Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

gene:BL97473 (gene) - B. lanceolatum

Overview
Namegene:BL97473
Unique Namegene:BL97473
Typegene
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

gene from alignment at Sc0000011:5263691..5269370-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>gene:BL97473 ID=gene:BL97473|Name=gene:BL97473|organism=Branchiostoma lanceolatum|type=gene|length=5680bp|location=Sequence derived from alignment at Sc0000011:5263691..5269370- (Branchiostoma lanceolatum)
CAATGTTGAACAAGGTACTGTACAGTGATTCAATAACAAACATAGCAAAC AGGAACACGCGACTATTTTCTGTAACAAACATAACTTACCTCGGCCTGTG TACCAGTCTTTCTGTTCAAACGTCTGGATGTGAATGTAGCAGAAAAAGAT CAGGTCACATGATCCAAATTTGGGGCGAAAATCTTCCTTCCTGCGGCCTG TTATTACAGAACGTAGACAATCAGTAATTCAGGGGTGTACCCCGGTTCTT CTTTGTACCAGGATATCCTTAGATCGTCCGTAATTTGCACGGTTTGGCAG AAAATTTGTTGACCTTTTCTCAGTTGCCGGGACGCTATCAGCTGAAAAAT GGCGCGAAAGAACAACGCTGACCCAGACGCCTGTCGCTGATTGGTCCAAA TTATGACGAAATCTCGCCGTGATTGGTCAGCAGTTTCGCGCCAGGCCCCA GAATCTGAATACTTTGTCTGAAGTATGTAGCTAATCTTCAAGCAGATGTA GGGTCATCATTCTCACCATCGTATGGTCCTGCCCAGTGTTTTATGTATGT TTGATGCTTTTTATACGTCTGGTCCGCGTTTTCCTCTCTTCCCCTATCCA ATAGGAGACTTATTAGATAGGAAGCACAATAAAACAGTTGACTGGATATC TATGGATCGTTACCTTAGGAAAATCTCTGACAAACTAAAGTTAGAGTCGA GTTGATTCCGCCAGGGTACTAGTAGTTAGTAATTCATTAGGTTAACTATG CCTGGTTGATGCAAGGAGGTTATAGGGACCTAAAACATTCTTAGCTGATG CAAGGACCAAGGAGGCTATATATTTAACCTCCTCGCAAGGACATTATAAA CTATATAATGTCTTTGGTTGATGCTATGATTAGCGTATTGGTCCCGACAT ATAATTATAAAGGGGGCGTGTCGTATAAAAGACGAATGTCACTTTATTAT GGATTTGTTAACGGTAACATGATAAACGCTCAAAGCTTTGTACCTTTCTA TCCGCTTGCTCAAAACAATCTAATGATACAATCCAAGTCCTTGTACAATC CTATTAATTTCAATTACATTGTAGGGGAAGATGACCATTACTGTGTACAG GTAGGTAAAAACGTCACGGACTGTTTCGATATAACAACGAGAGGTCTAAA CAAACGACACGTTAAACTCAACATGTTGATATATTCATATACCTGTTTAT ATGTTAATTCATGAGCATCCACTTGCTTGTTTGTATGTGTAATTGTCGGA AGACCTCGCGAAAGTAGCCGCAGCTTGCACCTTGTGTCGATAAACTGAGG TTCATATAGATTTGCATATAATGAGGGGACGTGTCCGCTCTGATGCTGAA GCACAAAGAACGATCGAAGCGTAAACAGGACAGGTCAGATTCCAACACGC CCGGATTCCAGTCCTTTAGACAACTTAGCAAGGTAGGGACATTTTGCCAA ATTCGCGGGAAATTTTGCAACTTTTGGTGTACCTGACATAAATCCGGGTT TAATACATAAATCCGCCACTTTGAAAGAACAGTGGGGTTGAGAGATCTCT AGTACAACACCCCCAGGTATGCAATGTTAAGATATACAGGAGTGGATTGA ACTGGGGGACGTTGGGTTGGAGATCTGTTTGGACGTATCTTTTCAGGGTG GAATTATGTACCCTCGTGGAATTATGTTAGTATATGTTTGGTGTTGCTCA ACAATGATTGAAGCGTTTGTAAGCGGGATACTACCGTGCCATATTTTACC GTCCCGTGCATGTGTCGTCTGACATTGTTGTTTGCTCAGACAGAACCATC ATGGCGGTGAAGGCAGCCCTAATGTTTGTGGCGGTGGCGGTTCTGCTGGC GTACTACTGTGACCAGCCTGTTCCAGAGGGCATCGCAGAGCCACGGATGT ACGCAAAAGTGCAGGGGATGGTGTTCAGAATATCGGCGAACCTGGTAAGG GTCAGGTCACGTACGTCGTACGACCGTCGTGCGATTTTAAGCTTTACTAC TGACGCATGCTGACGGTGACATTCTTGGGATATAGTTACATGTCCGGCAA AATTTAGCCGTCTTAAAGGTCTTATAAGATTATAAAGGGCTGTCATAGAT CCTAGCTTGTCGGTGCTTGGTTCTGTTGCAGCCTGTAAAATCGTACTCTC CAAGCAGAGGTTAAGAGTGGAGAAGATCGTGACCTTTTTACCCTCTGCCC CGTTTTTTGTCGGCCAAACGGGGCCGATAAAAAGGTCATCTCCTTGGCCG ACGAAAAACGGGCCAGAGGATAAAAAGGTCACGATCTCCTCCACTAACCT CTGCTTGGAGAGTATCAAAATCGCAAGACGATTCTACATTCTACATTCTA GTCTAGTCTACCTCAGTACTTGTTGTTTTGTCGCCCGGTCTCTCTTTAAT ACCACACCCACCGTTTGTTTGTTTAACCCTTATCTATTTATGAGAAGCTC AAATCGGCCGGCAGGTCGCTTTTCATTGAGGTCATGAGGGAAGAGGTAAG GGTCAGACAAGATACTCGTATAACAGAGATACGGATTACATCATTTTAGT CCTAATAAATCTATCAACTTGATATTGCACTACTAGCCCTAGGAGGGGGT CATTAACCTCCGCCAGCGAGAGATGTGTAAACACAGGCTAATTGTAATAC TAGTAGTTACGCAATACAAATCGACATCTTCCTTCATAAAGAAGCAGACC ACTTTTCGAATGTACAATACTGTTTAACAAAAACTGAATACAAAAATTAA AACTTGATTAAACCACAGAAGTTTGATCAAGCCTTTGTTATATTCTTCTG ACCTAATTCGCTGTGCTTGAAAGTGCCGAGGCATATTGATTATTGTGAAC AATTTTTTAAAATATATTCATATGGTTTTTCGTCTCATTTCTCCAGGCTA GAATCGGAGAGTACCTCGGTGTAGGTACGGAGCCTCAGAACCTCCGGTCA GTCATGGGGGCAATAGTAAACGTTGGTCTGAAGTTAAAAGGCAGTTCTTA CCGCGAGGGATTGAAGGTCACAGACACCATGTTTGACGGGGTCAAAGTCC GTGTGTACGAGCCAGTGTCAGCAGCACAGAGTAGCAGCAAAGTGCCGGGG CTGGTGTACTTCCACGGAGGGGGCTGGGTTATCCTGAATGTCGGTAAGAT CTTCGCTTATTGATTTAGATCCGAGGTAAAGGAAAATCTAAATATAGCCC CATAGCCTTTTTGAGGCCGTTGCGGCAGTAGCTCCTATATCCTATAGGTT GTTATCAAGTGTATCTAGCTAGGGTATGGTATTGGAAGGCGAAGCCCATC CCTCTTCTTCCACCACCTTTTACCTACCAAACCGAAGTCAGGTAGACGTA TGCACCTGGGTGGAGTGAGGAAAGTCGTGTAAAGTGCCTTTCCCAAGGGC ACAACATCGGTGGCATGTCACGTGATTAGAACTTAGGACCTCTGTGTTCT GGGCCAAACAGCCTAACCGTTGCGCCAACAAGACGCCACAACCTTAGGAC CGGAGAAAAGAATCCAAAACGCGTGAAATATTTATCTGAATTGTTGTTTG ATATATTTTCACATTTTCCCGTTTCTTTCCCACCTTTACATGACCACATG CTACGAAATACTCGGAGAGAGGACAGAGCATATATCATAGACATACCTGC ATATTCTTATATGGATAGACATGCCTGAACACCCCACACAATACTGATCT CAGCCTGGTGTTGTTTACAGACACCCACGATCCGCTAACGGCTCATGTTG CCAAACAACTGGGGACTGTTGTTGTGTCCGTGGAGTGAGTATCTTAATGA TGTTTTTATGTACCCCACAGTAAAATTCAAACGCAATTCTAACTACATTT GTATCTCATAGGTAATTGAATCACAAGGGTCGACCTTGTCAAGCACCCCG TTGGTTTCATTGGATAGGTCGTGACATAACTCCGGACGTTCATGTAATGA TCTTTATTTGCAAAGACATGCCCGAACTCTAATTGCAAGGGTGCACACAG ACACGATAACATAAAAAAAGGTTGTTTGATTGGTTAACAGCTGGTAAGAG TCCACACCCACAAAAGCAGAAACCAAAGGGTAGTTTAGCAGAACTTCACC GAGGTATATTGTCTAGGCCGCAGGCGTAGGAGAATGAGCTTTGGTTGAGC TGCATGGAACTCGTACCTGCGGCGGCTGGCAGCAACTCCCTCTGTTTTTG ATAAACAACAAACTCTAGTCTATCAGCTAACAGACATCGATATCTTCCCC GATCATCTTACAGCTACAGACTCGCTCCTGAGCACGTGTTTCCGGCAGCG TTTGATGACAGTGTTGCTGCCACAAAGTTCTTCCTCCAGAATGCAGAGAA GTACAACGTTGATCGCACACGTATCGGCATCAGCGGGGACAGTGCGGGAG GGAACCTTGCTGCAGCCGTCACTCTCGCACTCGCTAAAGAAGAGGATCTT CCGAAGTTAAAGACACAGGCGCTCATCAACCCAATCTTGCAAGCCATAAA CTTTGAGACGCCCTCCTACATCGCCCATGGTCACCTCAACACTCTAACTA AAGATAAAATAGTGTCGTTTTGGCTGTGGTATCTGAACAATGACCTGTCT TTCAAAAAGGTGTTTGAAGCCAACAATCACACAGGCGTGCAGATAGAGAA ATCTCAATACGCCGGGTACGTGGATCCCAAAATGGTCGACGTTACGACCG TTAAGAAGGAAAATATCAAATTTCCTGAGATTCCGAACATCGCGACCATT TTAGATCCCCATTTTGCCCCATTAATGGCAGACGACGCTGATTTGAAAGG TCTCCCACCGACGTACGTGATGACGTGTGAGTACGATGTTTTGAGGGACG ATGGTGTGATGTACGCCAGAAGGCTAGGAAAGGCTGGGGTTGAGGTCAAT CATGATCATTATGAACATGGCTTCCACGCATTTTTAAACAGCTTTGATGA TTATGAGTTAGCAGGTATTGCTATGCAGAACTACCTAGCGTATCTAAAAA AGATCCTATAAAATCAAGATATGATGATAAAGGCTCAAATCTGTTCACAT TTCATTCCGCTTGATCCAAAGAATCAAATGCAATTAATCCTAATCGCAAG TACATTCTAGGAGGAGATACTGTACCTCTTTCATACTTATGTCATGTCCT GCAACATTATCTGAATATCTAGACCAATATATCTATACATCTTAGTCATC TATGCAAAAAAGAATCCGTGAAATAGCGATTTGTAATTGTATAATTGACA TATACGACTCCCTATTGTATCTGCTATTGATATTATCTACCTCTGACAAT ATTATATAGATGGAGCATTGTACAGCCTAGAACCTAACCATTGTATAGCA TAGAACCTCCCTGTAGCTTTTAGTAGTTTGATATAAGTAGCCAGTAGTAT TTTATTGTTTGCCTTACATTGTACCTGATACAATCGTTGTGCAATGAACT TTGACTTTGACTTGACTATATCTGCTAAATACATCAAAGAATGTTTAGAC CTTAGAATAAGTACACTAAACTAAAAGTGTTGATTTATCTATCTACTTGT ACGTATCCATTTGTTTGTCTGTATGTATGTATGTCTGTATAGATGTAAAA GACCGTACAAAATACGTCGCTGTACTTTAGTGTCAATAAAGATTTGCATA TAAGCCACGTCAAGTCAACTTCGGCCACAG
Gene-mRNA-Prot
The following mRNA feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
transcript:BL97473_cuf12transcript:BL97473_cuf12Branchiostoma lanceolatummRNA
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
transcript:BL97473_cuf12transcript:BL97473_cuf12-proteinBranchiostoma lanceolatumpolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000011genomeSc0000011:5263691..5269370 -
Properties
Property NameValue
Logic namegff3_genes
Gene idBL97473
Biotypeprotein_coding