAAAATTATCGCC AGCAAATAGATTACACAAAGGAGCATAGTGCTTTTCCTAATCAGTGCAAC AGTCCGTCTGTTGCTTTGTGAAACCGGCAATCAGTCAGCCCGTCTGCAAA GGCTCCAACTGTGACTGCCCCAAATTCCAGGAAAATGTTACAGGAATAAA CCCTGGAAAATCCACCGTTCCCACCATTCTTGCTGGCATTATTCTGTCCA AACTTCCAGGGAAATGTTACAGGAATCCTCCCTGGAAAATCCACCGTTCC CACTATTTCTGCTGACATTGGTCTGCCCCAACTTCCAGGAACTCACTTGT TTAAAAGCAGCTGAATCACACTTGCTCATGCATTTGTTGCAATCAGTCAG TCCGTCTGCAAAGGCTCCAACTGTGACTTTGAGCCTTTGCTTACAGAGTT TAGAAGTGCAATTTCATGTCTTATTTTGGAAATTAGTTTACGATTCTGAT AATTTTCATGCTTCTGTTGCAGTGTAGTGCTGTTATGACTTATATGTGCA AATTGGACTGCATTGGCCTCGCGGCTTTCCTGGAGAAAAAGCAAGCAAAG AATGAGAATAGATATCATTTTCTATCATTATGTAGGCACAATTAAACATA CTTCTATCTCAGATGTCATATAGATAGAGAGAAATATATATATACGAATA GATATAGATATGTATAGATATAGTTAGATGGATATATAGCTAGATAGATG TTACACGGGTATACAGAAAAGCTGCAGCAAAATTCAACAGAATAGAATAT TCGATGTGCATTGGAGGTGCAGTATTGTTGGCACAGCAAGTGGGCTAGAT GGAGCCATAGATCTGAAGTAAATTCCAAAGATGTCAGAAACCCTCAGCGT GCTGTGAGTTGGATGGAAGCTCGGGAGAATTCCCGATTCCGACAGCGTTT GGAGAGATGAAGATTCCGGGCGCAGCACCCTTTGGACCCTCACTCGGGAA TTTGGAAGCATTTTAACATTCCGTGTGCATTTCGCACTAATGTAGCATTC CATATTCCACGGGCGTCGGATCAGTTTCCTCTCGGAATCCTGTGTTAGCC GGATATGCCTGTCACTGGGGACAGATCAGTAATGCTGGGGGTGGGGGTGG GTATGGCTGTCACTTGGGACCGATCAGTAATGCTGGGGGTGGGTGTGGCT GTCACTGGGGACTGATCAGTAATGCTGGGGGTNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAGTTTCCAGA CTCCCCAGTAACCATGGTTACCCTCCACTGTGAGTTTGCAGTCTCCCCAG TAACCGTGGTTACCCTTCACAGTGAGTTTCCAGTCTCCCCAGTAACCGTG GTTACCCTTCACAGTGAGTTTCCAGTCTCCCCAGTAACCGTGGTTACCCT CAACTGTGAGTTTCCAGTCTCCCCAGTAACCGTGGTTACCCTTCACAGTG AGTTTCCAGACTCCCCAGTAACCACGGTTACCCTTTATGTAATAGCCACA GGCTAGTTGGGCAGCCCTGGCTTTGCGTCCTGAACAGCCAAACCAATAAA ATGATAAAAAATTAAATGGTTACCCTCCACTGTAGTTTCCAGCAGGTTGC AGCCTGATACCTGGAGATCCCCCCAAACCCAAAGCTTCATTGTTATTTTG CTGCTGCTGCTGCTAAGTCCCCAAAGCCCTGCAGATCTCATAAATGGTTT GTCTCCATGGTGAGTATTTGAGTGCCTAAAGCCCTGTGGATCCACATTAA TGGCTCGTCTCCACTGCGAATATTAGTCAAACAATTCTGCTTCAGTCTGC AACCCTGGGGGAAACAATACCCATAAAGGAGCGGCATCATATTCTGCTCC ATCATCCATTATCGGCCGCGATGCTGGTTTATCATTAACGACTCCGATGC TGGTTTATCATTAACGGCTCCGATGCTGGTTTATCATTAACGCCCGCGAT GTTGGTTTATCATTAACGCCCGCGATGTTGGTTTATCATTAAAAGCCGCG ATGCTGGTTTATCATTATCAGCAGCAATGCTGGTTTATCATTAACGGCTG CGATGCTGATTTGTCATTAAAAGTCGCGATACTGGTTTATCATTATCAGC AGCGATGCTGGTTTATCATTATCAGCCGTGATGCTGGTTTATCATTAACG GCTCCAATGCTTGTTTAACATTGACGGCCACGATGCTGATTTATCATTAA CGGCCGCGATGCTGATTTTATCATTATCAGCCGTTATGCTGGTTTATCAT TAACGGTCGCAATGCAGGTTAATCATTAACGGCCACAATTTATCGTTAAC ACTAAGTAAAAGTTTCCCCCCTTACCATCAGCACATAGTGAAAGTTCCCC TCTTTACCATCAGCACAGAGTGAGAGGTGCCATCAGCACAATGTGAAAGT TGCCATCAGCATTAAGTGAAAGTTCCCCCTTACCATCAGCAGAAAGTGAC ATTTCTCCCTTCACCATCAGCACAAAGAAAAGCTCCCCTCTGTTACCATC AGCACAAAGTGAAAGTTCCATCTGCACCATCAGCACAAATTGAAGGTCCC CTCATTACCATCAGCAGAAAGTGAAATTTCCCCCTCACCATCAGCAGAAA GTGAAATTTCTCCCTTTACCATCAGCACAAAGAAAAGCTCCCCTCTGTTA CCATCAGCACAAAGTGAAAGTTCCCCCTTACCATCAGCACAAATTGAAAG TCCCCTCATTACCATCAGCAGAAAGTGAAAGTAACCATCTGCCCAGGCTG GCCCCAGATTTGTGGCCTCCATTTTGCGGGAAGTGAAGTCCAACGCCACC TGAGCCGCCTCGCTCGCTCGTTTGCTCGGGAGGTTAATTAGCAGGGAGAT TGCCTCATGAATCTGTCATGGCAACAACAGGAAACTTTCACCCCTAACAG ACAGCAACTTTCACTTGTAGACGTGGTAACATTGCTTTGTTGCGATTTCA ATAAAATAAATCATGTCTTGTGGTTTAATCTCATTTTGTGACGCTGTAGG TAATTTGATACCATGTTGGACAGTAGTTAAATCATGCTGTAGGTAATTAG ATACCAGGTTGGACTGTATGTAGTTGAACAGAGCCGTTACAGGGAGAGTT GAAGTTTTATGGTGTGAGGACCTCATTGTCAGTTCATATTGGCACGAGCC CAGAGCACCAGTCATGCCATCATTGGGCTGAATTTTGTTGCATGTTGAAA ACAGTTTTAAACCATTCACAATTAAGATCCATGAGTAAAGATGTAAAAAT GTCCAAATTTGAATAAGTTGGTAGAAGTTTGTTCAAGGTGACAGAAAAAA TAAGACTCTTTGTAGGATCTTTCTGTCAATGGGAATTGGGATGATGGAAA AAAATTCAATGCTCAAAGTATGAAGTTATTAGTATACACAAATGAGCTTA ACAGTGTTAGTTAATGTCACTACTGTAAAGATTTCAGCATTTCTTTATTT CCGTTTTCGGGGCCCTAATATTGCTTTGGGCCCCTTTAATTTGGACTCCA GTCAGCTCCACAGTGGTGAGGGTTCACATAGCTCTGATGAACAGCTCAGA AATTGGGCCACTTTTACTGCTGCTGTTATAGCTTTGGCCAAATGACATGG TTTTAATTGAAGTCATCCCTGCAGGATTGTAAGGGGCTGTAAAAACCCAT GGTCTGCTTGTCAACGGGAGGCTGTGTGTGCTTTCAACACAAATCACTAT TAGGGGTGGATACCGGTTCGCTGGACCTGAATCGGACCTTTATGACATCC AAGAACCGAGTCCAAAAAACCTGAAAGCTAAAACCCGAGTAAAAAAAAAC CTGAACAAAGTAAAACATTCATTTTTCAATTTTGTTTGATAGAAAGGGTT TTAAGACCCCTCTCTGCCAAAAAAGCATTTAAAATAAGTGCAACATTCAC ATATCAAACACTGGTTTGTCTTGAAAGTCTTTTCACCAACAAACTTTTAT AGTCGTGAGTGTCAGTATTGATTCTCTATGAAAATATTGGTCTGATAAAA CAAAACATCAACTGGACAGGATCAGGTCCAGGTTCAGGTCCGGACCTGAA CCTAAATCTCTGGACCTAAACTTGGACTTGGACCTTATTAAGCCGGACCG GTATCCACCCCTAATCACTACAAATACAGTAATTCTTGTTTCTTTCCCAG TGACTGTAACTTTATGTTCACTGTTATCACAGTCACCTCTGTGCCGTGAA CTTATCATCACCCTGAAAAAAACCTTCACACATCTGAAAATCTCTTGCCG CCACCGTGAAGTTAAAGTTCAGTGAAGTGTCCATTTTCCTTACACAGTGA AATTTTGCTACCGTGAAAATAAAGTGAATTACAGTATAGCAGGGCAGGAG ATCACTTAATGCCTATCTGTATTATCAACATTACTCTAATGTGAGAAGAT TGTTATCTCCATGAAAAATGGAGATATTGTTTTGGGTGTGTCTGTCTGTG TGTGTGTGTGTGTTTGTGTTTCCAGATGTTTGTAGTCAGCGTAACTCAAG AACGCCTGGATGGATTATGATGATATTTGGTTTGCGGGTAGGTGTTGGGG AGATAAAGGTCAAGGTTGATTTTGGGCTCCCTAGTATGTGACATTGGTAC TGCAGCAGATCTTCCTTAACTTTCTAAAATCTTTTGACCAGGATGTGCTA TGGTCTTGTTTGACTTGTAACCATGTGAATCTGTGTCTAGTCATGTTACA TATCTAATTTTCGGTGTTAGTTTGAGATCTATTGTATACAGACTTACCTC GATGAAGGTTAGACATCCTGCTAATAAGATATGCAAGAAAACAGTTAAGC AAGGTACAGAACGGTTACCTGACTCCATGGTCCCTCCCCAGTGTGGGGAA CTGTCTCTACTGTCTCTTTATGTGCCACAGTTTCTGCTGTGTTGTGCCAC ACAGTTACAGCCTTGTTCTGGTCACATTTTGTGCTTTGTTCTGGCCACAG TTTTGCCTTGTTCTGGCCACATTTTTTGCTTTGTTCTGGCCACAGTTTGC CTTGTCTTGGCCACATTTTGTGCTTTGTTCTGGCCACATTTTGTGCTTTG TTCTGGCCACAGTTTCAGCCTTGTTCTGGCCACATTTTGTGCTTTGTTCT GGCCACAGTTTCAGCCTTGTCTTGGCCACATTTTGTGCTTTGTTCTGGCC ACAGTTTTGTCTTGTCTTGGCTACATTTTGTGCTTTGTTCTGGCCACAGT TTTGTGCTTTGTTCTGGCCACATTTTCAGCCTTGTTCTGGCCACATTTTG TGCTTTGTTCTGGCCACATTTTTGCCTTGTTCTGGCCACATCTTGTGCTT TGTTCTGGCCACAGTTTCAGCCTTGTTCTGGCCAGAGTCTGTGCTGTGTC TTGGCCACAGTTTTTGCCTCGCTCTGGCCAGAGTCTGTGCTTTGTTGTGG CCACAGGTGTGTTATGCCGGCAGTAATGGGAAAGATGTTATCTGCCAAAC AGACGTGTGCAGAATAACAGGCCACTACTCTGTTATTGATGTGGATGCTG TCTGCAGTAATAGTAATGCGTCTGGGCTGCCGGATCGATACCTGTAAACC TACACCCGACAGCACAACAGTATAGCACACAAGTGGTACAATAATAGAAC AGATACCTGTAAACCTACGCTGGGCAGTGCGATAGTACAGCACACAAGTG GTACAATAATAGAACAGATACCTGTAAACCTACACCCGACAGCATAACAG TATAGCACACAAGAGGTACAATAATAGAACAGATACCTGTAAACCTACAC CCGACAGCACAACAGTATAGCACACATTCAGTGGTACAATAACAAAACAG ACACCTGTAAACCCACGCTGGGCAGTGCGACAGTACAGCACACAAGAGGT ACAATAATAGAACAGATTCCTGTAAACCTACACCGGGCAGTGCGATAGTA CAGCACACAATAATAGAACAGAAATAGAACAGTGAAAGTGTCAGTGAAAG TCTAAGACAATGATAAGCAGGAAAAGTGAAAGTGCCAGACATCACCAGCA GGAACAACTGTGCAGCAGCTTGGCTATTCTTGTTTCTCCTCGGGGTTGTG GTCTTAGACACTGCCGGGTCACAGAATCAGGAACTTGACGAAAGGAAATG TCTTATCTGCCAGCCCAGACTCTGATCTTTCTCCCCTCAAGTGGCTGAAG TGAGAAGGGAAGAAATGGCAACACTGTGGCAGTTCTACTGACAGAGGTGA TAGTGGCAGGTGATACACCTGTGTGTACAAATTTGATCTTACTGCTCGCA CAAAATGCTACCCTTAAGACACCCATACTTACTTCTTAAACTATAGGCAC AGCCCTTAAGACACCCGTACAACATGACAAGGTTATTGAGAGCTTTATTC CTTAAGACATTGGTCTTACATGTGAGGTTATTTCTTACATCCAGACAGAC CTGCTATTGAGATCCGCCTGAGGGTGTATAATCTATGATTCCAGTGGAAG TGTAGCATAACGTTAGAAGGTTTCAAGTTACTGAGCAGCAGTGGTGTCAA GTTACTGAGGAGCAGCAGTGGTATCAAGTTACTGAGGAGCAGCAGTGGTG TCAAGTTACTGAGGAGCAGCAGTGGTGTCAAGTTACTGAGGAGCAGCAGT GGTGTCAAGTTACTGAGGAGCAGCAGTGGTGTCAGATTTCAGGGACGAGC AAAGCTCCCATCAGAATATATTTCATACCAAACTGGATGGAAATGAACGC GGATAATCCCGACTGCAAGGACAGATTAATAGAAGGAAATAGCCTGTCAT ATTATCGGGGATGCAGCGGAGCGGAGCACTTCAGGGGGCTTTTTAATGAA ATCTTATTGCAAGTCCTTGTCCCACGGATAATTGAACGTGACGACAGGGG ATAGAGAAAGAATAACAACATTCAGGAAAGTGCAGGCTGTGATAATTGTG TACAGTTGGGTTATCTGTACGCTGCAGATACAAAACGTTCCACTTTCCCC GCTCCGCACAGTTGTATTTGACATTACTGTTAACAGGAAACATTATAGTA CAAAGTGTAGTAATAGAACAGAAATATTGATAATCTTTAAACAGAAAATG CTACTGTTACTTTTGGCAGCTCCTTCTGCTTTCGACTTTGCCCAGCTTTG AGCTTCCATCCACACAACACAACAGAACACAAAAATGAAAATTGACCAGT TAATATTGCATGTGCTCTCCATTCAACTGCACATAAACATGAGAGGCAAT TCCCCTGAGCTAACAGCCAGCAAACACCATGAGCCTGAGGGATGGGAACC GTGTCCAGCGAATTCCTGATGATTCACTCCAGCATTCCCCCCAGCATTCC GGCCTCATCTGCATTCCCGGGGGCGATGTTAGCCTTGGCTAAGAAACGCT GCTTCCGACGTCACATCATTCAGGCAGATTCCTGATGATTCACTCCAGCA TTCCGTCCAACATTCCGGCCTCATCTGCATTCCCCTGGGCGATGTTAGCC TTGGCTAAGAAACGCTGCTTCCGACGTCACATCATTCAGGCAGATTCCTG ATGATTCACTCCAGCATTCCGTCCAGCATTCCGGCCTCATCTGCATTCCC CTGGGCGATGTTAGCCTTGGCTAAGAAACGCTGCTTCCGACGTCACATCA TTCAGGCAGATTCCTGATGATTCACTCCAGCATTCCCCCCAGCATTCCGG CCTCATCTGCATTCCCCGGGGCGATGTTAGCCTTGGCTAAGAAACGCTGC TTCCGACGTCACATCATTCAGGCAGATTCCTGATGATTCACTCCAACATT CTGTCCAACATTCCGACCTCATCAGCATTCCCAGGGGCGATGTTAGCCTT GGCTAAGAAACGCCGCTTCCGACGTCACATCATTCAGGCAGATTCCTGAT GATTCACTCCAACATTCCCCCCAGCATTCCGACCTCATCTGCATTCCCCT GGGCGATGTTAGCCTTGGCTAAGAAACGCTGCTTCCAACGTCACATCATT CAGGCAGATTCCTGATGATTCACTCCAGCATTCCGTCCAACATTCCGACC TCATCTGCATTCCCCTGGGCGATGTTAGCCTTGGCTAAGAAACGCTGCTT CCGACGTCACATCATTCAGGCAGATTCCTGATGATTCACTCCAGCATTCC CCCCAGCATTCCGGCCTCATCTGCATTCCCCTGGGCGATGTTAGCCTTGG CTAAGAAACGCTGCTTCCAACGTCACATCATTCAGGCAGATTCCTGATGA TTCACTCCAGCATTCCGTCCAACATTCCGACCTCATCTGCATTCCCCTGG GCGATGTTAGCCTTGGCTAAGAAACGCTGCTTCCGACGTCACATCATTCA GGCAGATTCCTGATGAGCAGGTCGAGGCGGTCGATGTCAGGCTCGATGGA AACCACTGAAAACGCTGATTCATCATTCCTGCTGCCGGTCTGTAAACAGC AGGGGCTGCAGAGGAGGGGAATTATGTTTGTTATGTTTATAGCTATAACC TTTAGCCTTTATGAGGGTTCGGAGTAAAAATACATACAGACAATCATGCA AACATACAGGTAACAGAGTTAGAGGAAACATAGTATACATACTGTAAGAT ATACAGGAAACAAATTGTTGAGTCTTCGCGTTGGTTTTAAGTTTGCAGCA GCGTTATAGTCACATATACTGCTACAGTATGGGACAAAAATGTTCGGGTG GTTTTAAGTTCGCGGTGAAACGGTCGCCGCGAAAACCGCGAACATAAAAC CACCGCGACCATTTCTGCATCTACTGTATACAGAAAACAAATTGTTGACT TAAATTGTGAACAAAATGGTGGATAGCCTTTTTAAAGTTGGATGGACTGG ATAAAGATTTAGTGTTGGGTGGCAGGGTGTTTCAAAGAGCGATGTTACAG TAGAGAAAGGTTCACTTTTTGATGTTTATTTTAGATACTAGTAGTTTGAA ACGGTAGAAATTGGATAATCTGGTTGAGTCTGTCCTTAGATATCAGCATC AGACGTAGGAGTGGAATGTGAAGCTGCTATTCAAAGGGCATGGATGAGGG TCACTGCTAGAGCTCGGCCACGTCACTGCCTTACATGATGCTTAACTGGT GCAGACATCCTGATTCTTTAACTCCAAGTGTTCAATAACGATAAGTTTAT AACAGGTCTGACTTTTCCCAGTGGGCATCTTTGCAGCCCTGAATGTGAAG CCGTATTGACTATTCACAGCATGGATGAGGGTCAATGCTGGAGCTAGGCG ACGTCACTGCGTCACACGATGCTTAACTGGTGCAGACATCCTGATTCTTT AACTCCAAGTGTTCAATAACGATAAGTTTATAACCGGTGTGAGTTTTCCC ATTGGGCATCTTTCCAGCCCTGAATGTGAAGCCGTATTGACTATTCACAG CATGGATGAGAGTCGCTGCAAGAGCTAGGCAACGTACCTGCGTTACATGA TGCTTGTACATGTAAGTGTTGCAGAAATCCTGATTCTTTAACTCCAAGTG TTCGGTAAAGATAAGTTTATAACCGGTTTGAGCTTTCCCGGTGGGTATGT TGGCAGCCCTGAATGTGTCCTGATTCTTTAACTCCAAGTGTTCGGTAGCG ATAAGTTTATAACCGGTTTGAGCTTTCCCGGTGGGCATGTTGGCAGTCCT GAATGTGAAAGCGATGGCGGGGTTTGCCATTGACCTTCAGAATGATTGGA TTGCATTTTACTCCCTCATTAAAGGATTCCGTCTGCCCGAGGCGGAATGA CCGATGGGAATGATGGACATTAAATTCCATTGATTTTCCGGAGTCCAGAA GGCGAGCCTTTCATCAGGTTTACGCTGCGCTCTGGTTGGACGAGTCTTTG ATTTCCGTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNAGCAGATGGTTGATAATGTGCAGCAGATGCAGGACCAAGGCACATGG TCGATAATGTGCAGCATATGCAGGACCGAGGCATATGGTCGATAATGTGC AGCAGATGCAGGACCTAGGCACATGGTCGATAATGTGCAGCAGATGCAGG ACCTAGCAGATGGTTGATAATGTGCAGCAGATGCAGGACCAAGGCACATG GTCGATAATGTGCAGCATATGCAGGACCGAGGCATATGGTCGATAATGTG CAGCAGATGCAGGACCTAGGCACATGGTCGATAATGTGCAGCAGATGCAG GACCTAGCAGATGGTTGATAATGTGCAGCAGATGCAGATGGGCAATAATG TGCAGCAGATGCAGGACCTAGGCAGATGGTTGATACTATGCAGCAGATGC AGGACCTAGGCAGATGGTTGATAATGTGCAGCAGATGCAGATGGGCGATA ATGTGCAGCAGATGCAGTACCCAGGTAGATGGTTGATAATGAGCAGCGGA TGCAGATGGTTGATAATGTGCGGCAGATGTAGATGGTTTATGATGCGCAG CAGATGCAGTACCCATGCAGATGGCAGATAGTGTGCAGCAGATGCAGGAC CCATGCAGATGGTGGATAATGCGCAGCAGATGCAATTGGCGGATAATGTG CAGCAGATGCAGTACCCAGGCAGATGGTTGATAATATGCGGCAGATACAG GACCTAGCAGATGGTTAATAATGTGCAGCAGATGCAGTTGGTTGATAATG TGCAGCAGATGCAGATGGTTGATAATGTGCAGCAGATGCAGGACCCAGGT AGATGGTTGATAATGTGCGGCAGATGTAGATGGTTGATGATGTGCAGCAG ATGCATGACCCATGCAGATGGCGGATAGTGTGCAGCAGACACAGGACCCA TGCAGATGGTTGATAATGTGCAACAGATGCAGTTGGTGGATAATGTGCAG CAGATGCAGATAGTCGGTAATGTGTGTAAAGTTCCGCCGTTATTTGGTTT TTGTGACCTCCAGGAGTGTCCTATTGTTCCATCACAGTTCATGGCTGCAT TTGGAGCAATCAAACGGTTTCCAATATTCCATGGAAAATCCCATCCAGCC AACGATCACCAGGCATTGTATTTTCCTAGAATTATTGTTGAGTAGAATTC ATTGCCACAGTACAGTAGGAGCATCTTGCCTCGCTAGCTTTAAACACGCT TACACCTAGATGTGCAAAGTTAGTTGTGACAGGTTGTTCAGTGAATAAGG GGCAGATTCCTATGACAGCTCCACTAAAGAAGACCGAGTGCCTCAGTCGC GCTGCACATTACTGAAGCCCTGGTGCCTTCCGTAATGACCATCCTCGATG CTTATGAATGACTTCAGTGCCTTTACAAGGCCATGGCCGGTGTTGTCACA TTGTTGCAGTTCCCGTGATAAATTTCCCCACATATCCCAACATCAGACAA GCCCCAAACACAATACCTGAGACTGGTGGGTGTTTGAATGGTTGTTTGCC AGGATGAACCAGGGTGCCTATTCTGTGCGCTGAGCACAGAGCCCATTGCT TAAGTGTATGAATGTATCTATTATAGGCTTTTACATGAGAATAGCCATTT TTAGGTACAAGTCTATAATTTTACTGGAAATTGCAGTGTTGCCATTGAAT TGAACCAAAATGTACAATGATTCAAAACATTTTGGATGATGATGTGACGG CGCAATACATTGTTGCAGTCCCTGTGACAAATTTCCCCACATATCCCAAC ATCAGACAAAGCCCAAACACAATACCTGAGACTGGTGGAAGTGTTTGAAT GGCTTTTGCCAGGATGAATAAAATGTTTAGCGATCAGGGTTCCTGTTTAG TGCCCTGAGCACAGAGCTCAGTGTAGTGAATATACAAATCTATCAATCAT ATAGGCTTTTACATCTAAAACTTCTAAAGATAGGCTTCATAGAACATCCT AGCATTACTTTCTCCTGATTTGTTTGTTTTCCTTGTTTTCCACTTTTTCT CTGATATTTGATAACTGTTATCAAATATCAGAGGAAAACTGTTACAGAAT AATTCATTCAGTTATTATTTTTGTACAATTTTGATCTATTTCTTTATAAA TTGAAAACTATGTTTAACATTGATCATGTATAACGTAATCACATTTATTA TCTTCTTCTTTTATATTTATTATATAGTGTAATCATACTTATTATGTTTG GAACTCAAAACTCATTTTGTTATTCCTCTTCTCTTTGATTTGTTTCATTA GGAATTATCATGGTATAATTTCGTTTTTTTTTTCTTTTGTTGATTTTGCT TAGTTTTGATTATGTGCGGTTAAAAAATTGTCCAGGATATTTGGAGTTTC TTTTATCACAACCAGGAATCTCACCTGCTGACGATTCCTGGTTGCGATAA AAGAAACTCCAAATATCCTATGTTCTATCAACCTGATGAAATTATTTTCG GGATTCCTATTGTCTAGTTTTAAGGGAAGGCCCACGAAAACCCACATAGG CTTCTGGACAAGAACCAGAAGTCCTGGGTTCAAATCCTGACTTGCCTCTG CTGTTGTGCCCTTGGAAAAGGCACTTTTTATTACACGACCTTCCTTACTC CACCCAGGTGTAAAAATGGGTCGACTTCAGTTGGGGAGGTAAAAGGCAGT GGAAGGAGAGGGTTGGGCTCCGCCTTCCAATACTGAGCAGACCAGTTGAC CATTACAGAAGACAACACACTGTTTAGCCATTCCCCCCATGTCCGTTACA GGAGAAATAATTACCAGGGTGGGAGGTTTTGAAAAATCTATTGACTCTTG GACTTGTCGTGTTGGTGTAATAGTCAGGGTATTTGTGCTGGATTCAAGTC CCCGGACATGCCCTTGGGAAAGGCACTTTACATGACTTTCCTCACTCCAC TCAGGTGTTAAATGGGTATGTGACTTTGCTTGGGGAGGTAAAAGGCAGTG GAAGGAGAGGGTTGGGCTCCACCTTCCAATACCGTGCCCTAGACAATGGT GGATAGCAACCCACTGCCCCTACGGCCTCAAAAAGGCTGTGGTACTGTAC TACCTAATACCTACCTTTTTGCGTTTGGAGTGGCCAGCTGTGAAGTTAAG GGAGCTGAGTTCAAGTTCAAGTGAAACCCTGTTACAGGTTACTACCCCTA CCAACAGATCGTGACTTTGATTCTATGGATTATCAATTTGACTCCCTGTC ATCCTCTCATTCCATTGCCCAAATGGAAGTTTATTGCGGTCTGAAATCGG ATTGGAGACCTTCCATCAAGCCTCCCCTTCCTGTGAGGCTGGGAAAAATT GAATCTAGCTGCCGACATATTGCTCTTTAGATTGGGTCAAAGTCAATGAC AAGATTTTCCTGTTACATTTAGTTTCCAACATAACATACCGTTCTTTAGA TTCGGAGCAAAGTCAATGACGAGATTTTGCAGTTCCATCTAGTTTCCAAC ATAACGATCTTTAGATTGGGAATAAAGTCAACGCAGAGATTTTACTGTTG GATCTAGCTGCTGACATAACGATCTTTAGATCGGGAATAAAATCAATGCA GAGATTTTACTGTTGGATCTAGCTGCTGACATAACATTCTTTCCATCGGG AACAAAGCAATTGATGAGATGTTACTGTAGTTTTATCTAGATGCCAACGT AACGTTCTTTAGACCGAGAACAAAGCAAATGACAAGATTTATTGTGCATT TCGTTCTTTAAATTGGGAGTAAAGCCAATTACGAGATTTTACTATTATAT AATTGCATCTAGCTTCCAATATAACACTCTTTAGATCAGGAACAAAGTCA ATGAAGAGATTTTACCGTTGCATCTAGCTTCCAACATGACGCTCTTTCCA TTGGGAGCAAAGCCAATGACCAGATTTTACTGGTGATGCCTCGTGCTTCC AACGGCGTTGTCATGTCTGGTCTGCTGGGCTTTGTGTGGAATTGATGGTC GTTGGGCGTCCTAGCTCGGTCATCACTAACAATGTACCGCATCATTCCGC GTGGACCATGGACTAGATGATGAAGTACCTTAATTGTACCATGTCTCTAA GGGCTAGGTACAGGTACAGGTAGTGAAACGTATGTATGACTTATATATTA TACATGACTTAAACATACATAGTAGATAGATATGAGCTAGCTGAGTACAG TCAACTTCTTCTGGCTTCCTTGTACAAGTGAGGACGTGGGATAATATCTC TTGTACAGAGTTGTCTACAGCAATCATCAAGTCAAGTCAAGTCAAGTCAA AGCCTTTATTTTACTTCGAATGCTTGTTCGGCCATAATATGGCCGCTTTT CGACAAGGTCGAAGTGAAACGGAGGGGCAGGAGTCACGGTACAATAATAA ACTTAACGTAAACTTAACGTAACCGATATCAATACAATCATCAGTCACCA TATCTACTCTTCCGGGATAGGAAAGTCTGCAGTATGGCTTAGCAGCGCTC CCTAGCAGATGTGCCTATAACAACAGCTAGGTCCCATATGTACCCTGCTA CATGTATATGCCTAGAACATACAATGTTCACTTGTAAACCTCAGTTCACT GCTTTCGGTATGCCTTGAAATTCCACACTTGGAACGCCAACTAGAATGCC AAGGAAAGGATAGAGAAATGGCTACAAACTAAGAGTAAGACTCTCACAGT TGTAGAAGGGGAAATATGGGAGGGAAGTGTTTAATATGATCTCTAAGGGT GTTTCTGCTTGAAAAGACTAGACTCCTTGGAATGGTATATCGTGGTCCCA TGGTCAAGCTGGGAGATAAGTAAGATGAGACGAGACTTCTGTCTGGAGAA GCAGCGGCTACAGGTTGTATGGGTACAGCTGTTCGACTCACACCAGCTAC AGGTACATGTTTGATCTATTCCTTCACTCACAACACATTTCTGCAGGTGG TTGCAAATATACAACAAAGTGTGGAAGTGGATTTCGAGTGGCTGTGAACG CTGTAATTATCAGTAGAATTTGTGATAATTTTGGTTTTTTTTTCTTCTAA ACAAATTGCTTTATTCTGCAGGTGATTGTTGCAGTAAGATAGCTGCTAAG GATGGATGCAACATCCACTGCCAACATTCAGCTGCAAAGTGCTGAAAATT TTTATTCCTTTCAGGTCTTTTATATGAGGAAAAGTAGATCTCAATTTAAC TATGACCTGTTCAAGTTTTCAGGTGGCTCTACCATGTTTCACTTTCAAGT GGTTTCATCACCTGTGCAAGTCTGTTGGTGGTTTTCAGGTGGCTGTGAGA ATCCCCTATCCAGGTTTGAAGGTGGTTTTCAGTCGGCAGTGTGAAAATGA CCTGTGGAAGTTTGCCCTGACAGGCTGTTTCCATCCATCTGCAGATGTTC ACTAAGTCTTAGTACATTAAGTGCTAAATTTTGTGGGGTCGTGTGGCGCA ACGGCAGAGCGTTCGACTCAGAACCAAGAGGTCCCGAGTTCGAATCCTGT CATGTCACCGATCTTGTGCCCTTGGGAAAGGCACTTTACACGACTTTCCT CACTCCACCCAGGTGTAAATGGGTACCTGACTTCGGTTGGGGAAAGTCGT ATTGAGGTCACCTGGTGGCGCCGAATGGCAGCCGCCCAGACCCTTGCGAC AGTTCCACAAAATGCAAGTGTGGATAAGATATTATATGTTGTGTATTATG TGAAACCTGCAGAACCCTGCATCAATTCAGCGCTAGAAAGGCGGCCATTG CGGGTAATTTCTGACCAATAAAAACCAATTTGACTTGTCAGTGTTAAGCC TTCTCCTTTACTTTTCAGGTCTTCATTAGGTGCGAGCAGTGCTGTACTGG TTTACCTTTATGTTGTTTGTGTGTTAATGTTTTTGTTTACTGGTTCAGGT GTTCACTAGGTATGGGACCTGCTGTACTTCTTTGTGTATATGTATACTGT TTGTGTTTATCGTTTTTCTGTTTCAGGTCTTTACTGGGAACGGGAAGAGC TATATACACTTGTTTATTTTTTACCTTTTCAGGTCTTCACTCTGTATGGG AACTGCTGTACTTTTTCAGTACTTCACTAGGTGAAAAAAGTGCTGAACGT GTTTGTGTTAATTGTTTATTGCTTACTGTTACAGGTGTTTACTAGGTATG GGATGAGACGTGGTGTTCTTGTTTTTGCTTATGTTTATCATTAACTGTTT CAGGTGTACTATAGGTGTGAGAAGTGCTGTACTTGTTTATGTTTACTGTT TCAGGTCTTCACTAGGTAAGAAAAGTGTAGTATTTGTTTATGTTTACTGT TTGTGTTTATTGTTTGTTGTTTACTGTTCCAGGTGTTTACTAGGTATGGG AAGTGCTATACCTTCAACTCCGGGACGCCGAACCAGCCCGTGCTGAAAAC ACTGAAGGGCGGCATCGGCAACGGGGTGGAGTTTTTCCTGGACGTGCAGC AAGACGACTACATGCCTGCATGGGGGGAGTCAGGTCAGTAAACAACAAAC AATAACAGTAAACAATAATAGACAAGACGACTACATGCCTGCATGGGGGG AGTCAGGTCAGTAAACAACAAACAATAACAGTAAACAATAATAGACAAGA CGACTACATGCCTGCATGGGGGGAGTCAGGTCAGTAAACAATAGACAACA ACAGTTAACAATAAAAAATAACACTAAATAATAAGCAAGACTACATGCCT GCATGGGGGGAGTCAGGTGAGCAACAACGAAACTAACAAAACTTATATTA AAAAGTCTGCTATGGAGCCCAACCCTACACAATTTAATCTTCTTTCAAGA GCTATTTATTACTCCAAGGTCATGACCGTAGCATGTCCAGAACAGGACAT ATCAAAACCGAAAATTCGTCTGCAGTACCATAGAAAGTTAGGGGGTGTGT GCAAAATCTAATCATTTCACAAATTTCATCAAGACCTACTCACATACCAA ATATCAACGAAGACAATCCACTCAGGTATTCTCGAGTTATTGTGTTCACA CACAGACAGACACGTGCAACCGAAAACTTAACCTTCTAGGCAAAGTTAAC AAGGTTATCATTTGTCATGGTAACAAAGTTTTGGTCGTGCATGGTAACTA AATTTTGGTCATTATATGAAAATTTTAGCCATGGTAACAAAGTTTTGGTC ATTAGAAGAAAGTTGTGGTCATGATAACAAAATTCTGAATCAGTAGAATG ATTCCAAAGAAATTAGATAGTGTTGTCATTTGAAATGTTAAAACTGTAAA CCTGATTGCTTTGATTTGGGAAATTCACTTTTGTTTATCTTGCCAAGAAC AATAAATGTGAATAGAAGGCTTCCAAAACATGGTATGAATAAAGTTTAGA AGTTAGTTTCCAAATTTGGCCTGACTCATGTGAGCCATCATATGGTGCCA CAAATTTAGTTATAAGCTGACATCATCTCAAAACCAACTATTACTGTGTA GTCCTTTTGCCATAGATCTAGATTCTTGTAATACATGTTTCTGTAGTAGC TGTGATGTGTGCTGTCACCTGTACACCACATATTCTCCAAATGTTGTACC CACTGCCAAAGTGCCAATATTTGCATCACATAAGCACAATGTTTGCTTCC CATTGGCATTAAGCCTGATTCCAGGCTCAGGAGATACTGGACTTTATTGG AGTACAACTCCCTCCTTTATGCTGTAGCCCTTATATTTAATCAAGACACA ATCTTCTAGGGACACAGTGAACTACAGGTTTTCACTGACTTGTAGGCAAA ACATGCCACAAATTCTGTAAAGGACATATGTCACCTCAATGTCTGACAAG TTGAAACAGCAGTTGATAAATGAATAATAATAAATCAAATGTTTTTTTGT TGGTCAGAAATTACCTGTGCAATAGCAGCATTTCTAGTGCTGAATTGATG ACATTTGTATTAATGATTACTACTTAGTAAATGGAACTTGCAGACTCCCC TGGCATGTTCCATCAGACTCCTGGAGGGCCAGTAAGTTAGTGGTGAGATT TAGTCAGACCAGCTGCCCAGCAAGGTAGTACTGTAATTCACTTAATCTTC ATGGTAGCAAAATTTGACGATTTAAGGAAAATGGACATTTTTACTGAAAT TTAACTTCACGGTGGCGGCAAGTGATTTACAGAACGGATGTGTGAAGGAA TCAAAAATAATAACAACAAGTTTTTCACGGTGATGATAAGTTCACGGTAC ATAGGTGACCGTGAAAACAGTGAAGTTACAGTGAAAGAAACAAGACTTAC AGTACATTGCTGTTTGTCGGTAGTACACTAGTCTGTTGTTATTACCTGTG CAATGGCAGTGTTTCTAGTGCTGAATTGATGACATTTGCATTAAGGATCA TGTTCTTAGTAATTAGAATTGGCAGACTCCCCTGGCATTTTTCATCAGAC TACAAGATGGCCAGTAAGTCAGGGATGAGAGTTAGTCAGACCAGCAGTAG TGTTGGTAGTATATTGTTGTTTGCCGCTAGTACAATGTTTGTCTTCTCTG CACGGCTTTGTCTACACATGGTCTTTTTCAGATGAGGTAACCTTTGAGGT GGGCCTGAAGGTGCAACTGCACACGCAAGAGGAGCCGCCCTTCATACATG AATTGGGGTTTGGCGTTGGGCCTGAGCACCAGTATTTCCTTATGACCCAA GAACAGAGGGTACAGTGTTTCCCGTACTAGCCGTGTGTGCGTGTGTGTAT TAACCCAGTACTGCCTCTCCCCACAGATGAAGTAACGTTTGAGGTCGGAT TCAAGATACAGCTGCACACGCAAGAGGAGCCACCCTTCATTCATGAACTG GGCTTTGGCGTGGGGCCGGGCATGCAGTATTACGTTTCAACACAAGAGCA GAGGGTACAGTTCCCTTCTAAATCCTCACCAACAACAGCCTTGAGCTGCA GATGACCGGAATCCACTTCCTCGACCTCAACTCGAGACGTCTTAGCTTCT CCTGGGCCTTAGAAAAGTTCACCTGGCATAAATGAGGTTTTCTCCTCGAA ATAGCATGTAGCCATAGCAACAACAGGTCAAGGTTCAACTGCAGAGGGAC TGTTTGCTTTGTTTGTGTGTAATCTATGATGACCGACAATGACAGTTTCT GCATGACTTAGTTCGGTTGCGGCTGACTGTAGGAGATTGGAACTTTACCC AATTCCGTATACTGCATGGGTACATGTGAAATCTGTTAGAAGCAAAGAAA ACAACTTCATGTCTGAACACTTTGCAGTTACTGTATCGAAACAAGTAGCA TAGTAGAACAGCTGTATTATTATCAATTGGTGTTAAAGTGCATGTGGAAC CTGTGTGTACAGCCACAGGACAGAGCTCTAACCTCCCATTGTCAGCTCAA CCAACTTTGCTGCTTTCCCCTTCCTCTGGGCACGGCAGGGTTTGAACATG CCAGCAGGCACAAATGCTGTTCACAGCTCAAAAGGAAACCAGATTTGGCT CACATCTGAAATGTAGTTGGTTGTGAACCATGGTCAATATTGAGTGATGA AGGCCATAGTGGTCAGTATTGACTGACAAAAGCTATCATGATAGTGGTCA ATACTGACTGACAAAGGCTGTTTAAGACCAAAATGTATTTACCCTGCCCT GACCCCGCTGCTGCTCCTGCTAACTTCCTGATGCGACTCTTCACTCTCTA CATGTCCTCTTGATGTTCACCACTTGTTCTGCATCGCCCCCCCCCCCTCC TGGCAATGCTTCTCTAACATAACATTGACATTTATTTGCAGGAGACACAT CTTACACCATCCTATATAGAAAATAAGATTCAGAACAGAATTTCTGNGCT TCACAACCTCGACGTCGACTTAGCTTCTCCTGGGCCTTAGAAAAGTTCAC TTGGCATAAATGAGGTTTTCTCCTCGAAATAGCATGTAGCCATAGCAACA ACAGGGCAAGGTTCAACCGCAGAGGGACAGTTTGCTTTTTTTGAGTGTAA TCTACATGTATGATGACCGACAATGACAGTTTCTGCATGACTTAGTTCGG TTGCGGCTGACTGTAGGAGATTGGATTTTGCCTGATGCTTTTTTGCTAAA AGCTCTCAGCTTAACTCTTCCAACACAATTTCATATACTGCATGGGTAGA TGTGAAATCTACAATTTTACTAAAAAGTCAGAAGCAAATAATACAACTTC ACATTTGAACCATTGCAGTATCAAAACAAGTCGCATAGTAGAGCAGCTGT ATTATTAGCAACTAGTATTGCAGTGCATGTGGAACATATTGTGTGTACAG ACATTTGAGTGCAGACAGGACAGAGCTCTAACCTTCCACTGTCAGCTCAA CCAACTTTGCTGCTTTTCTCCCCTCTGGGCACGGCAGGGTCAGGTAGATG TAAGGCTTATAATCCCAAGAACATTTGCACTCTGATTTTTAACCTTTCCA AAAGGTTCAACTAAGGCTCAAGAGGGCTTGAGTCAAATTCTGGTTGGAAA GTCAAAACTGTACATCAGGTGCAAAATATTTCCTTGGTCCGAGGTGGTTA CCAAGTTTTCTGCACCTGAGTTTTCAAGGCTGTTCCAAATTTAACAGTGA TTTTTAGGACCAGGCTACAGCCTAGGTCACAAATTCATCACAAAATTCAT ATGTGAAAATCATCAGAGCAAACTGATTTGCATGCAGTAAAGGAACTTTT GTTCAGATGTCCACAGTGACAGCCATTGTTTGAACACGCTAGCGGGCTCA CACGCTCTACACAACTAAAAAAGAGACCAAATTTGACTCACACTATACTT AAAGTTGGTTTTCAACCATGGTCAAGATTGACTGACAAAAGCCATTATGA CAGTGGTCAATACTGACTGACAAAGGCTGTATAACACTGAAATGCTTTCA GACATTTGCCCTTCCCTGACCCCGCTGCCACTCCTGCTAACCTCCTGATG CTTCACTCTCTACATTTACATTTCCTCAAGATGCTCACTTGTTCACCACT TGTTCTGCATTTCCTTCCTGCCCCCTCCCCCCCCTCCTGGCAATGCTTGT CTAACATAACATTGACATTTATTTGCAGGAGACACATCTTCCACAATCCT TAGTAGCTATATAGAACATAAAATTCAGAACAGAATTCCTGCTTTAACTC ATGTTTGATAAAGTGAGTTTGCTATCACACTAGACATGATATAGCAAAAT GCTAGCCTTTAAAAGGTAGCATGAAAAGTGCCCCCTACCTTTTTCTATTG GCACTGCAGGAACATCACTAGCTCCCCCAATAACCTGGGGAAAAACTTTA GGACTGCAGCTAAATTTCACACAAGCGCTTTCACACTAACACCTTATCCT ACATCCAAACTCAACAACCTACATTCACACTAACACTCTATCCTATAACC AACAACCAAAATTCAAAGCCATTGCCCTTAATCAACCGGTCTACACTAGC ATTTTCCTTCATTAACTAGACATGCTCAACTGACAAATAATGAACCTTTT CTACCTTCACTGCTCTCCTCTGATATTCTGTCCCTTTTTACTGAACAGAC ACATGATGTTTCACTACCATCACGTGTCTGTTAAACTATACTGTTGCTGC TAGATGGTAAATCTATGGAGTCAGCTGGATATGTGCATCATAGTCAACCA ATCATGGAAACTTGTTTGTTTGTATTCAATTTGAATAACTACTTAACTGC CTCATGTCGTAACACACCAGGTTTGTACTGAAGAGTACAAGCCGCATATC CGGACAGATATATTTGATTAACTCACACCGGGAAGGGCCCCTACTCTTAT TGATAAGTGTGGTGGGTTCTTTTACGTGCTCAATTGTGACCCAAAAGATG CACATTTCCAGCAGAGATAATGCTCCTAACTTTTCTCAGTGCCGTACAAG TCACATGTTTTTGACAATGGGACGACTGCCTTTTCTTGACATGCATGTTT CTGCTGCAATGGCTAGGGGACTGGCGACTTGACCTACGACCCGGCTCATG ACTTTTGATCGACCTTATTTTCCAGATCACCTATCTGCCCGCGCCCTGGG GTCAGTGTAAGGCCGAGAACGACCTGACCTTTGACTTTGCCAAGTACACG ACGTCCGCCTGTCGAATTGACTGCGAGACCAAGTTTGTGGTGAGCCAGTG CGGCTGCAAGATGGTGCACATGCCAGGTACTGTGTCTCTCTTTCTCTCAC TCACTCACTCACTCACTCACTCACTCACTCACTCACTCACTCACACTCAC TCACACTCACTCACACTCACACTCACTCACACTCACTCACTCACTCACTC TCACTCACTCACTCACTCTCACTCACTCACTCACTCACACTCACTCACTC ACTCACTCACTGTCTAACTCAAGCCTTGTCACAACACAGTAAACTTTCAC AGAGACCAAGTTTGTGGTGAGCATGCATACTGTGTCTCTCTTTCACTCAC TCTTTCTCTCACTCACTAACAGTCACACACACACACTCACTCACTCACTC ACTCACTCACTCACTCTCACTCATTCACTCACTCACTCATTCACTAACTC ACTGTCTAATTCAAGCCATGTCACAACACAGTAAACTTTCGTACATTACA GAGATCAAGTTTGAGGTAAGCCAGTGCACAGCATACTTCACTCAGAATCT GTACATGCCCGGTACCTATAAAGAAATGTCAGAAGACAATAAACTGTTGT GCACATACATTGTACATGTAGAAAAGTTGTTTTAAACAAAGAACCAATAT TTTCTTCAGGAGTTCTGGTAGTTTTCAATTTCAATGATGTAGTTATGGCT GCTTGTTAAGACCTAACATGCACATATATAACTTAATTGCACAACAATTG TACAAGGCACAAAGTATGGCAATTACATTTAAAATTCTTGCTGTTTTCCC ATTTCTGCAGGATCGTTTCCCATCTGCACTCCGGATGTTTATGTGGAGTG TGCCGACCAGGCTCTCGGTAAGGACGCCTTCTTTCCTCAGACTGTTTTAA AACCCTTGTCCTGCAGGAAGCTTATATAATAATATTATAGGCTCTCTTTA TAGCCTGTGTGTGGGTCCTGTATTTGTACGGGTTAGGGGTATTTTTCAGC TGAATGCATCACACCTCAGTGATACGCCCTGAATGCGGAAGCAACAATGC CATCGCAGCGCAGAAAAAGTCAAGGGAAAATGACCTGATTAAGAAATCAA ATTAATGAAATAGATTGTGTAAAAAAAATAAGCAGGACAAGGGTTAACTC TGTTGGTTTCTGAGCAGCAGTGTCCATGGGAATTTCCTTGGTACAATCAA GGACATTATATATAATGTCTTTGGTACAAAGAACCTGTAAATACTGTACA TAGGCTCAGAGCTTCAGAGTGTCTTCTCTGCCACGACCAGTGGAAGAATA ACTCTTCAGTCAGCTAATTATAACTGGATGAATATCATAACGATCACTAA GAATGAATAGCTTACTTGCTCAGGCAACATGGAAGTGAAACTCACAGGTC TTGCTAATTTTTCCTGTAGATTTTCTGGTGAAGTCGGACAACAAGAAGTG TGTGTGCGACACGCCCTGCAACACAACGCGCTACAACCTGTTTATGTCTC ATGTCAAGTTCCCCAGCGAGCAAGCCGTCAAGTATCTGGCTAGAAAGTAT GCCAAGCGCGAAGATTACTTCAGGTGAGTGCGAATGTGGCTTCAAGCGAG TGTGAATGTGCATGGCAAGTTTGCATACTACTTCAAGTGCACATGAGTGC AAATGTGTCTTCAAGTGAGTGTGAATGTGAACTGTATGTCTGAAAACTAC TTCATGTGAGTGTGAATGTGCCTTTGGGTGAGTGTGAATGTGCATGGCAA GTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGG CTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAG GTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTG AATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCAT GGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCT GTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTAC TTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGA GTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATG TGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCA AGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAG GCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCA GGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGT GAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCA TGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTC TGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTA CTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTG AGTGTGAATGTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAAT GTGCATGGCAAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGC AAGTCTGTAGGCTACTTCAGGTGAGTGTGAATGTGCATGGCAAGTCTGTA GGCTACTTCACGTAAGTGTGAATGTGCATGACAAGTCTGTAGGCTACTTC ACGTGAGTTTGAATGTGCACGGCATGTGTTGTTTACTTTTTGTTTGTCAA GATTGTTGGCATGCTAAGACCAGTTGTTGTTGGCTTTGGTGAGCCATAAT GTAGGGACTTTTGCTGTAGAAGCTTGTAGTTTGTAGTTGCTGAAGTGGGG GAACCGCAAAATGTAACTGATTTTCCAGAAAGAGATTTAAGGTTATTGTT TTTGGTAAAAATTGAAAAGTGGACAGAAAAAGTCTTCACAAGAAATTGAA CAGAAAAAGTTACAGAGAAATCATGCATAGATTTTCAAACATTATAATCT GAAGCCGTGCAGGCTTTTTGCAGGCTATGAAATATTATAAATATAATATT ATAAAAAAATTATAATATTATAATATTACAAAGTCTAAGCGGAAAGCCCT TATTGTAACCTGAATTCAGATATTGACAAAAAAGCAATGATAACAGTTTT AGATTATAGTCCTGCATGAATTTCCCTCCTAGGAAAATTTTGTATTACAA TTTATCGCTATAGTGGCTGGAAGGATATTTATGGCTTTCACAGTCTGCAT GTGGTTCCCCCCTTTGCTGAAACCCAGCGCTAACCCAGCTACATGACCCA ACGTGACCTTTAGTCCGAAACAAACTGTGGCTGCGAGCTCAGAGAATGTC CATCATGCATGTCCCGCCAGTAGTGGGTAGAACCTCATGATCCAAAGACT AGAACAAAAAAACCTCCCAGGGTATTCTCTTCTTCACACACAGGAAAAAC ACCCTGGTTTTGAACGTCTTCTTCGAAGCACTGAACTACGAAACTATCGA GCAGCAAAAGGCCTACGAGGTCGCTTCTCTCCTCGGTAGGTGTGGGTGTG TAGACTAGCGCGTGTTGTGTCGTGGCGTAATGTTGTGGGTCGTTCTGTGT CTCTCTCTCCTCGCACAGGAAGAACACTCTGGTGATGAATATCTTCTTCG AGGCGCTAAACTATGAAACTATTGAACAGCAAAAGGCCTATGAGGTAGCC TCCCTGCTGGGTGAGTCTCGCGAGTTGTCCATCATCCCCCTCCCACCCCT GCAGTCGCATGGCAATGGAATCTTCCACAAGCCCGACCAATGGAATTGGG TAGACGAGGAACAGACCATGTTGACTCTTAGGGGGATGTCTTGTCAAAAA GTTTTGTTTTTCATATATAAATTACTGATAAAAACGTTTATTATACCATG TTTTTGAAAAAAGTTTATAATACCACATTTGAGAAAATGTTTATTATACC ATGTTTGTAAACCTTTATTACACCATGTTTGTAAAAACTGAATTACTTTG TTTGAGATGCATACTGGGACTCGACACCCCCCTCTAGTCATCAGTGGTTC TTCCTGAGTCAAGTTCTGCCTCTGACTTTGGCATGTTACTGATGCATGGC CAATCACAAGACCCTTCCTCTCCCTGCCCAACACAAGACCCCCCTACCCA ACACAAGACCCCCCCAGCTGAACACCAAGAGCCCACGGCTGAATAGAAGA TCACCCCTATCCGCCCAACACAAGACCCCCCCCCTGCTGTCCTTCATACT GATATCTTCCTTTTTCAGCTGCAGTTGCAGAGCTGTCTCCTCCGGGCACA AGATGGTTACAGGGTGTACATGTACATGTACTACTCCCAAATGTACTACT GTAAATGCAGAGATGTTGCAATGGTTTTGTTTTTGTGGTAAAGTCGCAAA ATTGAAACCGCCGCAAAAAGCCGTTCCACTGTGTGAGTGTAGCGCTACTA ATGTTGCAAATGTGAACTCAAAACTACCGCAAACAATCCATTTTCTCAGT ACTGTAAAATTAAATCCTTGCGAACATTTCTGCATTTACAGTGATTCATG AGCATACAGGCCAAACAAACTGCAGAGATGACATGGACAAACCCATGGGT TTGTACTGACATATTAGGGAGTGGTACCAAAATTTGGGATTTGTGCTAAT ATATCTGGGACTTGTACCATGAAAAAATGAATGTCACCTGTAAAAATTTT TTATATTTGCCGATAGTAATAGTTGTCAAAAGGACCCCTGACCTCCTCCC TTGAACTCTGGAAGAACGGCTTAGGCCGAAGAGTGCATCTGTATACAGTA CTCTCAAGGTTATATAAAGGTTGAAAAAAAAAAAAAAAAAAACTTGTTTG TGTGGCCCTGTATGACTGGGCATACTAAACCCTGGACATGTCACGTTGCT GGAATCCATTTGTTAAACACTCTTATGCTTACCTCACCCCACTCTGATAA ACAGTTACTCACCTGCACTTATTGATCATGCTAATAAGAACCAACCTGAT TGACTTACCTGACCTTTATCTGACCCCTGACCTTTGTCCCTTGCCCTCCT CAGGTGACATTGGTGGACAAATGGGCCTGTTCATAGGCGCCAGTATCCTG ACTATTCTGGAGCTCTTCGACTACCTCTATGAGGTGGGACTTGCCTGACC TTTATCTGACCCCTGACCTTTGCCCCTTGCCCTCCTCAGGTGACATTGGT GGACAAATGGGCCTGTTCATAGGCGCCAGCATCCTGACTATCCTGGAGCT CTTCGACTACCTCTATGAGGTGGGTACAATCACTTGAATTTCTGTTTGGT TTTGTTTGTTTCATTTATTGTTTATTTGCATATTACGTACTTTTTATTTA TTTGCTCTACTGTGTACAATGTACAGCAGCCAAGGCTGCCCGACTAGCTA TTGCTATTACAAGGGGCCAGCCTTGCTGCAAAAGTACATGATGAAATACA ATAGTTGCATAAGTTAAAAATAAATCATACACACATACAATCATACAACT CTTACCGTGAATCAATATAATCATTCTATGAATACAACTATAAAATCTAA AAGGGACAAAATACAGATACGGATTGTACATTGGAATAAAAGTCACTTCG TACTAGACCGGGGAGATTTAAACAGAGAAGGGTTCCCCCAGTGAGTTCCA TGCCATAGTTTAAAAAGTAGGGAGTGAGGGGGCAGTCCGTCTGTTACGTA CGTGGGCCTCTCCCCACAAACTTGACAATATCAATAATGATTAAAACTGT ACATAATCAAATCTTGACAAAATTAACAAAAGAAATTAATTTTATTAAGT TAATTCTACCATAAAACGGGCCAAAAGCACTAGCCCTGTGCTACGTTCGC TCTAAGGTTCGACCGTGCAATCTGCCGTTGGCCAACGAACACATGTTCCA TTCGGGTTACCTGAGGTCACGTTGCAGGAACATGCCTGCAATTTTATGTA GCTTCAATCATTACAAAACGCCCATTATTGTATGGGGAGGGAGTGATGTA TACCGTATTTGCTCAGGAGCAAATGACGGCCTTTCTAGTTTGTTTATTTC TTCGTTGTTTGCTCCCTGTAGGTTCTGAAAGACAAGTGCACCGAGTAATT TGCTTGTTTATTTACCGATCTGCTTGTTGTTGTTTGCTTATTTGTTCGTT GTTTGCTCCCTGTAGGTTCTGAAAGACAAGTGCACCGAGTAATTTGCTTG TTTATTTACCGATCTGCTTGTTGCTGTTTGTTTATTTGTTCCTTGTTTGT TCCCTGTAGGTTCTGAAAGACAAGTGCACCGAGCGCCGCCACCAGTAATA TGCTGATTGTTTTGTTGTTTGTTTATTTGTTTGTTGTTTATCCTGCAGGT TCTGAAAGACAAGTGCACCGAGCGCCGCCACCAGCCCCGCTCCGAGTCAA ACGCCGTGTCCGTTAATCTGGAGGACTGCAAACGGGACAACAGCCGGGCT CCGCTGAGCTAAACAGGACGACAACAGCACAACGACAGAAGGAGGGCCCG TCGCCACGGGTCAAGTTAAACCTACAGGGCTCCTATAGTCTACAACCAAG CTGAAGTAATAATACGACTAAGCCTTCGCATAGCAAGAACATGATATATC CTAACCCTGTACGAAATAGANATTGTGGTACGAAATGTGTAAAAGCAATA AGAGAGGCTTCAACACTGTGCTTTTCTTAGGCATGGTTCCATACCTTCTG CACTGCCCCAGAAACTTAGACAGAGCCTGACAGTTTTGACCCGACCATAA GTAGCAGTTCCCAGACATACATGGCTGTCTGACGACATTGGATGGTCACA CTTCTAATATAACCCATGTTTCTGGTGCCAACACCAGTCACACTACCAAA ATTGGAAGTACCGAAAGTGCTGTGATGTGCTTGTGCTGGTACCACAGTTT GCTGAAAGTACTGTGGTGTACTAAGGTACTTGTACCACAGTTTACTGAAA GTACTGTGATGTACTCAGGTACTTGTACCACAGTTTACTGAAAGTNTGAA GGAAATGCTCTTTTCTTGCAACCTTCTTCAGACGGAAAGGGGAGAAAAAT GAACCGGGAAAACGTGGGGACTTTTGAAGAGGTTTGAATAGATAGATACT TAATATTGATTGATTGACTTTAAAGATATATTCCTGTGATAAGTAGACCT ACGAGAGTAGCTATCTAGCTGAAGACTGGACTATTGACGTCACTCTGCTT CTATCATAGGCACGAAACTTCCTTCACTTAGCTAGCTGTACTAGTGGAAC ATCTGTAGATAACGTATCGCTCACTCCAGGGGGAACTCACAGGGGGGACC AACAGGTGTCTGCTCCCCTTCAAGACTCGGCTGGGTAAGACAGGAACTTT GAGTGGGTCCTTAAGACATGCCGGTTTCTTGAAGTAAGAGGAGAGCAGAC AGCTGCACCCCCCGGCTAAAGTGGAATCACCCAAAGTTCTGCTGNGTAGC TCAGTAACTGTTGTTTTATTCAGCATTTCTAATGGTATTGTGCCAATCCA TATTGTGCCAGAAATACTTAAAACATGCCATTTCTGTATATTTTCATTGT AGTATTTATCAAAGTAAGTTTACCGAAGAAAACAGTGCTAGGGAGGTTAC TAAGCATTTGTGTAGTACCGCTGCATGTGCCACAATGGTTTACTGCCAAT GCCCGCAGTGCAGTAGGCTGTATTGCCATAGAAATGTAAAAATAGTCTTC CGGGAAAAACAGCTTGCTCATAATGTACAGCGGTGGTCTGTACTCTTGCA AAATGTACAAATTTGGTCGGACGAAATGTAGCAACATGACTTGCAATACA TTTACTTGCAACATCAGNCGACCTCTGAACTTTCACACCCACAGTATGCT GGGGTCACACCAGTGCTGAACTTTGACATGACAAGAGGTCACACCAGTTC TGACCTTTGACATGACCTGAAGGTCACACCAGTGCTGACCTTTGACATGA CCTGAAGGTCACACGAGTGTTGACCTTTGACATGATCTGAAGGTTACACC AGTGCTGACCTTTGACATGGCCTGACCCACTGTGTCATTTGCTGTAGAAT CATGTTCTTGGTGATAATTGTGGTACGAAATGTGTAAAAGCAATAAGAGA GGCTTCAACACTGTGCTTTTCTTAGGCATGGTTCCATACCTTCTGCACTG CCCCAGAAACTTAGACAGAGCCTGACAGTTTTGACCCGACCATAAGTAGC AGTTCCCAGACATACATGGCTGTCTGACGACATTGGATGGTCACACTTCT AATATAACCCATGTTTCTGGTGCCAACACCAGTCACACTACCAAAATTGG AAGTACCGAAAGTGCTGTGATGTGCTTGTGCTGGTACCACAGTTTGCTGA AAGTACTGTGGTGTACTAAGGTACTTGTACCACAGTTTACTGAAAGTACT GTGATGTACTCAGGTACTTGTACCACAGTTTACTGAAAGTTCTGTGCTGT GCTGGTACTTGTACCACAGTTTACTGAAAGTTCTGTGGTGTGCTGGTACT TGTACCACAGTTTACTGAAAGTACTGTGGTGTACTCAGGTACTTGTACCA CAGTTTACTGAAAGTGCTGTGATGTACTCAGGTACTTGTATCACAGTTTA CTGAAAGTGCTGTGATGTACTCAGGTACTTGTACCACAGTTTGCTGAAAG TACTGCGGTGTACTAAGGTACTTGTACCACAGGTTACTGAAAGTACTGTG GTGTACTCAGGTACTTGTACCACAGTTTGCTGAAAGTACTGTGGTGTACT CAGGTGCTTGTACCACAGTTTACTGAAAGTGCTGTGATGTACTCAGGTAC TTGTACCATAGTTAGTTGAAAATCTGTAGTCTTGGAAAATCCCCTTCCTT ATGGTTAAAGAGTAATAAGTTTACAGTACTCGGTAGCTCAGTAACTGTTG TTTTATTCAGCATTTCTAATGGTATTGTGCCAATCCATATTGTGCCAGAA ATACTTAAAACATGCCATTTCTGTATATTTTCATTGTAGTATTTATCAAA GTAAGTTTACCGAAGAAAACAGTGCTAGGGAGGTTACTAAGCATTTGTGT AGTACCGCTGCATGTGCCACAATGGTTTACTGCCAATGCCCGCAGTGCAG TAGGCTGTATTGCCATAGAAATGTAAAAATAGTCTTCCGGGAAAAACAGC TTGCTCATAATGTACAGCGGTGGTCTGTACTCTTGCAAAATGTACAAATT TGGTCGGACGAAATGTAGCAACATGACTTGCAATACATTTACTTGCAACA TCAGACATTGCAACACTGTAGCTTGATATCACAAAAGTGACAAAATCATG CTCTTCCAGAAATCAACAGGGTTCCTTCTAACTGTTTATTTACCTCGGAT ACCTTTGCACATCAATGCAGCAAACTTGTACACACTGCAGTTTGCTAATC CAGGCAGAAGTGTGGAGGTTTCAGGAGTTCCAGACGTTCTATATGACTGT TTGTAACATACGCTCTGTGAGCTAAGGGTGTGCTAAGGCATCACTGTTGA AACTGGTACAGAAGGGATGAATATGGTGTAGAAAAAGTGTTTAAAAGTTT GGACTCTCTACAGGGGAACATGGCAAAACGGAGTGGTGTTGAACAGACTA GTCAGAGCGGGTATCTCTCCTCTGGTGATGCACATATGGAATATGTAACT GTGTTTCTAACGTGAGATGATTTTGTGGACGAGATTGTCGTGACTCTTTG GCCAACATAGTTGGCACATGAGCGGTGTGTCGCCTATCTTATGACACATG AGCGGTGTGTCACCTATCTTATGACAGTTGCATGTTAGGTAGATCCATGG GTGGTAGACTGGGTCCCTCTACACCAGAAACATTACTACGTGTTCCTGCG TTTCGCACCCGATCATTCACGCTCGATGTAAGTAATTAGGCACTATTAAA ACTATTTCTCTACTTTCCTGTACATTATGATAACCGCGGACGCCAGTAAA AACCTGTCATCTCTACATGTAAAGACTAGCGGCTCCGCCCCTTAGCCGTT GCCAAAATCAATACTACCGAGGACCTGGATCCTGATTTGGTCTCATCTGG CCTAAACTTAAAGAAAACCAGTTACTGTAGATACTTGTGTCATTGTAGTC GTCATGTTAAGTCTTAAGATGTTAGAAGAAGACTCATGATCTTTTCCCTG GCCGACCTCTGACCTGTGACATCATAGAAGACGCTCCAGTCGAACAGGTG AGGTCACAGGTCAGCAGGTGGTCCTTAGGGGTGGATGGGGACTTTTTAAA GGACAGGGTACCTTGTCCTTTGCCACATGCATGTTCTAAAGGACCAGATA CTTAGTTCCTTGCGTCATACATGTCCTGAAGGACAGGGTACCTTGTCCTT TGCCTCATGTATGTTCTAAAAGAGATGGCATTTCATGTATGTCCGCCAGC CAGCCTCTATTACCGGTTGTGTGTATAACTGTGGATCTTCCAATAAAGCT GTGAACACG

Coding sequence (CDS) from alignment at Sc0000000:135885..326093+

>BlTCONS00000018 ID=BlTCONS00000018|Name=BlTCONS00000018|organism=Branchiostoma lanceolatum|type=CDS|length=798bp|location=Sequence derived from alignment at Sc0000000:135885..326093+ (Branchiostoma lanceolatum)
ATGCCTGCATGGGGGGAGTCAGATGAAGTAACGTTTGAGGTCGGATTCAA
GATACAGCTGCACACGCAAGAGGAGCCACCCTTCATTCATGAACTGGGCT
TTGGCGTGGGGCCGGGCATGCAGTATTACGTTTCAACACAAGAGCAGAGG
ATCACCTATCTGCCCGCGCCCTGGGGTCAGTGTAAGGCCGAGAACGACCT
GACCTTTGACTTTGCCAAGTACACGACGTCCGCCTGTCGAATTGACTGCG
AGACCAAGTTTGTGGTGAGCCAGTGCGGCTGCAAGATGGTGCACATGCCA
GGATCGTTTCCCATCTGCACTCCGGATGTTTATGTGGAGTGTGCCGACCA
GGCTCTCGATTTTCTGGTGAAGTCGGACAACAAGAAGTGTGTGTGCGACA
CGCCCTGCAACACAACGCGCTACAACCTGTTTATGTCTCATGTCAAGTTC
CCCAGCGAGCAAGCCGTCAAGTATCTGGCTAGAAAGTATGCCAAGCGCGA
AGATTACTTCAGGAAAAACACCCTGGTTTTGAACGTCTTCTTCGAAGCAC
TGAACTACGAAACTATCGAGCAGCAAAAGGCCTACGAGGTCGCTTCTCTC
CTCGGTGACATTGGTGGACAAATGGGCCTGTTCATAGGCGCCAGCATCCT
GACTATCCTGGAGCTCTTCGACTACCTCTATGAGGTTCTGAAAGACAAGT
GCACCGAGCGCCGCCACCAGCCCCGCTCCGAGTCAAACGCCGTGTCCGTT
AATCTGGAGGACTGCAAACGGGACAACAGCCGGGCTCCGCTGAGCTAA
Gene-mRNA-Prot
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
BlTCONS00000018-exon-Sc0000000-1564993656:135885..135945BlTCONS00000018-exon-Sc0000000-1564993656:135885..135945Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:309867..309995BlTCONS00000018-exon-Sc0000000-1564993656:309867..309995Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:310229..310250BlTCONS00000018-exon-Sc0000000-1564993656:310229..310250Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:312261..312388BlTCONS00000018-exon-Sc0000000-1564993656:312261..312388Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:315510..315660BlTCONS00000018-exon-Sc0000000-1564993656:315510..315660Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:316395..316451BlTCONS00000018-exon-Sc0000000-1564993656:316395..316451Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:317004..317157BlTCONS00000018-exon-Sc0000000-1564993656:317004..317157Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:319078..319169BlTCONS00000018-exon-Sc0000000-1564993656:319078..319169Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:320824..320903BlTCONS00000018-exon-Sc0000000-1564993656:320824..320903Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:321983..323369BlTCONS00000018-exon-Sc0000000-1564993656:321983..323369Branchiostoma lanceolatumexon
BlTCONS00000018-exon-Sc0000000-1564993656:324802..326093BlTCONS00000018-exon-Sc0000000-1564993656:324802..326093Branchiostoma lanceolatumexon
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
BlTCONS00000018BlTCONS00000018-proteinBranchiostoma lanceolatumpolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000000genomeSc0000000:135885..326093 +
Spatial Expression
in the tripal_feature_cv_term.tpl.php
Properties
Property NameValue
GeneIDBlCUFF000016