BlTCONS00000001 (mRNA) - B. lanceolatum

Overview
NameBlTCONS00000001
Unique NameBlTCONS00000001
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)

Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000000:25509..29694+

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>BlTCONS00000001 ID=BlTCONS00000001|Name=BlTCONS00000001|organism=Branchiostoma lanceolatum|type=mRNA|length=4186bp|location=Sequence derived from alignment at Sc0000000:25509..29694+ (Branchiostoma lanceolatum)
GTGCGAAAGCGTGGATTTATGACGGAGGGAGACCCTCGGTTATCGGACAG CCATCGCAGCAGATACAGCCCGTGCGTCAATCTCCCCCCAGTTAGCGAAT CGACAGCCTCTCGCGTCCCCCCGTCCCGACGAAGGCCTCCTCATCCCTTA TTCGCTCCTGGACCGGTTCCTCCGTGGGCCCCTCTCCACCGCGCGTCTGC CTGAAGCACCTGCTAACGTCCGGATTGCAGCCGAGTTGCCCCGTCTCTAC ACCAGGGCCCCTTCCCAGCGTGGTGCATCTCCACTGTGAGTGTGTAGGGT CTGTCACCACCACCAGAAGCATCTGCTACTGTAGTGGATTGCATCTCTCT ACACCAGGCCCCACCACTGTGAGTGTGCAGGTATTCACCACTACTGCGTG TGTGTTTAACACTGCGAGTGTGTTTAACACTGCGAGTCTGTGGAGTCAGT GTGCACCGTCCGTGTGAGCCACACTGGAGCTCAGCCCTGCTGATTTGATG CGGAGCGGCACACCTCCGGAATTCTGATCCGAGCCCATTCATTGGCCCGT CTCCATTGGCCCTGCACCAGCCTGCCGTCCTGTGGCAGTTCTGTAGCGAT CCGGCATCGTCACATTTGTAGCAGACACTGTAGCAGTGCAGTTAGCAGTC CTGTGTAGCAGTCCTGTGTAGCAGTCCACTGTAGCCGTTCTGTGGCCACC GAAGCTCCGCTGGAAAAGGGAAAGTTCTCTCTCCACCAGGTAAGCCAACT TTGCTCCCATCTAACCCTCCGACGGGGGAAAGCCGCTGAGAATTCCCGGC CGTGCAGTTTTAGGGAATTCCCGGTAGTGTATGTACATCGGGCTGAATTC CCGGTAGTGTATGTACATCGGGCTGGTCCCCTGGGGCTGGAATTACAATA TCAGCCCGGCGTGCTCAGTTGGCTGCATAAGTGCTGGAGGGAGGCAGTGC TCTGTTCAGGTGGGTTATCAGCGCAAATTTGGGCCAGGTTTCCTGTCGAG TGTTCAGGTATCCTCTCTCTCTCTAGCCTCGTTTGCAGGCTCTATGAGTC AGGCTTTATCCTGATGGCATGGTCAGTTCTCTTGCACAGGATTTCCTACC CAGTGGCTAAATTCTATTGCACTCAGTTTCTATTCCATTACACGTACGAG GCCACAGCGAACTGGGTGCAGCATAAACCGTGTGTAATTGATTTGCCGTC AGAAAAAAAGCTTTTCTCTGGCCTCCTTAGCAGGCTTGTCAGGCTTTTAT TCTGATGGCCTGTTCAGTTCTATTACACACGGTTTCTGTTGATATTATTG CACAAACAGAGCACAGCTACAACTGAGTGCAATAGAAACCCTGTGTGATA GAACTGATATAGAACTGAACTGAGCATGACATGTAAACTGTAGTCATTTG ATGAAACATCATAATTCTATATGCATATAAGCACTTACCTAAATGTTTTT ATGGGACTACTTCCTTGCTTACTCAACTGAACTCACTTTTACGATGAAAT GCCTTTAAGTGTTTAGTCAATGCTATGATTGTGATTTTACATGCAAATTT CATGGAGCACATCTATGTAAATACCAGCCACTGATAAGTCTGCCAGATGT GTAGTAAAGTTCCAGTCCAATCTAGCATGCCATCCGAAAAAAAGCCTGAC TCAAAAAACTAATAGGCTTTTCTTTGATGGCCTGTTCAGTTCTAGTGCAC TCGGTTTCTATTATATTTCACATGCAAGGCCCGACACAACAGACAGTGCA CTAGAAACCCTGTGTAATGTGTTGATAAAACAATGTTACGTCCGTTTGTT TATAAATCATGTTATTCTGATGAAGCCTGTAAAATTAGCCTTGATAGAGC TAAAGTGTATTTTTAAAAAAGACAAAACAAACAAATATATAGAACTGATC AGCCATCGGTAGAAAAGCCTGACTTGAAGAGCCTGCTCAAGAGACGACCT CTTTCCACCTCGGGCCTCACCAAGACTATTTCTTGGTTGTCGGATTTTGA AAAGTACCGCTAATTCGGGATACCAACATGACACCAGAGTCTGTAGAGAG TTTAGAATCAGCAGTCTGAACACCCTGCAGCTGCATTCAGTCTTTCTTCA ATCCTCCACAGTTCCCGGGACTGAAGAGTGTCAGTTTCCAGTTTTCCTCC AGCCCTCTGTTTTCATGATGTGTCCTTTTGCTAAAATTCCACATAAAACT GAACCAACAAATTAAATTTGTGTGGCCTCAAATCTATTTCTCAGACATTC TGAAGACAAAATTTTGATGAAGACAAATGCCTGGGAGAAAAATGCCCCAC ACGACACTTTACAATATTTACTCCCTGAAACTGTGTGTACGAGGGTGCAG CCCTCAGACTCTGTTTTCGAAGTAAATTTCAATCTAGCATTATCTTTATA ATCCGAGAACCAAAAGAAAACTTGGTGTGGAGTACGAGTCGGGCTGCTTC CTGACAGCATGTACAGAAGGAAAAGCCTGATTTGTAGAGCCTGCTGCATG AGGACTTTTTGTACACTGTAAAAGGCCCCGGTGGGAGACGAGTGCTCGCC TCTCCCTCCACAATGCGGTGCCAGAAAGTGGCCCACAAGCCAGGCTGTTT CCTGACGGCATATTCAGAAGGAAAAGCTGATTCTTAGAGCTTTCTGCTGC CCAAAACAGCACCGTTAAAGGCCCTGGTGGGAGATGAGTGCTCGCCTCTC CCTCCGCAGTTTTCCCCCAATCCTGTGCAGAAGTGGCCTCCGTGGGCTCC AGCCCGCGATTATCGCTGCAGCGTAATCCGTAACGTTCGGCTGCGCTGAA GGCGGCAGTGACAGATGATCGCCTGTCCCCGATACTGTTGATGCATCAAT ATTTATATCCTGTGGCTGGAACGCGCCTCCGTGGAAATGTCATGTCGCTC GTTCCCCAGTGTCTAGGATCGACCTCCATTCTCATTAGGGCCACGTGCGC TTTTTATAAATTGTCCCATTTCCAAGAAAAAGCGAAACCAGGCTCAGTTT GTCTTCATTTTCTTTGTTTTCTTGTACCAGCTCTGTGGAAATGCCATGTT GCTGAAATCGTCCCATGTCCAAACTTGATGCAAAACTCAGCATTTCTGCA TTTTCTTTGTTTCTGTTATATAACATCTGACAAAAGGTCATGTTACTCTT TCCCCGGTGTCTCGGACTGACCTACAGTTCTGTGGCCATGTGAAGCATGT GAAAAACTATCCTGTGTTCAAACGAGATGCTAAATCTTGCCATGATTGTC TTAATTGTCATAATTTTTCGTTGAAATGGTTTCATGGCCACGTGAATCAA GCAAATTTCAAAGCTAAAAAAAACATGCCCAGATTTTATCTGTAGTTGCT GTGCCGGCTAAACTACCTCTTTGTCTTCCTTTCTGCACTTAATTTCTACC CCTCCGTCTAAATGTTCTTCCTCTCCAATGTCTAGGATCACCTGCAAGTT CGTGGCCACTTTAGCCGCTCTAACCTACAAGCTACACGCTAAAGACCGGA TTTCTCCCTGGTTCCCGCGCCGTTAACCGCCACCCTGGAGCCCCAGTACG GAATCAACGCCGCAGAGTTTCGCGACCCTGCCGAGTTCCGCCCCGGATAC CGTTACCGGGAAGCAGGCAGCATGTCGAGCTACGAAGACAACGAGCCGAA GGCGTCCGACATCAACGTGTTCGCTGGGAACGCGACGATGCACGGCATCA GCCACATCTTCACGGAGGGCTCGTTCTCGTTCCGGCGCTTCCTGTGGGCG GCTGCGTTCCTGATCTGCTTCGGGATGGTGTCGTACAACGGGTACGACCG CGTGATGTACTACCTCTCCTACCCGCGCGTCACCAAGCTGGACGAGCTCG AGGCCCAGATGATGAACTTCCCCGCCATCACCATGTGCAACCTCAACCCC TTCCGCTTCTCCAAGGTCACCAAGGACGACCTCTGGCAGGTCGGCCAGGC CCTGGAGATCCTCGACGAGAACAAGAAGCTGGCGCACTCGGAGTTCGTTG ACCCGGAGCACCTGTCCACGCTGCGCCGGCTGGCGGAGTTCGGGCCGGGC TACGTGCCGAAGAACAAGGACAGCTTCAGCATGAAGGAGTTCTACAACCG CACGGCGCACCAGATCCAGGACATGGTGCTGGAGTGCAGCTACCGCGGAA CCAAGTGCAGCTGGGCCAACTTCACTGTGGTAAGTC

Coding sequence (CDS) from alignment at Sc0000000:25509..29694+

>BlTCONS00000001 ID=BlTCONS00000001|Name=BlTCONS00000001|organism=Branchiostoma lanceolatum|type=CDS|length=564bp|location=Sequence derived from alignment at Sc0000000:25509..29694+ (Branchiostoma lanceolatum)
ATGTCGAGCTACGAAGACAACGAGCCGAAGGCGTCCGACATCAACGTGTT
CGCTGGGAACGCGACGATGCACGGCATCAGCCACATCTTCACGGAGGGCT
CGTTCTCGTTCCGGCGCTTCCTGTGGGCGGCTGCGTTCCTGATCTGCTTC
GGGATGGTGTCGTACAACGGGTACGACCGCGTGATGTACTACCTCTCCTA
CCCGCGCGTCACCAAGCTGGACGAGCTCGAGGCCCAGATGATGAACTTCC
CCGCCATCACCATGTGCAACCTCAACCCCTTCCGCTTCTCCAAGGTCACC
AAGGACGACCTCTGGCAGGTCGGCCAGGCCCTGGAGATCCTCGACGAGAA
CAAGAAGCTGGCGCACTCGGAGTTCGTTGACCCGGAGCACCTGTCCACGC
TGCGCCGGCTGGCGGAGTTCGGGCCGGGCTACGTGCCGAAGAACAAGGAC
AGCTTCAGCATGAAGGAGTTCTACAACCGCACGGCGCACCAGATCCAGGA
CATGGTGCTGGAGTGCAGCTACCGCGGAACCAAGTGCAGCTGGGCCAACT
TCACTGTGGTAAGT
Gene-mRNA-Prot
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
BlTCONS00000001-exon-Sc0000000-1564993656:25509..26247BlTCONS00000001-exon-Sc0000000-1564993656:25509..26247Branchiostoma lanceolatumexon
BlTCONS00000001-exon-Sc0000000-1564993656:28944..29694BlTCONS00000001-exon-Sc0000000-1564993656:28944..29694Branchiostoma lanceolatumexon
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
BlTCONS00000001BlTCONS00000001-proteinBranchiostoma lanceolatumpolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000000genomeSc0000000:25509..29694 +
Spatial Expression
in the tripal_feature_cv_term.tpl.php
Properties
Property NameValue
GeneIDBlCUFF000001